- Email: [email protected]
ABL1 rearrangement
Cancer Genetics and Cytogenetics 185 (2008) 37e42
Establishment and cytogenetic characterization of a human acute lymphoblastic leukemia cell line (ALL-VG) with ETV6/ABL1 rearrangement Joerg Baeumlera, Karoly Szuhaib, JH Frederik Falkenburgc, Marianke L.J van Schiec, Oliver G Ottmanna, Bart A Nijmeijerc,* a Department of Hematology, JW Goethe University, Frankfurt am Main, Germany Department of Molecular Cell Biology, Leiden University Medical Center, Leiden, The Netherlands c Department of Hematology, Leiden University Medical Center C2R, PO Box 9600, 2300 RC Leiden, The Netherlands b
Received 1 April 2008; received in revised form 25 April 2008; accepted 2 May 2008
Abstract
Fusion kinases (FK) like BCR/ABL1 mediate leukemic transformation and represent therapeutic targets. Fusion of ETV6 (ETS translocation variant 6, previously known as TEL) to ABL1 due to t(9;12) has been observed in various hematological malignancies. ETV6/ABL1 and BCR/ABL1 FK display similar activity but they may not be identical in function. Here we present the generation of an ETV6/ABL1 positive human acute lymphoblastic leukemia (ALL) cell line, ALL-VG. The cell line expressed ETV6/ABL1 fusion transcripts and displayed sensitivity to imatinib with an IC50 of 0.1 mM. Karyotyping did not reveal overt t(9;12), suggesting a cryptic translocation. Fluorescent in situ hybridization and array-based comparative genomic hybridization were performed to characterize the rearrangement. ETV6/ABL1 fusion was demonstrated to result from insertion of a duplicated 300 to 1300 kb region of 9q34 that contained the distal portion of the ABL1 gene, into the ETV6 locus on 12p13. With this insertion, an 1150 to 1750 kb region of 12p13 that contained the distal portion of the ETV6 gene as well the cyclin dependent kinase inhibitor (CDKN ) 1B gene was lost. Furthermore, the cells displayed a del(9)(p21.1~p23), typically associated with loss of CDKN2A and CDKN2B. The ALL-VG cell line may serve as a tool for the study of ETV6/ABL1. Ó 2008 Elsevier Inc. All rights reserved.
1. Introduction Fusion of the non-receptor tyrosine kinase gene ABL1 to BCR mediates leukemic transformation and is the hallmark of chronic myeloid leukemia (CML) and a subset of acute lymphoblastic leukemia (ALL) [1], for which targeted therapy with the selective abl kinase inhibitor imatinib has become standard treatment [2]. Infrequently, ABL1 fuses to ETV6 (ETS translocation variant 6, previously known as TEL), a member of the ETS family of transcription factors [3]. ETV6/ABL1-fusion has been associated with myeloid as well as with lymphoid leukemias [4-7]. The BCR/ABL1 and ETV6/ABL1 fusion kinases (FK) mediate increased The ALL-VG cell line has not yet been submitted to any tissue culture collection. For inquiries regarding the cell line please contact Dr. BA Nijmeijer, Department of Hematology, Leiden University Medical Center C2R, PO box 9600, 2300RC Leiden, the Netherlands. * Corresponding author. Tel.: þ31-71-526-2271; fax þ31-71-5266755. E-mail address: [email protected] (B.A. Nijmeijer). 0165-4608/08/$ e see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2008.05.001
intracellular phosphorylation levels, confer growth factor independence, and are inhibited by imatinib [8-10]. However, clinical manifestation of ETV6/ABL1 and BCR/ABL1 positive leukemia’s can differ, suggesting that these FK may not be fully comparable in function [11]. Studies on the ETV6/ABL1 FK have been restricted to murine transfection models since no human leukemia cell lines were available that endogenously express this FK. In this study, we present establishment and characterization of an ETV6/ABL1 positive human ALL cell line, ALL-VG.
2. Case Report A 30-year old male was diagnosed with Philadelphia chromosome negative ALL of common type, with central nervous system involvement and a leukocyte count of 129x109/L. Conventional G-banding revealed a 45,XY,del(1)(q42),-9,13,add(16)(p1?3),þmar karyotype in 20 metaphases. Induction therapy resulted in hematological remission and
38
J. Baeumler et al. / Cancer Genetics and Cytogenetics 185 (2008) 37e42
autologous stem cell transplantation followed. Two months after transplantation, the patient died of relapse.
3. Materials and methods 3.1. Establishment of the ALL-VG cell line Primary leukemic cells were obtained by leukapheresis at the moment of presentation with infirmed consent. Leukemic cells were enriched by ficoll density centrifugation and placed into culture in a previously developed serumfree medium [12]. Viable cell density in the culture was maintained between 0.5 and 2.0x106 cells/mL. For in vitro proliferation assays, cells were incubated in the presence of various concentrations of imatinib (kindly provided by Novartis (Basel, Switzerland) or in its absence (controls). Seven days later, numbers of viable cells were counted. IC50 was defined as the concentration of imatinib at which viable cell numbers were 50% of those observed in controls. 3.1. Flow cytometry Expression of surface markers was analyzed using FITC-conjugated anti-human CD10, CD19, CD20 (Becton Dickinson, Franklin Lakes, NJ), anti TdT (Beckman Coulter, Mijdrecht, The Netherlands), anti immunoglobulin heavy chain (m)(Nordic, Tilburg, The Netherlands) and phycoerythrin (PE-) conjugated anti-human CD19, CD20, CD34 (Becton Dickinson), and anti CD79a (DAKO, Glostrup, Denmark). Intracellular expression of CD79a, m, or TdT was determined after permeabilization with FACSlysis solution (Becton Dickinson). Samples were analyzed on a FACScan flow cytometer (Becton Dickinson). 3.2. RT-PCR Expression of ETV6/ABL1 transcripts was analyzed by RT-PCR. RNA was extracted from 10x106 cells using Gold TriFast reagent (Peqlab Biotechnology, Erlangen, Germany) and cDNA was synthesized from total RNA using the SuperScript III First-Strand Synthesis SuperMix (Invitrogen, Carlsbad, Ca). A first round of ETV6/ABL1 PCR was performed with ETV6 exon 3 forward (5’-AAGGCC AATTGACAGCAACACG-3’) and ABL1 exon 2 reverse (5‘-GCACCAAGAAGCTGCCATTGAT-3’) primers. A second nested round was preformed on the product with ETV6 exon 3 forward (5’-AAGCTCTCCTGCTGCTGA CCAAAG-3’) and ABL1 exon 2 reverse (5’- CTCCAG ACTGTTGACTGGCGTGAT-3’) primers. PCR products were analyzed by agarose gel electrophoresis. Amplicons were extracted from the gels and sequenced at Seqlab (Go¨ttingen, Germany) using the nested primers. 3.3. Cytogenetic characterization Combined binary ratio labeling fluorescent in situ hybridization (COBRA-FISH) and BAC-FISH were performed as
described elsewhere [13,14]. Comparative Genomic Hybridization Micro array (Array-CGH) was performed as described previously [15]. Briefly, slides containing triplicates of 3500 large insert clones spaced at 1 Mb density over the genome were produced. The large insert clone set used to produce these arrays was provided by the Wellcome Trust Sanger Institute (UK). Information regarding the full set is available at the Wellcome Trust Sanger Institute mapping database site (http://www.ensembl.org/). DNA was amplified, spotted on the slides and hybridized. Target imbalances were determined based on log2 ratios of the average of their replicates, and sequences were considered as amplified or deleted when outside the 60.33 range.
4. Results Culture of primary cells resulted in a continuously proliferating cell line, designated ALL-VG. The cell line doubled at a constant rate every 2.3 days for more than one year, without any sign of exhaustion. Long-term cultured ALL-VG cells (cultured continuously for over 6 months) displayed the same common-ALL immune phenotype as the primary cells at diagnosis. Both expressed CD10, CD19, CD20, CD22, CD79a, and TdT, but not CD34 or cytoplasmic m. To specify the karyotype in more detail, COBRA-FISH was performed on primary cells and on the ALL-VG cell line. ALL-VG cells and the primary cells displayed the identical karyotype 45,XY,der(1)t(1;9), der(9)t(9;13),-13,der(16)t(16;22). In a proliferation assay, ALL-VG cells revealed sensitivity to the bcr/abl inhibitor imatinib with an IC50 of 0.1 mM. RT-PCR verified that the cells were BCR/ABL1 negative. However, RT-PCR with primers specific for ETV6 exon 3 and ABL1 exon 2 revealed two amplicons of ~480 and ~1024 nucleotides, respectively. Sequencing demonstrated that these amplicons represented a fusion transcript of ETV6 exon 4 to ABL1 exon2, and a fusion transcript of ETV6 exon 5 to ABL1 exon 2, respectively (Table 1). The same transcripts were expressed by the primary cells. ALL-VG cells did not display an overt t(9;12) implied by ETV6/ABL1 fusion. To localize the rearrangement, metaphase FISH was performed on ALL-VG cells using probes that correspond to regions proximal and distal to the ETV6 or ABL1 genes. FISH indicated that the rearrangement was the result of an insertion of a duplicated distal ABL1 region into an otherwise normal looking chromosome 12, replacing the region containing the distal part of the ETV6 gene (Figs. 1A-1E). Counter painting with a chromosome 9-specific probe revealed that one intact ABL1 region was localized on the normal chromosome 9. The other intact ABL1 region was localized on the der(1)t(1;9), that apparently contained only a small part of 9q (Fig. 1F). Array CGH revealed that a 300 to 1300 kb region was gained that contained the distal part of the ABL1 gene on
J. Baeumler et al. / Cancer Genetics and Cytogenetics 185 (2008) 37e42
39
Table 1 Fusion gene sequences detected by PCR Detected sequences
Alignmenta
GTGATGTGCTCTATGAACTCCTTCAGCATATTCTGAAGCAGAGGAAACCTCGGATTCTTTTTTC ACCATTCTTCCACCCTGGAAACTCTATACACACACAGCCGGAGGTCATACTGCATCAGAAC CATGAAGAAGaAAGCCCTTCAGCGGCCAGTAGCATCTG
ETV6 exon 4 ABL1 exon 2
GTGATGTGCTCTATGAACTCCTTCAGCATATTCTGAAGCAGAGGAAACCTCGGATTCTTTTTT CACCATTCTTCCACCCTGGAAACTCTATACACACACAGCCGGAGGTCATACT GCATCAGAACCATGAAGAAGATAACTGTGTCCAGAGGACCCCCAGGCCATCCGTG GATAATGTGCACCATAACCCTCCCACCATTGAACTGTTGCACCGCTCCAGGTCACCTA TCACGACAAATCACCGGCCTTCTCCTGACCCCGAGCAGCGGCCCCTCCGGTCC CCCCTGGACAACATGATCCGCCGCCTCTCCCCGGCTGAGAGAGCTCAGGGACCCAGGC CGCACCAGGAGAACAACCACCAGGAGTCCTACCCTCTGTCAGTGTCTCCCATGGAGAATAATCAC TGCCCAGCGTCCTCCGAGTCCCACCCGAAGCCATCCAGCCCCCGGCAGGAGAGCACACGCGT GATCCAGCTGATGCCCAGCCCCATCATGCACCCTCTGATCCTGAACCCCCGGCACTCC GTGGATTTCAAACAGTCCAGGCTCTCCGAGGACGGGCTGCATAGGGAAGGGAAGCCCA TCAACCTCTCTCATCGGGAAGACCTGGCTTACATGAACCACATCATGGTCTCTGTCT CCCCGCCTGAAGAGCACGCCATGCCCATTGGGAGAATAGCAGaAAGCCCTTCAGCGGCCAGTAGCATCTG
ETV6 exon 4
a
ETV6 exon 5
ABL1 exon 2
Aligned to the human genome using the Ensembl database (www.ensembl.org).
9q34 (Fig. 2). In the microinsertion, an 1150 to 1750 kb region distal to the ETV6 gene on 12p13 was lost. The deleted region on 12p13 that was involved in the rearrangement also included the cyclin dependent kinase inhibitor (CDKN ) 1B
locus. Furthermore, CGH revealed del(9)p(21.1-p23), typically associated with loss of the tumor suppressor genes CDKN2A and CDKN2B. The breakpoint on 9q involved in the t(1;9) and t(9;13) could not be identified from CGH, as
Fig. 1. BAC-FISH confirmation and localization of cryptic ETV6/ABL1 rearrangement in ALL-VG cells. To confirm and localize ETV6/ABL1 rearrangement, metaphase BAC-FISH was performed on ALL-VG cells using probes specific for the proximal and distal regions of ETV6 and ABL1. On both chromosomes 12, proximal ETV6 signal was observed (A). On one of these however, the distal ETV6 signal was lost (B, arrow). Two proximal ABL1 signals were observed (C). While two distal ABL1 signals co localized with the proximal ABL1 signals, a third distal ABL1 signal was observed (D, arrow), co-localizing with proximal ETV6 on chromosome 12 (E, arrow). Whole chromosome painting with a probe specific for chromosome 9 (WCP9) revealed that the intact ABL1 regions were located on the normal chromosome 9 and on the der(1)t(1;9), respectively (F, arrows).
40
J. Baeumler et al. / Cancer Genetics and Cytogenetics 185 (2008) 37e42
Fig. 2. Comparative genomic hybridization array (CGH). To map cryptic aberrations, array CGH was performed. Random amplified Cy3-conjugated ALLVG DNA was hybridized against amplified Cy5-conjugated female normal DNA to an array of 3,500 known clones that spanned the whole genome. Results were transformed to signal ratios where a ratio larger than 0.33 represented gain and a ratio smaller than -0.33 represented loss of indicated regions. (A) CGH reflected the overt aberrations observed by COBRA-FISH. The der(1)t(1;9), der(9)t(9;13), and -13 resulted in a loss at 1q and loss of a large region of chromosome 13. The der(16)t(16;22) resulted in gain of a region spanning the nearly complete chromosome 22. CGH also revealed del(9)p(21.1-p23). Apparent loss of X and gain of Y were due to DNA gender mismatch, performed as an internal hybridization control. (B) On 9q34, two consecutive clones were gained (clones RP11-83J21 and RP11-143H20; arrows, left panel ). On 12p13 one clone was lost (clone RP11-59H1; arrow, right panel ). (C) Mapping of aberrant clones (grey squares) to genomic regions on 9q34 revealed that RP11-83J21 and RP11-143H20 mapped to the distal portion of the ABL1 gene (left). RP1159H1 mapped proximal to the ETV6 gene on 12p13, to a region also harboring the CDKN1B locus (right).
these translocations were balanced with respect to chromosome 9. Breakpoint mapping specified the karyotype of ALL-VG cells to be: 45,XY,der(1)t(1;9)(q41;q?),der(9)t (9;13)(q?;q12.3),del(9)(p21.1~p23),-13,der(16)t(16;22)(p 13.3;q11.22).ish ins(12;9)(RP11-434C1þ;RP11-59H11;RP11-57C19-;RP11-83J21þ).
5. Discussion FK like BCR/ABL1, mediate malignant transformation but at the same time may serve as therapeutic targets [2]. Alternative FK exist [16]. Cell lines harboring these oncoproteins are essential tools to study FK biology and kinase
J. Baeumler et al. / Cancer Genetics and Cytogenetics 185 (2008) 37e42
inhibition [17]. Here, we present the characterization of the first human ALL cell line that endogenously expresses ETV6/ABL1 fusion. Fusion of ETV6 to c-ABL1 has been observed in atypical CML in chronic phase [4] in atypical CML in blastic phase [7], in acute myeloid leukemia [6], and in few cases of ALL [5]. Activity of the ETV6/ABL protein is inhibited by imatinib, and clinical responses of ETV6/ABL1 positive leukemia to imatinib have been reported [10]. In comparison with BCR/ABL1 rearrangement, ETV6/ABL1 rearrangement is a rare event [5]. Since rearrangement of ETV6 and ABL1 most often is a cryptic result of complex chromosomal rearrangements it may go unnoticed in normal cytogenetic analysis [18]. In ALL-VG cells, two overt cytogenetic aberrations involving the same chromosome 9 were detected by karyotyping, but neither involved disruption of the ABL1 gene. FISH and CGH analysis revealed that instead, ETV6/ABL1 fusion was the result of a micro-insertion into chromosome 12, juxtapositioning an additional distal ABL1 region to the proximal portion of the ETV6 gene. The fusion resulted in expression of two splice variants either including or excluding ETV6 exon 5, suggesting the breakpoint on ETV6 was located in intron 5-6 and the breakpoint on ABL1 was located in intron 1-2. Interestingly, ETV6/ABL1 rearrangement coincided with loss of the CDKN1B gene, located 1 MB centromeric to the ETV6 locus. ALL-VG cells also displayed the del(9)(p21.1-23) associated with loss of CDKN2A and CDKN2B [19]. Loss of these tumor suppressor genes may have been involved in leukemic transformation, and may have been responsible for the relative ease by which the ALL-VG cell line could be established from the primary cells. ALL-VG cells displayed sensitivity to imatinib that was comparable to the sensitivity reported for BCR/ABL1 positive ALL cells [20], demonstrating that proliferation of ALL-VG cells was dependent on the activity of the ETV6/ABL protein. BCR/ABL and ETV6/ABL are known to constitutively activate the same intracellular signaling pathways [8,9]. The portions of BCR and ETV6 involved in the corresponding ABL fusion proteins both contain helix-loop-helix (or SAM-) domains through which the FK form homodimers, resulting in autophosphorylation and activation [21,22]. However, besides these similarities, BCR/ABL and ETV6/ABL may differ in their overall biology since the normal BCR protein is a serine-threonine kinase involved in the RAS signaling pathway [23] and ETV6 is a transcriptional repressor [24]. Although the normal ETV6 allele is transcriptionally active in most ETV6/ABL1 positive leukemias [25], ETV6 fusion proteins may affect the function of normal ETV6 in a dominantnegative way through the formation of heterodimers [26]. While multiple hematopoietic lineages are generally involved in BCR/ABL1 positive myeloproliferative disorders (MPD), ETV6/ABL1 positive MPD typically presents with eosinophilia [11,6]. Furthermore, ETV6/ABL1 transgenic
41
mice developed distinct MPD with myelocytic bowel infiltration that was not observed in BCR/ABL1 transgenic animals [27]. The oncogenic activity of ETV6 FK may therefore extend beyond aberrant kinase activity alone. Different ETV6 FK have been described. In leukemia, ETV6 has been found fused to platelet derived growth factor [28] to JANUS kinase [29], to neurotrophic tyrosine kinase receptor 3 [30], and to ABL1-related gene (ARG) [31]. Only a cell line that displayed ETV6/ARG fusion has thus far been described. The ALL-VG cell line may therefore be of value in the study of ETV6 FK in malignant transformation.
References [1] McLaughlin J, Chianese E, Witte ON. In vitro transformation of immature hematopoietic cells by the P210 BCR/ABL oncogene product of the Philadelphia chromosome. Proc Natl Acad Sci USA 1987;84: 6558e62. [2] Deininger M, Buchdunger E, Druker BJ. The development of imatinib as a therapeutic agent for chronic myeloid leukemia. Blood 2005;105:2640e53. [3] Papadopoulos P, Ridge SA, Boucher CA, Stocking C, Wiedemann LM. The novel activation of ABL by fusion to an ets-related gene, TEL. Cancer Res 1995;55:34e8. [4] Andreasson P, Johansson B, Carlsson M, Jarlsfelt I, Fioretos T, Mitelman F, Hoglund M. BCR/ABL-negative chronic myeloid leukemia with ETV6/ABL fusion. Genes Chromosomes Cancer 1997;20: 299e304. [5] Janssen JW, Ridge SA, Papadopoulos P, Cotter F, Ludwig WD, Fonatsch C, Rieder H, Ostertag W, Bartram CR, Wiedemann LM. The fusion of TEL and ABL in human acute lymphoblastic leukaemia is a rare event. Br J Haematol 1995;90:222e4. [6] La Starza R, Trubia M, Testoni N, Ottaviani E, Belloni E, Crescenzi B, Martelli M, Flandrin G, Pelicci PG, Mecucci C. Clonal eosinophils are a morphologic hallmark of ETV6/ABL1 positive acute myeloid leukemia. Haematologica 2002;87:789e94. [7] Tirado CA, Sebastian S, Moore JO, Gong JZ, Goodman BK. Molecular and cytogenetic characterization of a novel rearrangement involving chromosomes 9, 12, and 17 resulting in ETV6 (TEL) and ABL fusion. Cancer Genet Cytogenet 2005;157:74e7. [8] Voss J, Posern G, Hannemann JR, Wiedemann LM, Turhan AG, Poirel H, Bernard OA, Adermann K, Kardinal C, Feller SM. The leukaemic oncoproteins Bcr-Abl and Tel-Abl (ETV6/ABL) have altered substrate preferences and activate similar intracellular signaling pathways. Oncogene 2000;19:1684e90. [9] Okuda K, Golub TR, Gilliland DG, Griffin JD. p210BCR/ABL, p190BCR/ABL, and TEL/ABL activate similar signal transduction pathways in hematopoietic cell lines. Oncogene 1996;13:1147e52. [10] O’Brien SG, Vieira SA, Connors S, Bown N, Chang J, Capdeville R, Melo JV. Transient response to imatinib mesylate (STI571) in a patient with the ETV6-ABL t(9;12) translocation. Blood 2002;99: 3465e7. [11] Lepretre S. Eosinophilia in leukemias: a probable leukemic clone. Haematologica 2002;87:785e6. [12] Goselink HM, van Damme J, Hiemstra PS, Wuyts A, Stolk J, Fibbe WE, Willemze R, Falkenburg JH. Colony growth of human hematopoietic progenitor cells in the absence of serum is supported by a proteinase inhibitor identified as antileukoproteinase. J Exp Med 1996;184:1305e12. [13] Szuhai K, Tanke HJ. COBRA: combined binary ratio labeling of nucleic-acid probes for multi-color fluorescence in situ hybridization karyotyping. Nat Protoc 2006;1:264e75.
42
J. Baeumler et al. / Cancer Genetics and Cytogenetics 185 (2008) 37e42
[14] Szuhai K, Bezrookove V, Wiegant J, Vrolijk J, Dirks RW, Rosenberg C, Raap AK, Tanke HJ. Simultaneous molecular karyotyping and mapping of viral DNA integration sites by 25-color COBRA-FISH. Genes Chromosomes & Cancer 2000;28:92e7. [15] Knijnenburg J, van der Burg M, Tanke HJ, Szuhai K. Optimized amplification and fluorescent labeling of small cell samples for genomic array-CGH. Cytometry Part A 2007;71A:585e91. [16] Cross NC, Reiter A. Tyrosine kinase fusion genes in chronic myeloproliferative diseases. Leukemia 2002;16:1207e12. [17] Drexler HG, MacLeod RA, Uphoff CC. Leukemia cell lines: in vitro models for the study of Philadelphia chromosome-positive leukemia. Leuk Res 1999;23:207e15. [18] Van Limbergen H, Beverloo HB, van Drunen E, Janssens A, Hahlen K, Poppe B, Van Roy N, Marynen P, De Paepe A, Slater R, Speleman F. Molecular cytogenetic and clinical findings in ETV6/ABL1-positive leukemia. Genes Chromosomes Cancer 2001;30: 274e82. [19] Kuiper RP, Schoenmakers EF, van Reijmersdal SV, Hehir-Kwa JY, van Kessel AG, van Leeuwen FN, Hoogerbrugge PM. High-resolution genomic profiling of childhood ALL reveals novel recurrent genetic lesions affecting pathways involved in lymphocyte differentiation and cell cycle progression. Leukemia 2007;21:1258e66. [20] Kawaguchi Y, Jinnai I, Nagai K, Yagasaki F, Yakata Y, Matsuo T, Kuriyama K, Tomonaga M. Effect of a selective Abl tyrosine kinase inhibitor, STI571, on in vitro growth of BCR-ABL-positive acute lymphoblastic leukemia cells. Leukemia 2001;15:590e4. [21] Kim CA, Phillips ML, Kim W, Gingery M, Tran HH, Robinson MA, Faham S, Bowie JU. Polymerization of the SAM domain of TEL in leukemogenesis and transcriptional repression. EMBO J 2001;20: 4173e82. [22] Golub TR, Goga A, Barker GF, Afar DE, McLaughlin J, Bohlander SK, Rowley JD, Witte ON, Gilliland DG. Oligomerization of the ABL tyrosine kinase by the Ets protein TEL in human leukemia. Mol Cell Biol 1996;16:4107e16.
[23] Radziwill G, Erdmann RA, Margelisch U, Moelling K. The Bcr kinase downregulates Ras signaling by phosphorylating AF-6 and binding to its PDZ domain. Mol Cell Biol 2003;23:4663e72. [24] Chakrabarti SR, Nucifora G. The leukemia-associated gene TEL encodes a transcription repressor which associates with SMRT and mSin3A. Biochem Biophys Res Commun 1999;264:871e7. [25] Hannemann JR, Healy LE, Ridge SA, Wiedemann LM. The second ETV6 allele is not necessarily deleted in acute leukemias with a ETV6/ABL fusion. Genes Chromosomes Cancer 1998;21:256e9. [26] Gunji H, Waga K, Nakamura F, Maki K, Sasaki K, Nakamura Y, Mitani K. TEL/AML1 shows dominant-negative effects over TEL as well as AML1. Biochem Biophys Res Commun 2004;322: 623e30. [27] Million RP, Aster J, Gilliland DG, Van Etten RA. The Tel-Abl (ETV6-ABL) tyrosine kinase, product of complex (9;12) translocations in human leukemia, induces distinct myeloproliferative disease in mice. Blood 2002;99:4568e77. [28] Golub TR, Barker GF, Lovett M, Gilliland DG. Fusion of PDGF receptor beta to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation. Cell 1994;77: 307e16. [29] Peeters P, Raynaud SD, Cools J, Wlodarska I, Grosgeorge J, Philip P, Monpoux F, Van Rompaey L, Baens M, Van den BH, Marynen P. Fusion of TEL, the ETS-variant gene 6 (ETV6), to the receptorassociated kinase JAK2 as a result of t(9;12) in a lymphoid and t(9;15;12) in a myeloid leukemia. Blood 1997;90:2535e40. [30] Iijima Y, Ito T, Oikawa T, Eguchi M, Eguchi-Ishimae M, Kamada N, Kishi K, Asano S, Sakaki Y, Sato Y. A new ETV6/TEL partner gene, ARG (ABL-related gene or ABL2), identified in an AML-M3 cell line with a t(1;12)(q25;p13) translocation. Blood 2000;95:2126e31. [31] Griesinger F, Janke A, Podleschny M, Bohlander SK. Identification of an ETV6-ABL2 fusion transcript in combination with an ETV6 point mutation in a T-cell acute lymphoblastic leukaemia cell line. Br J Haematol 2002;119:454e8.
Establishment and cytogenetic characterization of a human acute lymphoblastic leukemia cell line (ALL-VG) with ETV6/ABL1 rearrangement Joerg Baeumlera, Karoly Szuhaib, JH Frederik Falkenburgc, Marianke L.J van Schiec, Oliver G Ottmanna, Bart A Nijmeijerc,* a Department of Hematology, JW Goethe University, Frankfurt am Main, Germany Department of Molecular Cell Biology, Leiden University Medical Center, Leiden, The Netherlands c Department of Hematology, Leiden University Medical Center C2R, PO Box 9600, 2300 RC Leiden, The Netherlands b
Received 1 April 2008; received in revised form 25 April 2008; accepted 2 May 2008
Abstract
Fusion kinases (FK) like BCR/ABL1 mediate leukemic transformation and represent therapeutic targets. Fusion of ETV6 (ETS translocation variant 6, previously known as TEL) to ABL1 due to t(9;12) has been observed in various hematological malignancies. ETV6/ABL1 and BCR/ABL1 FK display similar activity but they may not be identical in function. Here we present the generation of an ETV6/ABL1 positive human acute lymphoblastic leukemia (ALL) cell line, ALL-VG. The cell line expressed ETV6/ABL1 fusion transcripts and displayed sensitivity to imatinib with an IC50 of 0.1 mM. Karyotyping did not reveal overt t(9;12), suggesting a cryptic translocation. Fluorescent in situ hybridization and array-based comparative genomic hybridization were performed to characterize the rearrangement. ETV6/ABL1 fusion was demonstrated to result from insertion of a duplicated 300 to 1300 kb region of 9q34 that contained the distal portion of the ABL1 gene, into the ETV6 locus on 12p13. With this insertion, an 1150 to 1750 kb region of 12p13 that contained the distal portion of the ETV6 gene as well the cyclin dependent kinase inhibitor (CDKN ) 1B gene was lost. Furthermore, the cells displayed a del(9)(p21.1~p23), typically associated with loss of CDKN2A and CDKN2B. The ALL-VG cell line may serve as a tool for the study of ETV6/ABL1. Ó 2008 Elsevier Inc. All rights reserved.
1. Introduction Fusion of the non-receptor tyrosine kinase gene ABL1 to BCR mediates leukemic transformation and is the hallmark of chronic myeloid leukemia (CML) and a subset of acute lymphoblastic leukemia (ALL) [1], for which targeted therapy with the selective abl kinase inhibitor imatinib has become standard treatment [2]. Infrequently, ABL1 fuses to ETV6 (ETS translocation variant 6, previously known as TEL), a member of the ETS family of transcription factors [3]. ETV6/ABL1-fusion has been associated with myeloid as well as with lymphoid leukemias [4-7]. The BCR/ABL1 and ETV6/ABL1 fusion kinases (FK) mediate increased The ALL-VG cell line has not yet been submitted to any tissue culture collection. For inquiries regarding the cell line please contact Dr. BA Nijmeijer, Department of Hematology, Leiden University Medical Center C2R, PO box 9600, 2300RC Leiden, the Netherlands. * Corresponding author. Tel.: þ31-71-526-2271; fax þ31-71-5266755. E-mail address: [email protected] (B.A. Nijmeijer). 0165-4608/08/$ e see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2008.05.001
intracellular phosphorylation levels, confer growth factor independence, and are inhibited by imatinib [8-10]. However, clinical manifestation of ETV6/ABL1 and BCR/ABL1 positive leukemia’s can differ, suggesting that these FK may not be fully comparable in function [11]. Studies on the ETV6/ABL1 FK have been restricted to murine transfection models since no human leukemia cell lines were available that endogenously express this FK. In this study, we present establishment and characterization of an ETV6/ABL1 positive human ALL cell line, ALL-VG.
2. Case Report A 30-year old male was diagnosed with Philadelphia chromosome negative ALL of common type, with central nervous system involvement and a leukocyte count of 129x109/L. Conventional G-banding revealed a 45,XY,del(1)(q42),-9,13,add(16)(p1?3),þmar karyotype in 20 metaphases. Induction therapy resulted in hematological remission and
38
J. Baeumler et al. / Cancer Genetics and Cytogenetics 185 (2008) 37e42
autologous stem cell transplantation followed. Two months after transplantation, the patient died of relapse.
3. Materials and methods 3.1. Establishment of the ALL-VG cell line Primary leukemic cells were obtained by leukapheresis at the moment of presentation with infirmed consent. Leukemic cells were enriched by ficoll density centrifugation and placed into culture in a previously developed serumfree medium [12]. Viable cell density in the culture was maintained between 0.5 and 2.0x106 cells/mL. For in vitro proliferation assays, cells were incubated in the presence of various concentrations of imatinib (kindly provided by Novartis (Basel, Switzerland) or in its absence (controls). Seven days later, numbers of viable cells were counted. IC50 was defined as the concentration of imatinib at which viable cell numbers were 50% of those observed in controls. 3.1. Flow cytometry Expression of surface markers was analyzed using FITC-conjugated anti-human CD10, CD19, CD20 (Becton Dickinson, Franklin Lakes, NJ), anti TdT (Beckman Coulter, Mijdrecht, The Netherlands), anti immunoglobulin heavy chain (m)(Nordic, Tilburg, The Netherlands) and phycoerythrin (PE-) conjugated anti-human CD19, CD20, CD34 (Becton Dickinson), and anti CD79a (DAKO, Glostrup, Denmark). Intracellular expression of CD79a, m, or TdT was determined after permeabilization with FACSlysis solution (Becton Dickinson). Samples were analyzed on a FACScan flow cytometer (Becton Dickinson). 3.2. RT-PCR Expression of ETV6/ABL1 transcripts was analyzed by RT-PCR. RNA was extracted from 10x106 cells using Gold TriFast reagent (Peqlab Biotechnology, Erlangen, Germany) and cDNA was synthesized from total RNA using the SuperScript III First-Strand Synthesis SuperMix (Invitrogen, Carlsbad, Ca). A first round of ETV6/ABL1 PCR was performed with ETV6 exon 3 forward (5’-AAGGCC AATTGACAGCAACACG-3’) and ABL1 exon 2 reverse (5‘-GCACCAAGAAGCTGCCATTGAT-3’) primers. A second nested round was preformed on the product with ETV6 exon 3 forward (5’-AAGCTCTCCTGCTGCTGA CCAAAG-3’) and ABL1 exon 2 reverse (5’- CTCCAG ACTGTTGACTGGCGTGAT-3’) primers. PCR products were analyzed by agarose gel electrophoresis. Amplicons were extracted from the gels and sequenced at Seqlab (Go¨ttingen, Germany) using the nested primers. 3.3. Cytogenetic characterization Combined binary ratio labeling fluorescent in situ hybridization (COBRA-FISH) and BAC-FISH were performed as
described elsewhere [13,14]. Comparative Genomic Hybridization Micro array (Array-CGH) was performed as described previously [15]. Briefly, slides containing triplicates of 3500 large insert clones spaced at 1 Mb density over the genome were produced. The large insert clone set used to produce these arrays was provided by the Wellcome Trust Sanger Institute (UK). Information regarding the full set is available at the Wellcome Trust Sanger Institute mapping database site (http://www.ensembl.org/). DNA was amplified, spotted on the slides and hybridized. Target imbalances were determined based on log2 ratios of the average of their replicates, and sequences were considered as amplified or deleted when outside the 60.33 range.
4. Results Culture of primary cells resulted in a continuously proliferating cell line, designated ALL-VG. The cell line doubled at a constant rate every 2.3 days for more than one year, without any sign of exhaustion. Long-term cultured ALL-VG cells (cultured continuously for over 6 months) displayed the same common-ALL immune phenotype as the primary cells at diagnosis. Both expressed CD10, CD19, CD20, CD22, CD79a, and TdT, but not CD34 or cytoplasmic m. To specify the karyotype in more detail, COBRA-FISH was performed on primary cells and on the ALL-VG cell line. ALL-VG cells and the primary cells displayed the identical karyotype 45,XY,der(1)t(1;9), der(9)t(9;13),-13,der(16)t(16;22). In a proliferation assay, ALL-VG cells revealed sensitivity to the bcr/abl inhibitor imatinib with an IC50 of 0.1 mM. RT-PCR verified that the cells were BCR/ABL1 negative. However, RT-PCR with primers specific for ETV6 exon 3 and ABL1 exon 2 revealed two amplicons of ~480 and ~1024 nucleotides, respectively. Sequencing demonstrated that these amplicons represented a fusion transcript of ETV6 exon 4 to ABL1 exon2, and a fusion transcript of ETV6 exon 5 to ABL1 exon 2, respectively (Table 1). The same transcripts were expressed by the primary cells. ALL-VG cells did not display an overt t(9;12) implied by ETV6/ABL1 fusion. To localize the rearrangement, metaphase FISH was performed on ALL-VG cells using probes that correspond to regions proximal and distal to the ETV6 or ABL1 genes. FISH indicated that the rearrangement was the result of an insertion of a duplicated distal ABL1 region into an otherwise normal looking chromosome 12, replacing the region containing the distal part of the ETV6 gene (Figs. 1A-1E). Counter painting with a chromosome 9-specific probe revealed that one intact ABL1 region was localized on the normal chromosome 9. The other intact ABL1 region was localized on the der(1)t(1;9), that apparently contained only a small part of 9q (Fig. 1F). Array CGH revealed that a 300 to 1300 kb region was gained that contained the distal part of the ABL1 gene on
J. Baeumler et al. / Cancer Genetics and Cytogenetics 185 (2008) 37e42
39
Table 1 Fusion gene sequences detected by PCR Detected sequences
Alignmenta
GTGATGTGCTCTATGAACTCCTTCAGCATATTCTGAAGCAGAGGAAACCTCGGATTCTTTTTTC ACCATTCTTCCACCCTGGAAACTCTATACACACACAGCCGGAGGTCATACTGCATCAGAAC CATGAAGAAGaAAGCCCTTCAGCGGCCAGTAGCATCTG
ETV6 exon 4 ABL1 exon 2
GTGATGTGCTCTATGAACTCCTTCAGCATATTCTGAAGCAGAGGAAACCTCGGATTCTTTTTT CACCATTCTTCCACCCTGGAAACTCTATACACACACAGCCGGAGGTCATACT GCATCAGAACCATGAAGAAGATAACTGTGTCCAGAGGACCCCCAGGCCATCCGTG GATAATGTGCACCATAACCCTCCCACCATTGAACTGTTGCACCGCTCCAGGTCACCTA TCACGACAAATCACCGGCCTTCTCCTGACCCCGAGCAGCGGCCCCTCCGGTCC CCCCTGGACAACATGATCCGCCGCCTCTCCCCGGCTGAGAGAGCTCAGGGACCCAGGC CGCACCAGGAGAACAACCACCAGGAGTCCTACCCTCTGTCAGTGTCTCCCATGGAGAATAATCAC TGCCCAGCGTCCTCCGAGTCCCACCCGAAGCCATCCAGCCCCCGGCAGGAGAGCACACGCGT GATCCAGCTGATGCCCAGCCCCATCATGCACCCTCTGATCCTGAACCCCCGGCACTCC GTGGATTTCAAACAGTCCAGGCTCTCCGAGGACGGGCTGCATAGGGAAGGGAAGCCCA TCAACCTCTCTCATCGGGAAGACCTGGCTTACATGAACCACATCATGGTCTCTGTCT CCCCGCCTGAAGAGCACGCCATGCCCATTGGGAGAATAGCAGaAAGCCCTTCAGCGGCCAGTAGCATCTG
ETV6 exon 4
a
ETV6 exon 5
ABL1 exon 2
Aligned to the human genome using the Ensembl database (www.ensembl.org).
9q34 (Fig. 2). In the microinsertion, an 1150 to 1750 kb region distal to the ETV6 gene on 12p13 was lost. The deleted region on 12p13 that was involved in the rearrangement also included the cyclin dependent kinase inhibitor (CDKN ) 1B
locus. Furthermore, CGH revealed del(9)p(21.1-p23), typically associated with loss of the tumor suppressor genes CDKN2A and CDKN2B. The breakpoint on 9q involved in the t(1;9) and t(9;13) could not be identified from CGH, as
Fig. 1. BAC-FISH confirmation and localization of cryptic ETV6/ABL1 rearrangement in ALL-VG cells. To confirm and localize ETV6/ABL1 rearrangement, metaphase BAC-FISH was performed on ALL-VG cells using probes specific for the proximal and distal regions of ETV6 and ABL1. On both chromosomes 12, proximal ETV6 signal was observed (A). On one of these however, the distal ETV6 signal was lost (B, arrow). Two proximal ABL1 signals were observed (C). While two distal ABL1 signals co localized with the proximal ABL1 signals, a third distal ABL1 signal was observed (D, arrow), co-localizing with proximal ETV6 on chromosome 12 (E, arrow). Whole chromosome painting with a probe specific for chromosome 9 (WCP9) revealed that the intact ABL1 regions were located on the normal chromosome 9 and on the der(1)t(1;9), respectively (F, arrows).
40
J. Baeumler et al. / Cancer Genetics and Cytogenetics 185 (2008) 37e42
Fig. 2. Comparative genomic hybridization array (CGH). To map cryptic aberrations, array CGH was performed. Random amplified Cy3-conjugated ALLVG DNA was hybridized against amplified Cy5-conjugated female normal DNA to an array of 3,500 known clones that spanned the whole genome. Results were transformed to signal ratios where a ratio larger than 0.33 represented gain and a ratio smaller than -0.33 represented loss of indicated regions. (A) CGH reflected the overt aberrations observed by COBRA-FISH. The der(1)t(1;9), der(9)t(9;13), and -13 resulted in a loss at 1q and loss of a large region of chromosome 13. The der(16)t(16;22) resulted in gain of a region spanning the nearly complete chromosome 22. CGH also revealed del(9)p(21.1-p23). Apparent loss of X and gain of Y were due to DNA gender mismatch, performed as an internal hybridization control. (B) On 9q34, two consecutive clones were gained (clones RP11-83J21 and RP11-143H20; arrows, left panel ). On 12p13 one clone was lost (clone RP11-59H1; arrow, right panel ). (C) Mapping of aberrant clones (grey squares) to genomic regions on 9q34 revealed that RP11-83J21 and RP11-143H20 mapped to the distal portion of the ABL1 gene (left). RP1159H1 mapped proximal to the ETV6 gene on 12p13, to a region also harboring the CDKN1B locus (right).
these translocations were balanced with respect to chromosome 9. Breakpoint mapping specified the karyotype of ALL-VG cells to be: 45,XY,der(1)t(1;9)(q41;q?),der(9)t (9;13)(q?;q12.3),del(9)(p21.1~p23),-13,der(16)t(16;22)(p 13.3;q11.22).ish ins(12;9)(RP11-434C1þ;RP11-59H11;RP11-57C19-;RP11-83J21þ).
5. Discussion FK like BCR/ABL1, mediate malignant transformation but at the same time may serve as therapeutic targets [2]. Alternative FK exist [16]. Cell lines harboring these oncoproteins are essential tools to study FK biology and kinase
J. Baeumler et al. / Cancer Genetics and Cytogenetics 185 (2008) 37e42
inhibition [17]. Here, we present the characterization of the first human ALL cell line that endogenously expresses ETV6/ABL1 fusion. Fusion of ETV6 to c-ABL1 has been observed in atypical CML in chronic phase [4] in atypical CML in blastic phase [7], in acute myeloid leukemia [6], and in few cases of ALL [5]. Activity of the ETV6/ABL protein is inhibited by imatinib, and clinical responses of ETV6/ABL1 positive leukemia to imatinib have been reported [10]. In comparison with BCR/ABL1 rearrangement, ETV6/ABL1 rearrangement is a rare event [5]. Since rearrangement of ETV6 and ABL1 most often is a cryptic result of complex chromosomal rearrangements it may go unnoticed in normal cytogenetic analysis [18]. In ALL-VG cells, two overt cytogenetic aberrations involving the same chromosome 9 were detected by karyotyping, but neither involved disruption of the ABL1 gene. FISH and CGH analysis revealed that instead, ETV6/ABL1 fusion was the result of a micro-insertion into chromosome 12, juxtapositioning an additional distal ABL1 region to the proximal portion of the ETV6 gene. The fusion resulted in expression of two splice variants either including or excluding ETV6 exon 5, suggesting the breakpoint on ETV6 was located in intron 5-6 and the breakpoint on ABL1 was located in intron 1-2. Interestingly, ETV6/ABL1 rearrangement coincided with loss of the CDKN1B gene, located 1 MB centromeric to the ETV6 locus. ALL-VG cells also displayed the del(9)(p21.1-23) associated with loss of CDKN2A and CDKN2B [19]. Loss of these tumor suppressor genes may have been involved in leukemic transformation, and may have been responsible for the relative ease by which the ALL-VG cell line could be established from the primary cells. ALL-VG cells displayed sensitivity to imatinib that was comparable to the sensitivity reported for BCR/ABL1 positive ALL cells [20], demonstrating that proliferation of ALL-VG cells was dependent on the activity of the ETV6/ABL protein. BCR/ABL and ETV6/ABL are known to constitutively activate the same intracellular signaling pathways [8,9]. The portions of BCR and ETV6 involved in the corresponding ABL fusion proteins both contain helix-loop-helix (or SAM-) domains through which the FK form homodimers, resulting in autophosphorylation and activation [21,22]. However, besides these similarities, BCR/ABL and ETV6/ABL may differ in their overall biology since the normal BCR protein is a serine-threonine kinase involved in the RAS signaling pathway [23] and ETV6 is a transcriptional repressor [24]. Although the normal ETV6 allele is transcriptionally active in most ETV6/ABL1 positive leukemias [25], ETV6 fusion proteins may affect the function of normal ETV6 in a dominantnegative way through the formation of heterodimers [26]. While multiple hematopoietic lineages are generally involved in BCR/ABL1 positive myeloproliferative disorders (MPD), ETV6/ABL1 positive MPD typically presents with eosinophilia [11,6]. Furthermore, ETV6/ABL1 transgenic
41
mice developed distinct MPD with myelocytic bowel infiltration that was not observed in BCR/ABL1 transgenic animals [27]. The oncogenic activity of ETV6 FK may therefore extend beyond aberrant kinase activity alone. Different ETV6 FK have been described. In leukemia, ETV6 has been found fused to platelet derived growth factor [28] to JANUS kinase [29], to neurotrophic tyrosine kinase receptor 3 [30], and to ABL1-related gene (ARG) [31]. Only a cell line that displayed ETV6/ARG fusion has thus far been described. The ALL-VG cell line may therefore be of value in the study of ETV6 FK in malignant transformation.
References [1] McLaughlin J, Chianese E, Witte ON. In vitro transformation of immature hematopoietic cells by the P210 BCR/ABL oncogene product of the Philadelphia chromosome. Proc Natl Acad Sci USA 1987;84: 6558e62. [2] Deininger M, Buchdunger E, Druker BJ. The development of imatinib as a therapeutic agent for chronic myeloid leukemia. Blood 2005;105:2640e53. [3] Papadopoulos P, Ridge SA, Boucher CA, Stocking C, Wiedemann LM. The novel activation of ABL by fusion to an ets-related gene, TEL. Cancer Res 1995;55:34e8. [4] Andreasson P, Johansson B, Carlsson M, Jarlsfelt I, Fioretos T, Mitelman F, Hoglund M. BCR/ABL-negative chronic myeloid leukemia with ETV6/ABL fusion. Genes Chromosomes Cancer 1997;20: 299e304. [5] Janssen JW, Ridge SA, Papadopoulos P, Cotter F, Ludwig WD, Fonatsch C, Rieder H, Ostertag W, Bartram CR, Wiedemann LM. The fusion of TEL and ABL in human acute lymphoblastic leukaemia is a rare event. Br J Haematol 1995;90:222e4. [6] La Starza R, Trubia M, Testoni N, Ottaviani E, Belloni E, Crescenzi B, Martelli M, Flandrin G, Pelicci PG, Mecucci C. Clonal eosinophils are a morphologic hallmark of ETV6/ABL1 positive acute myeloid leukemia. Haematologica 2002;87:789e94. [7] Tirado CA, Sebastian S, Moore JO, Gong JZ, Goodman BK. Molecular and cytogenetic characterization of a novel rearrangement involving chromosomes 9, 12, and 17 resulting in ETV6 (TEL) and ABL fusion. Cancer Genet Cytogenet 2005;157:74e7. [8] Voss J, Posern G, Hannemann JR, Wiedemann LM, Turhan AG, Poirel H, Bernard OA, Adermann K, Kardinal C, Feller SM. The leukaemic oncoproteins Bcr-Abl and Tel-Abl (ETV6/ABL) have altered substrate preferences and activate similar intracellular signaling pathways. Oncogene 2000;19:1684e90. [9] Okuda K, Golub TR, Gilliland DG, Griffin JD. p210BCR/ABL, p190BCR/ABL, and TEL/ABL activate similar signal transduction pathways in hematopoietic cell lines. Oncogene 1996;13:1147e52. [10] O’Brien SG, Vieira SA, Connors S, Bown N, Chang J, Capdeville R, Melo JV. Transient response to imatinib mesylate (STI571) in a patient with the ETV6-ABL t(9;12) translocation. Blood 2002;99: 3465e7. [11] Lepretre S. Eosinophilia in leukemias: a probable leukemic clone. Haematologica 2002;87:785e6. [12] Goselink HM, van Damme J, Hiemstra PS, Wuyts A, Stolk J, Fibbe WE, Willemze R, Falkenburg JH. Colony growth of human hematopoietic progenitor cells in the absence of serum is supported by a proteinase inhibitor identified as antileukoproteinase. J Exp Med 1996;184:1305e12. [13] Szuhai K, Tanke HJ. COBRA: combined binary ratio labeling of nucleic-acid probes for multi-color fluorescence in situ hybridization karyotyping. Nat Protoc 2006;1:264e75.
42
J. Baeumler et al. / Cancer Genetics and Cytogenetics 185 (2008) 37e42
[14] Szuhai K, Bezrookove V, Wiegant J, Vrolijk J, Dirks RW, Rosenberg C, Raap AK, Tanke HJ. Simultaneous molecular karyotyping and mapping of viral DNA integration sites by 25-color COBRA-FISH. Genes Chromosomes & Cancer 2000;28:92e7. [15] Knijnenburg J, van der Burg M, Tanke HJ, Szuhai K. Optimized amplification and fluorescent labeling of small cell samples for genomic array-CGH. Cytometry Part A 2007;71A:585e91. [16] Cross NC, Reiter A. Tyrosine kinase fusion genes in chronic myeloproliferative diseases. Leukemia 2002;16:1207e12. [17] Drexler HG, MacLeod RA, Uphoff CC. Leukemia cell lines: in vitro models for the study of Philadelphia chromosome-positive leukemia. Leuk Res 1999;23:207e15. [18] Van Limbergen H, Beverloo HB, van Drunen E, Janssens A, Hahlen K, Poppe B, Van Roy N, Marynen P, De Paepe A, Slater R, Speleman F. Molecular cytogenetic and clinical findings in ETV6/ABL1-positive leukemia. Genes Chromosomes Cancer 2001;30: 274e82. [19] Kuiper RP, Schoenmakers EF, van Reijmersdal SV, Hehir-Kwa JY, van Kessel AG, van Leeuwen FN, Hoogerbrugge PM. High-resolution genomic profiling of childhood ALL reveals novel recurrent genetic lesions affecting pathways involved in lymphocyte differentiation and cell cycle progression. Leukemia 2007;21:1258e66. [20] Kawaguchi Y, Jinnai I, Nagai K, Yagasaki F, Yakata Y, Matsuo T, Kuriyama K, Tomonaga M. Effect of a selective Abl tyrosine kinase inhibitor, STI571, on in vitro growth of BCR-ABL-positive acute lymphoblastic leukemia cells. Leukemia 2001;15:590e4. [21] Kim CA, Phillips ML, Kim W, Gingery M, Tran HH, Robinson MA, Faham S, Bowie JU. Polymerization of the SAM domain of TEL in leukemogenesis and transcriptional repression. EMBO J 2001;20: 4173e82. [22] Golub TR, Goga A, Barker GF, Afar DE, McLaughlin J, Bohlander SK, Rowley JD, Witte ON, Gilliland DG. Oligomerization of the ABL tyrosine kinase by the Ets protein TEL in human leukemia. Mol Cell Biol 1996;16:4107e16.
[23] Radziwill G, Erdmann RA, Margelisch U, Moelling K. The Bcr kinase downregulates Ras signaling by phosphorylating AF-6 and binding to its PDZ domain. Mol Cell Biol 2003;23:4663e72. [24] Chakrabarti SR, Nucifora G. The leukemia-associated gene TEL encodes a transcription repressor which associates with SMRT and mSin3A. Biochem Biophys Res Commun 1999;264:871e7. [25] Hannemann JR, Healy LE, Ridge SA, Wiedemann LM. The second ETV6 allele is not necessarily deleted in acute leukemias with a ETV6/ABL fusion. Genes Chromosomes Cancer 1998;21:256e9. [26] Gunji H, Waga K, Nakamura F, Maki K, Sasaki K, Nakamura Y, Mitani K. TEL/AML1 shows dominant-negative effects over TEL as well as AML1. Biochem Biophys Res Commun 2004;322: 623e30. [27] Million RP, Aster J, Gilliland DG, Van Etten RA. The Tel-Abl (ETV6-ABL) tyrosine kinase, product of complex (9;12) translocations in human leukemia, induces distinct myeloproliferative disease in mice. Blood 2002;99:4568e77. [28] Golub TR, Barker GF, Lovett M, Gilliland DG. Fusion of PDGF receptor beta to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation. Cell 1994;77: 307e16. [29] Peeters P, Raynaud SD, Cools J, Wlodarska I, Grosgeorge J, Philip P, Monpoux F, Van Rompaey L, Baens M, Van den BH, Marynen P. Fusion of TEL, the ETS-variant gene 6 (ETV6), to the receptorassociated kinase JAK2 as a result of t(9;12) in a lymphoid and t(9;15;12) in a myeloid leukemia. Blood 1997;90:2535e40. [30] Iijima Y, Ito T, Oikawa T, Eguchi M, Eguchi-Ishimae M, Kamada N, Kishi K, Asano S, Sakaki Y, Sato Y. A new ETV6/TEL partner gene, ARG (ABL-related gene or ABL2), identified in an AML-M3 cell line with a t(1;12)(q25;p13) translocation. Blood 2000;95:2126e31. [31] Griesinger F, Janke A, Podleschny M, Bohlander SK. Identification of an ETV6-ABL2 fusion transcript in combination with an ETV6 point mutation in a T-cell acute lymphoblastic leukaemia cell line. Br J Haematol 2002;119:454e8.