- Email: [email protected]
Establishment of a Gene Expression System in Rice Chloroplast and Obtainment of PPT-Resistant Rice Plants
Agricultural Sciences in China
2009, 8(6): 643-651
June 2009
Establishment of a Gene Expression System in Rice Chloroplast and Obtainment of PPT-Resistant Rice Plants LI Yi-nü1*, SUN Bing-yao2*, SU Ning3, MENG Xiang-xun2, ZHANG Zhi-fang1 and SHEN Gui-fang1 1
Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, P.R.China
2
College of Life Sciences, Suzhou University, Suzhou 215123, P.R.China
3
Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing 100081, P.R.China
Abstract In contrast to the situation of random integration of foreign genes in nuclear transformation, the introduction of genes via chloroplast genetic engineering is characterized by site-specific pattern via homologous recombination. To establish an expression system for alien genes in rice chloroplast, the intergenic region of ndhF and trnL was selected as target for sitespecific integration of PPT-resistant bar gene in this study. Two DNA fragments suitable for homologous recombination were cloned from rice chloroplast genome DNA using PCR technique, and the chloroplast-specific expression vector pRB was constructed by fusing a modified 16S rRNA gene promoter to bar gene together with terminator of psbA gene 3´ sequence. Chloroplast transformation was carried out by biolistic bombardment of sterile rice calli with the pRB construct. Subsequently, the regenerated plantlets and seeds of progeny arising from reciprocal cross to the wild-type lines were obtained. Molecular analysis suggested that the bar gene has been integrated into rice chloroplast genome. Genetic analysis revealed that bar gene could be transmitted and expressed normally in chloroplast genome. Thus, the bar gene conferred not only selection pressure for the transformation of rice chloroplast genome, but PPT-resistant trait for rice plants as well. It is suggested that an efficient gene expression system in the rice chloroplast has been established by chloroplast transformation technique. Key words: Oryza sativa L., chloroplast transformation, bar gene, homologous fragments
INTRODUCTION As the site of photosynthesis in eukaryotic cells, chloroplasts have long been investigated by plant biologists. Since the definitive histochemical evidence for the presence of DNA in chloroplasts of Chlamydomonas was published about forty years ago (Ris and Plaut 1962), the molecular genetic research in chloroplast has been rapidly developed, and chloroplast genomes in tobacco, rice, maize, spinach, alfalfa and Chlamydomonas have been sequenced, which provided the foundation for
genetic engineering of chloroplast genome. The event that successful genetic transformation in Chlamydomonas genome was achieved marked the beginning of chloroplast genetic engineering (Boynton et al. 1988). Available studies showed that chloroplast transformation via homologous recombination has several advantages over nuclear transformation, such as high-level transgene expression, reliable security, and site-specific integration of transgenes, which hereby attract more and more attention and facilitate its wide application. Chloroplast genetic engineering actually offers some attractive advantages over nuclear transformation.
This paper is translated from its Chinese version in Scientia Agricultura Sinica. LI Yi-nü, E-mail: [email protected]; Correspondence SHEN Gui-fang, Professor, Tel: +86-10-82109854, E-mail: [email protected] *
The authors contributed equally to this work. © 2009, CAAS. All rights reserved. Published by Elsevier Ltd. doi:10.1016/S1671-2927(08)60259-X
64 4
However, compared with nuclear transformation, chloroplast transformation is just at the stage of its beginning. Up to now, the application of chloroplast genetic engineering has been mostly limited to very few plant species such as tobacco (Svab et al. 1990), potato (Sidorov et al. 1999), tomato (Ruf et al. 2001), and rapeseed (Hou et al. 2003). Moreover, no report is available on the chloroplast transformation to obtain fertile monocotyledonous plants. Therefore, it is desirable to establish gene expression system in the chloroplast of a number of economically important crop plants. Rice is one of the most important crops cultivated worldwide. To develop an efficient gene expression system in the rice chloroplast and adopt its unique advantages to improve rice breeding for resistant traits will be a promising research subject. Among the existing chloroplast transformation systems, spectinomycin is the most versatile selectable antibiotic resistance marker, and is proved to be highly effective in chloroplast transformation of tobacco, potato, tomato, and other species in the family Solanaceae. But in the case of rice, spectinomycin is not an excellent choice, since rice presents natural resistance to this antibiotic just as most gramineous plants do (Fromm et al. 1987). Therefore, for the establishment of chloroplast transformation system in rice, it is very critical to screen an accessible selectable marker instead of spectinomycin. So far, only one report involving in the screening of alternate antibiotics other than spectinomycin for rice chloroplast transformation is available (Khan and Maliga 1999). They transformed rice protoplast with aadAgfp fusion construct by using streptomycin resistance gene as a selectable marker, and obtained some transformed plants though no further information about the reproductive traits or genetic analysis of progeny is presented. Molecular analysis indicated that exogenous gene expressed in only a few chloroplasts among these transformed plants. The bar gene, which confers resistance to PPT (L-phosphinotricin), the active ingredient of herbicide Basta, was proved to be an efficient selectable marker in tobacco chloroplast transformation (Lutz et al. 2001). In this paper, we describe the cloning of homologous fragments for the site-specific integration of exogenous gene, present the construction of expression vector harboring a modified 16S rRNA gene promoter
LI Yi-nü et al.
(Su et al. 2003) using PPT-resistant gene bar as a selectable marker and the genetic transformation of rice calli by biolistics method, and report the development of a gene expression system in the chloroplast of Oryza sativa and obtainment of fertile PPT-resistant rice plants.
MATERIALS AND METHODS Bacterial strains and plasmids Escherichia coli DH5a strain and plasmid pBluescript SK (M13) were kept in the Key Lab for Crop Biotechnology, CAAS, China. Plasmid vecotrs pAZ, pT393, and pU16S, harboring bar gene, psbA terminator sequence (psbA 3´), and rice chloroplast 16S rRNA gene promoter (144 bp long), respectively, were constructed previously in the Key La b for Crop Biotechnology, CAAS, China (Su et al. 2003).
Plant materials Rice cultivar Zhonghua 10 (Oryza sativa L. ssp. japonica) used in this study was obtained from the Institute of Crop Breeding and Cultivation, Chinese Academy of Agriculture Sciences. Young ears were used as explant to induce calli for biolistic transformation, and for further screening and regeneration of transplastomic plantlets. The culture media applied in this study are as follows: MS supplemented with 2 mg L-1 2,4-D was used as callus induction and subculture medium, MS containing 0.2 mol L-1 mannitol and 0.2 mol L-1 sorbitol as highly osmotic medium, MS containing 2 mg L-1 6BA and 0.5 mg L-1 NAA as regeneration medium, and the basal medium for rooting.
Agents and enzymes Restriction enzymes, Klenow enzyme, T4 DNA ligase, T4 DNA polymerase, Random Primer Labeling Kit were purchased from Promega Inc (Madison, WI, USA). Advantage PCR-Pure Kit and Hybond-N membrane were products from Clontech (Mountain View, CA, USA) and Amersham (Pittsburgh, PA, USA), respectively. [α-32P] dATP was purchased from Yahui Ltd., Beijing. All other chemicals used in this study were analytical pure agents.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Establishment of a Gene Expression System in Rice Chloroplast and Obtainment of PPT-Resistant Rice Plants
Primers In terms of site-specific integration of foreign genes in chloroplast genome by homologous recombination, the non-coding region between ndhF and trnL genes in the small single copy (SSC) region was chosen as the insertion site for bar gene according to the published sequence of rice chloroplast genome (Hiratsuka et al. 1989). Two homologous fragments (~1.5 kb for each) were amplified by PCR using the primers P1 (5´CGAGCTCCGCGGCTTTCGAATAAGCATGAGTGA TCAAATGG-3´) and P2 (5´-CGGGATCCTGCAGA CGGG AGGATAAAAGGAAGGG-3´), P3 (5´CGCGGATCCGAGCTCGGGGGATAGGCCCCCA TACC-3 ´) a nd P4 ( 5´-G GGC CCGTCGAC AG AGCCCATGAAAGGAAGATCAATGACTC-3´), respectively, and cloned into pBluescript SK (M13) for sequencing before they were inserted into the vector. A PPT-resistant bar gene (600 bp) expression cassette under the control of 16S rRNA gene promoter (144 bp) and psbA terminator sequence (psbA 3´) was inserted between ndhF and trnL fragments. According to the known sequence of bar gene, a pair of primers, P5 (5´TTAGGAAGTAACCATGAGCCC-3´) and P6 (5´ACGGATCAGATCTCGGTGAC-3´), was designed for PCR to identify bar locus in transformed populations. Additionally, primers P7 (5´-CCGATTCACCAAA CTAATTCTTATCTATTTCTG- 3´) a nd P8 ( 5´GTCTTTTTCTTCCAAAGATTTTTACGAATACGC3´) were designed for PCR ana lysis to detect homoplasmy of transplastomic rice lines.
Chloroplast expression vector pRB The chloroplasts were isolated from mature leaves of a rice cultivar Zhonghua 10 as described by Zhao et al. (1991). The chloroplast DNA was extracted from these isolated chloroplasts, and was used as template in PCR reactions containing primers P1/P2 or P3/P4 to amplify two homologous fragments corresponding to ndhF and trnL, respectively. These two fragments were then purified by Advantage PCR-Pure Kit, and cloned into pBluescript SK (M13) to construct sequencing vectors, pSKE and pSKF, for sequencing assay. Double digestion with Sac II and BamH I was performed to cut pSKE and produce a 1.5 kb DNA fragment. This fragment
64 5
was inserted between Sac II site and BamH I site of pSKF, the resulting vector contained rice homologous fragment and named pREF. pU16S was digested by Sac I, and the cut site was blunted with Klenow fragment, then cut with Hind III to generate a modified rice 16S promoter (150 bp long). This digested product was cloned into pT393 between Xba I (blunted) site and Hind III site to construct an expression vector p16ST, which harbored 16S promoter and psbA terminator sequence. pAZ was digested by Xba I, and the cut site was blunted, then cut with Hind III. The 0.5 kb digested product contained bar gene sequence. After purified, it was inserted into p16ST between Sal I (blunted) site and Hind III site to make an intermediate vector p16STB. Then, this vector was cut with BamH I to produce a 0.9 kb DNA fragment, which was cloned into pREF between BamH I sites to generate the rice chloroplast expression vector pRB. Molecular manipulation involving in plasmid extraction, DNA fragment cloning, and identification of recombinant plasmid was performed as described by Sambrook et al. (1989).
Preparation of plant materials for transformation Young ears were taken from the rice cultivar Zhonghua 10 plants at booting stage when the flag leaf is about 5 cm away from its adjacent leaves. The blades attached to the ears were removed with 2-3 leaves remaining. The young ears with sheaths were surface-sterilized with 75% ethanol solution and were pre-incubated at 4°C for 5-10 d. These pre-incubated ears were given another surface-sterilization in 75% ethanol and were sliced into fragments 1-2 cm in length, then placed onto MS medium containing 2 mg L-1 2,4-D for induction of calli. After sub-cultured for 1-2 times, the induced calli can be used as targets for transformation.
Bombardmentofgold-coatedDNAmicroprojectiles on rice calli Embryogenic calli were transferred on hypertonic medium (MS medium containing 0.2 mol L-1 mannitol and 0.2 mol L-1 sorbitol) and incubated for 4 h before bombardment. After the DNA concentration was adjusted to be 1 µg µL-1, the gold-DNA coating was pre-
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
64 6
pared according to Gordon-Kamm et al. (1990). The Bombardment was carried out to deliver the constructs into rice embryogenic calli using PDS-1000/He BIOLISTIC Particle Delivery System (Bio-Rad, Hercules, CA, USA). The parameters set for bombardment in this study were: 28 inches Hg vacuum, 9 cm target distance, 1 100 psi helium pressure, and 1.0 µm gold particle diameter.
Screening for bar-resistant calli and regeneration of plantlets The bombarded calli were incubated on hypertonic medium for 16-20 h, then transferred onto induction medium containing 10 mg L-1 PPT for screening of bar-resistant calli. After 2-3 weeks of cultivation, these calli were placed on the same fresh induction medium to be sub-cultured for further screening. 2-3 weeks later, the viable calli were picked off and air dried in the Petri dish with 3 layers of filter paper for 2-3 d. Subsequently, the air dried calli were transferred to regeneration medium (MS medium containing 2 mg L-1 6-BA, 0.5 mg L-1 NAA, and 10 mg L-1 PPT) to obtain plantlets. When grown to about 5 cm high, the plantlets were transferred to rooting medium (MS medium containing 10 mg L-1 PPT). Finally, the tender plantlets grown to about 10 cm high were acclimated indoors for 3-4 d, and were transplanted into soil for further growth.
LI Yi-nü et al.
ing Kit (Promega, Madison, WI, USA). Southern hybridization analysis was performed as described by Sambrook et al. (1989). For validating the site-specific integration of bar gene and detecting the homoplasmy of chloroplast genome in transformed plants by the product size of PCR reaction, the chloroplast DNA from transformed rice plants was used as template in a PCR reaction containing P7 and P8 primers. To test PPT resistance phenotype of transplastomic plants, two or three young upper leaves from transformed plants at a growth stage between late tillering and heading were smeared with 1 mg mL-1 PPT solution on the surfaces of both sides, and the same treatment was applied to non-transformed plants as the control. Genetic analysis of progenies from bartransplastomic rice lines. Reciprocal crosses between bar-transplastomic and the wild type rice were carried out, and the seeds of hybrid progeny were harvested. After surface-sterilized and dehusked, the seeds were transferred into a petri dish ( 9) containing MS medium supplemented with 1 mg mL-1 PPT, and incubated in growth chamber at 25°C with a 12 h/12 h light/dark regime to examine seed germination and seedling growth. 16 seeds from each cross (from direct cross and reciprocal cross) were placed in a Petri dish, and two more dishes were set as replicates.
RESULTS
Detection of bar-resistant transformants Expression vector for rice chloroplast Rice chloroplast was separated from transformed rice plants, and applied to extract chloroplast DNA according to the methods described by Zhao et al. (1991). The extracted chloroplast DNA was used as template in a reaction performed on a MJ Research PTC-200 thermocycler, in the presence of P5 and P6 primers and under routine temperature and time conditions, to detect the integration of bar gene in transformed plants. Chloroplast DNA from transformed rice plants was digested with Xba I and separated by gel electrophoresis and transferred onto a Hybond-N membrane. The bar gene fragment was labelled with [α-32P]dATP (Yahui Ltd., Beijing) as probe by using Random Primer Label-
Amplified products from a PCR reaction using P1 and P2 primers were double-digested with Sac II/BamH I, and cloned into pSK between Sac II and BamH I sites to generate sequencing vector pSKE. The sequencing results indicated the fragment was 1 487 bp long, and agreed completely with the published sequence. Therefore, it was constructed into the chloroplast expression vector as a homologous fragment corresponding to ndhF gene. Similarly, the amplified product from P3 and P4 primers was double-digested with BamH I and Sal I , and inserted into pSK between BamH I and Sal I sites to obtain pSKF, the sequencing results also confirmed the 1 463 bp long fragment could be used as
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Establishment of a Gene Expression System in Rice Chloroplast and Obtainment of PPT-Resistant Rice Plants
the other homologous fragment corresponding to trnL gene. By introduction the homologous fragment of ndhF gene into pSKF between Sac II and BamH I sites, the pREF vector containing rice homologous fragments was constructed (Fig.1-A). The 150 bp long modified rice 16S promoter was generated by cutting the plasmid pU16S with Sac I and Hind III, respectively, and cloned into Xba I (blunted)/ Hind III-digested pT393 to create p16ST expression vector containing 16S promoter and psbA terminator. The 0.5 kb long bar gene was recovered from pAZ by cutting with Xba I (blunted)/Hind III, and inserted into p16ST at Sal I (blunted) and Hind III sites to produce an intermediate vector p16STB, from which a 0.9 kb long DNA fragment was cut and inserted into BamH Idigested pREF to generate expression vector pRB for rice chloroplast genome (Fig.1-B).
Selection and regeneration of transplastomic plantlets from bombarded calli After incubated on highly osmotic medium, the bombarded calli were transferred onto PPT-containing induction medium for screening and subculture. Then, the survived resistant calli were transferred onto regeneration medium for induction and differentiation to regenerate shoots. After subcultured on rooting
64 7
medium, the regenerated plantlets were hardened and tr a nsferr ed i nto soi l for growt h into norma l transplastomic plants.
Molecular identification of the bar gene in transplastomic rice plants To screen of transplastomic plants, PCR reaction containing bar-specific P5 and P6 primers was performed on templates of isolated chloroplast DNA from regenerated transformed rice and non-transformed wild-type rice, respectively. The electrophoresis pattern showed PCR DNA samples from transformants always reveal a single 0.5 kb DNA band for the bar gene, which was the same in length as that from the positive control, while DNA sample from non-transformed wild-type didn’t present the corresponding band, suggesting the bar gene become integrated into the rice chloroplast genome (Fig.2).
Southern blotting analysis of bar gene in transplastomic rice plants The 0.5 kb bar gene fragment was used as a probe in a southern analysis of PCR-amplified products from four transformants. As shown in Fig.3, all the amplified bands from four transformants were probed with the
A
B
Fig. 1 Construction of chloroplast transformation vector and localization of foreign gene bar in the vector. A, plasmid pREF, showing the two homologous fragments, ndhF and trnL, in the wild-type rice chloroplast genome; B, plasmid pRB, showing the integration of the bar gene expression cassette between ndhF and trnL fragments of pREF. Gene bar is expressed under the control of 16S rRNA gene promoter Prrn (16S) and psbA terminator sequence (psbA 3´). The sites of primers (P7 and P8) for PCR assay of transplastomic plants are also shown in the maps.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
64 8
0.5 kb [α- 32P]-labelled bar gene, indicating that the amplified bands were the inserted exogenous gene, which further confirmed that the exogenous bar gene has been successfully integrated into the chloroplast genome in Oryza sativa L.
Site-specific integration and heteroplasmy of bar gene in chloroplast genome of transplastomic rice plants The primers P7 and P8 were, respectively, complementary to two homologous fragments corresponding to ndhF and trnL in rice chloroplast genome (Fig.1). PCR reaction with primers P7 and P8 should yield a 0.7 kb band from template of non-transformed wild-type rice or a 1.8 kb band from transformed rice in compl ete homopla smy (i ntegra ti on of transgenes into all chloroplast genomes). In the case of heteroplasmy in rice chloroplasts in a cell, both
LI Yi-nü et al.
bands would be generated from transformed and nontransformed chloroplast copies, respectively. We performed PCR reactions with primers P7 and P8, using chloroplast DNA harboring the inserted exogenous gene as templates and the chloroplast DNA from non-transformed wild-type rice as control. Results indicated that these transgenic plants turned out to be heterozygous plants in chloroplast genome and exhibited individual differences in the degree of homoplasmy (Fig.4).
The PPT-resistance of bar-transplastomic rice plants The resistance of transplastomic plants to herbicide PPT was scored one week after they were smeared by PPT solution on both sides of upper leaves. As showed in Fig.5, the wild-type control plants developed severe injury symptom such as chlorosis in the leaf veins and tips and died 16 d after PPT treatment, whereas these transformed plants, proved to harbor bar gene in their chloroplast genomes by molecular analysis, grew normally, implying they were resistant to PPT treatment though they were heteroplasmy in chloroplast populations within a cell.
Maternal inheritance of bar gene in the transplastomic rice lines Fig. 2 Detection of bar gene (0.5 kb) by PCR amplification from chloroplast genome of transplastomic rice plants. M, 1 kb DNA ladder; lane 1, positive control (plasmid pRB); lane 2, negative control (wild-type rice); lanes 3-8, transplastomic plants 1-6, respectively.
To detect the resistance trait in F1 progeny and its genetic transmission, crosses between transplastomic lines
Fig. 3 Southern bloting analysis of bar gene integration into chloroplast genome of transplastomic rice plantlets. After restriction digestion, gel electrophoresis, and Southern transfer, the chloroplast genomic DNAs from transplastomic rice plantlets hybridized with [α-32 P]-labelled bar fragment. Lane 1, positive control; lane 2, negative control; lanes 3-6, transplastomic plants 1-4, respectively.
Fig. 4 PCR assay of site-specific integration of foreign gene and homoplasmy of chloroplast genome in transformed rice. Primers P7 and P8 were used in the PCR assay. M, 1 kb DNA ladder; lane 1, negative control (plasmid pREF); lane 2, positive control (plasmid pRB); lane 3, wild-type rice (negative con trol); lanes 4-9, transplastomic plants 1-6, respectively.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Establishment of a Gene Expression System in Rice Chloroplast and Obtainment of PPT-Resistant Rice Plants
64 9
and wile-type lines were performed in the greenhouse. The seeds of F 1 progeny from cross between transplastomic line as female parent and wile-type line as male parent were labeled A, while those from transplastomic line as male parent were labeled B (Fig.6). These seeds were placed on MS PPT-supplemented medium for germination and seedling growth. The results showed that seeds from cross between transplastomic line ( ) and wile-type line ( ) could germinate and sprout green shoots based on its resis-
tance to PPT (Fig.6-A), whileas seeds from cross between transplastomic line ( ) and wile-type line ( ) yielded white shoots and failed to develop into seedlings due to its susceptibility (Fig.6-B), which suggested the resistant gene be transmitted maternally into next generation, excluding the possibility of pollen transmission, and also indicated that the bar gene became integrated into chloroplast genome rather than nuclear genome, and expressed and/or genetically transmitted.
Fig. 5 Herbicide sensitivity assay by smearing leaves of transplastomic rice plants with PPT solution. Left, bar-containing transplastomic rice plants; right, non-transplastomic wild-type rice plants.
Fig. 6 Genetic analysis for resistance to PPT of F1 progeny from reciprocal crosses between transplastomic rice lines and wild-type rice lines. Seeds were placed on PPT-supplemented medium. A, transplastomic line ( ) × wild-type line ( ); B, transplastomic line ( ) × wild-type line ( ).
DISCUSSION
a few plant species. Rice (Oryza sativa L.) is one of the most important plant crops throughout the world, and is also a critical monocotyledonous model plant species. Previous report showed that the bar gene conferring resistance to herbicide PPT is an appropriate selective marker used for the screening the transgenic lines in plant genetic engineering (Wehrmann et al. 1996). In a nuclear genetic engineering, Rathore et al. (1993) introduced bar gene into rice nuclear genome by PEG-mediated transformation of protoplasts. In this work, we developed rice chloroplast transformation system using the bar gene as selective marker and obtained transplastomic lines harboring bar gene. This implies that it will be possible to improve rice agronomic traits by introducing other genes of interest into chloroplast genome. Successful chloroplast transformation depends on
Chloroplast transformation of higher plants is the new research area of plant genetic engineering. It is also an extremely attractive technology for the development of genetically modified plants with transgenic traits, due to its distinct advantages over nuclear genetic engineering, such as high-throughput and compartmentalization of expressed products, site-specific integration, lack of gene silencing and position effects and the containment of the transgene (Daniell et al. 2002). Particularly, in chloroplast engineering, the foreign genes usually inherit in a maternal pattern, which greatly reduce hazards of horizontal gene transfer into related plants, and provide unique characteristics in biological safety. However, successful chloroplast transformation in higher plants reported so far was limited in only
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
65 0
the integration of the foreign DNA into the chloroplast genome through site-specific homologous recombination by double crossing. For most transformation vectors, favorable homologous fragment is 1-2 kb in length, because fragments that are too short would give rise to lower transformation efficiency (Sikdar et al. 1998) or that are too long would make it inconvenient to manipulate in vitro. In Khan and Maliga’s study, transplastomic rice (heteroplastomic) plants were obtained by inserting foreign gene into the region between trnV/rps12/7 within the IR region of rice chloroplast genome (Khan and Maliga 1999). Considering the possible disruption of native gene function by insertion of foreign sequences, we chose the non-coding region between ndhF and trnL within the small single copy region of chloroplast genome as the site for inserting and cloned two fragments about 1.5 kb upstream and/ or downstream non-coding region as homologous fragments. The ta rge t t is s ue for t he r i ce chl or opl a s t transformation, unlike for members of Solanaceae, is non-green callus. The prerequisite of successful transformation is that it should be possible to determine if the expression cassette is active or is inactive in non-green plastid. Silhavy and Maliga (1998) confirmed that eubacterial-type plastid-encoded RNA polymerase, required for transcription of plastid genes in higher plants, was not only active in chloroplast but active in non-green plastid as well. They transformed plastid genome with fluorescent antibiotic marker gene (FLARE-S) and detected fluorescent protein expression both in chromoplasts of petals and in other plastids of roots in transgenic tobacco (Khan and Maliga 1999). Similarly, it was reported in another study that aadA, integrated into tomato chloroplast genome, could efficiently express both in green leaves and immature fruits and in red mature fruits (Ruf et al. 2001). Additionally, green fluorescent protein was also proved to be expressed in potato tubers (Sidorov et al. 1999). It is well known that chloroplasts can present in green immature fruits and convert into chromoplasts in ripening tomato fruits and, therefore, the expression of foreign genes in red mature fruits together with the observation in potato tubers illuminated that a plastid expression cassette is usually capable of directing the expres-
LI Yi-nü et al.
sion of foreign genes in non-green plastids. This is further supported by our observations that transfor med non-gr ee n c a ll i gene ra t ed the gr ee n transplastomic rice plants. In this work, we analyzed the degrees of chloroplast homoplasmy by PCR using chloroplast genomic DNA as templates. Transgenic plants tested here were found to be heterozygous plants in chloroplast genome with transformed and non-transformed chloroplasts existing within the same cell or in the same plant. In addition, different plants presented different degrees in homoplasmy. It is tempting to speculate that this outcome was mirrored by differentiation-dependent development of homoplasmy, namely, longer duration and more times for differentiation on regeneration medium could accelerate the evolution of homoplasmy from heteroplasmy. In the future studies, we will undoubtedly focus on how heteroplasmy is resolved into homoplasmy and the affecting factors that are essential for this process.
CONCLUSION Unlike in the nuclear engineering, foreign genes are generally introduced into chloroplast genome in a manner of s it e -s pec i fi c i nte gra t ion vi a homologous recombination. Based on this mechanism, the foreign bar gene, also used as a selective marker gene in this study, has been introduced into rice chloroplast genome by particle bombardment technology. Molecular assay has validated that we obtained PPT-resistant bartransplastomic rice lines. Additionally, genetic analysis by reciprocal crosses confirmed that the stable inheritance of bar gene in rice chloroplast genome, and its inheritance pattern is consistent with maternal transmission genomic. Therefore, it is believed that the foreign gene expression system has been successfully developed in rice chloroplast genome.
Acknowledgements This study was funded by the 948 Program of the Ministry of Agriculture of China (991020) and by the Natural Science Foundation of the Science and Technology Department of Jiangsu Province, China (BK2001139).
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Establishment of a Gene Expression System in Rice Chloroplast and Obtainment of PPT-Resistant Rice Plants
65 1
References
a selectable marker gene and for the production of herbicide-
Boynton J E, Gillham N W, Harris E H, Hosler J P, Johnson A
resistant rice plants from protoplasts. Plant Molecular
M, Jones A R, Randolph-Anderson B L, Robertson D, Klein
Biology, 21, 871-884.
T M, Shark K B , Sanford J C. 198 8. Chloroplast
Ris H, Plaut W. 1962. Ultrastructure of DNA-containing areas
transformation in Chlamyd omonas with high velocity
in the chloroplast of Chlamydomonas. Journal of Cell Biology, 13, 383-391.
microprojectiles. Science, 240, 1534-1538. Daniell H, Khan M S, Allison L. 2002. Milestones in chloroplast
Ruf S, Hermann M, Berger I J, Carrer H, Bock R. 2001. Stable
genetic engineering: an environmentally friendly era in
genetic transformation of tomato plastids and expression of
biotechnology. Trends in Plant Science, 7, 84-91.
a foreign protein in fruit. Nature Biotechnology, 19, 870-875.
Fromm H, Edelman M, Aviv D, Galun E. 1987. The molecular
Sambrook J, Fritsch E F, Maniatis T. 1989. Molecular Cloning:
basis of rRNA-dependent spectinomycin resistance in
A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory
Nicotiana chloroplast. The EMBO Journal, 11, 3233-3237. Gordon-Kamm W J, Spencer T M, Mangano M L, Adams T R,
Sidorov V A, Kasten D, Pang S Z, Hajdukiewicz P T, Staub J M,
Daines R J, Start W G, O’Brien J V, Chambers S A, Adama
Nehra N S. 1999. Technical advance: stable chloroplast
W R, Willetts N G, Rice T B, Mackey C J, Krueger R W,
transformation in potato: use of green fluorescent protein as
Kausch A P, Lemaux P G. 1990. Transformation of maize
a plastid marker. The Plant Journal, 19, 209-216.
cells and regeneration of fertile transgenic plants. The Plant Cell, 2, 603-618. Hiratsuka J, Shimada H, Whittier R, Ishibashi T, Sakamoto M, Mori M, Kondo C, Honji Y, Sun C R, Meng B Y, Li Y Q,
Press, New York.
Sikdar S R, Serino G, Chaudhuri S, Maliga P. 1998. Plastid transformation in Arabidopsis thaliana. Plant Cell Reports, 18, 20-24. Silhavy D, Maliga P. 1998. Plastid promoter utilization in a rice
Kanno A, Nishizawa Y, Hirai A, Shinozaki K, Sugiura M.
embryogenic cell culture. Current Genetics, 34, 67-70.
1989. The complete sequence of the rice (Oryza sativa)
Su N, Sun M, Li Y N, Ni P C, Shen G F. 2003. Isolation and
chloroplast genome: intermolecular recombination between
modification of rice chloroplast 16S promoter, construction
distinct tRNA genes accounts for a major plastid DNA
of expression vector and transformation. Chinese Bulletin of
inversion during the evolution of the cereals. Molecular and General Genetics, 217, 185-194. Hou B K, Zhou Y H, Wan L H, Zhang Z L, Shen G F, Chen Z H, Hu ZM. 2003. Chloroplast transformation in oilseed rape. Transgenic Research, 12, 111-114.
Botany, 20, 295-301. (in Chinese) Svab Z, Hajdukiewicz P T, Maliga P. 1990. Stable transformation of plastid in higher plants. Proceedings of the National Academy of Sciences of the USA, 87, 8526-8530. Wehrmann A, Vliet A V, Opsomer C, Botterman J, Schulz A.
Khan M S, Maliga P. 1999. Fluorescent antibiotic resistance
1996. The similarities of the bar and pat gene products make
marker for tracking plastid transformation in higher plants.
them equally applicable for plant engineers. Nature
Nature Biotechnology, 17, 910-915.
Biotechnology, 14, 1274-1276.
Lutz K A, Knapp J E, Maliga P. 2001. Expression of bar in the
Zhao Y, Weng X H, Zou Q, Shen G F, Tang S, Chai J H, Wang X
plastid genome confers herbicide resistance. Plant Physiology,
M. 1991. Constructions of cosmid library and detailed
125, 1585-1590.
physical map of rice chloroplast. Acta Genetica Sinica, 8,
Rathore K S, Chowdhury V K, Hodges T K. 1993. Use of bar as
149-160. (in Chinese) (Edited by ZHANG Yi-min)
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
2009, 8(6): 643-651
June 2009
Establishment of a Gene Expression System in Rice Chloroplast and Obtainment of PPT-Resistant Rice Plants LI Yi-nü1*, SUN Bing-yao2*, SU Ning3, MENG Xiang-xun2, ZHANG Zhi-fang1 and SHEN Gui-fang1 1
Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, P.R.China
2
College of Life Sciences, Suzhou University, Suzhou 215123, P.R.China
3
Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing 100081, P.R.China
Abstract In contrast to the situation of random integration of foreign genes in nuclear transformation, the introduction of genes via chloroplast genetic engineering is characterized by site-specific pattern via homologous recombination. To establish an expression system for alien genes in rice chloroplast, the intergenic region of ndhF and trnL was selected as target for sitespecific integration of PPT-resistant bar gene in this study. Two DNA fragments suitable for homologous recombination were cloned from rice chloroplast genome DNA using PCR technique, and the chloroplast-specific expression vector pRB was constructed by fusing a modified 16S rRNA gene promoter to bar gene together with terminator of psbA gene 3´ sequence. Chloroplast transformation was carried out by biolistic bombardment of sterile rice calli with the pRB construct. Subsequently, the regenerated plantlets and seeds of progeny arising from reciprocal cross to the wild-type lines were obtained. Molecular analysis suggested that the bar gene has been integrated into rice chloroplast genome. Genetic analysis revealed that bar gene could be transmitted and expressed normally in chloroplast genome. Thus, the bar gene conferred not only selection pressure for the transformation of rice chloroplast genome, but PPT-resistant trait for rice plants as well. It is suggested that an efficient gene expression system in the rice chloroplast has been established by chloroplast transformation technique. Key words: Oryza sativa L., chloroplast transformation, bar gene, homologous fragments
INTRODUCTION As the site of photosynthesis in eukaryotic cells, chloroplasts have long been investigated by plant biologists. Since the definitive histochemical evidence for the presence of DNA in chloroplasts of Chlamydomonas was published about forty years ago (Ris and Plaut 1962), the molecular genetic research in chloroplast has been rapidly developed, and chloroplast genomes in tobacco, rice, maize, spinach, alfalfa and Chlamydomonas have been sequenced, which provided the foundation for
genetic engineering of chloroplast genome. The event that successful genetic transformation in Chlamydomonas genome was achieved marked the beginning of chloroplast genetic engineering (Boynton et al. 1988). Available studies showed that chloroplast transformation via homologous recombination has several advantages over nuclear transformation, such as high-level transgene expression, reliable security, and site-specific integration of transgenes, which hereby attract more and more attention and facilitate its wide application. Chloroplast genetic engineering actually offers some attractive advantages over nuclear transformation.
This paper is translated from its Chinese version in Scientia Agricultura Sinica. LI Yi-nü, E-mail: [email protected]; Correspondence SHEN Gui-fang, Professor, Tel: +86-10-82109854, E-mail: [email protected] *
The authors contributed equally to this work. © 2009, CAAS. All rights reserved. Published by Elsevier Ltd. doi:10.1016/S1671-2927(08)60259-X
64 4
However, compared with nuclear transformation, chloroplast transformation is just at the stage of its beginning. Up to now, the application of chloroplast genetic engineering has been mostly limited to very few plant species such as tobacco (Svab et al. 1990), potato (Sidorov et al. 1999), tomato (Ruf et al. 2001), and rapeseed (Hou et al. 2003). Moreover, no report is available on the chloroplast transformation to obtain fertile monocotyledonous plants. Therefore, it is desirable to establish gene expression system in the chloroplast of a number of economically important crop plants. Rice is one of the most important crops cultivated worldwide. To develop an efficient gene expression system in the rice chloroplast and adopt its unique advantages to improve rice breeding for resistant traits will be a promising research subject. Among the existing chloroplast transformation systems, spectinomycin is the most versatile selectable antibiotic resistance marker, and is proved to be highly effective in chloroplast transformation of tobacco, potato, tomato, and other species in the family Solanaceae. But in the case of rice, spectinomycin is not an excellent choice, since rice presents natural resistance to this antibiotic just as most gramineous plants do (Fromm et al. 1987). Therefore, for the establishment of chloroplast transformation system in rice, it is very critical to screen an accessible selectable marker instead of spectinomycin. So far, only one report involving in the screening of alternate antibiotics other than spectinomycin for rice chloroplast transformation is available (Khan and Maliga 1999). They transformed rice protoplast with aadAgfp fusion construct by using streptomycin resistance gene as a selectable marker, and obtained some transformed plants though no further information about the reproductive traits or genetic analysis of progeny is presented. Molecular analysis indicated that exogenous gene expressed in only a few chloroplasts among these transformed plants. The bar gene, which confers resistance to PPT (L-phosphinotricin), the active ingredient of herbicide Basta, was proved to be an efficient selectable marker in tobacco chloroplast transformation (Lutz et al. 2001). In this paper, we describe the cloning of homologous fragments for the site-specific integration of exogenous gene, present the construction of expression vector harboring a modified 16S rRNA gene promoter
LI Yi-nü et al.
(Su et al. 2003) using PPT-resistant gene bar as a selectable marker and the genetic transformation of rice calli by biolistics method, and report the development of a gene expression system in the chloroplast of Oryza sativa and obtainment of fertile PPT-resistant rice plants.
MATERIALS AND METHODS Bacterial strains and plasmids Escherichia coli DH5a strain and plasmid pBluescript SK (M13) were kept in the Key Lab for Crop Biotechnology, CAAS, China. Plasmid vecotrs pAZ, pT393, and pU16S, harboring bar gene, psbA terminator sequence (psbA 3´), and rice chloroplast 16S rRNA gene promoter (144 bp long), respectively, were constructed previously in the Key La b for Crop Biotechnology, CAAS, China (Su et al. 2003).
Plant materials Rice cultivar Zhonghua 10 (Oryza sativa L. ssp. japonica) used in this study was obtained from the Institute of Crop Breeding and Cultivation, Chinese Academy of Agriculture Sciences. Young ears were used as explant to induce calli for biolistic transformation, and for further screening and regeneration of transplastomic plantlets. The culture media applied in this study are as follows: MS supplemented with 2 mg L-1 2,4-D was used as callus induction and subculture medium, MS containing 0.2 mol L-1 mannitol and 0.2 mol L-1 sorbitol as highly osmotic medium, MS containing 2 mg L-1 6BA and 0.5 mg L-1 NAA as regeneration medium, and the basal medium for rooting.
Agents and enzymes Restriction enzymes, Klenow enzyme, T4 DNA ligase, T4 DNA polymerase, Random Primer Labeling Kit were purchased from Promega Inc (Madison, WI, USA). Advantage PCR-Pure Kit and Hybond-N membrane were products from Clontech (Mountain View, CA, USA) and Amersham (Pittsburgh, PA, USA), respectively. [α-32P] dATP was purchased from Yahui Ltd., Beijing. All other chemicals used in this study were analytical pure agents.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Establishment of a Gene Expression System in Rice Chloroplast and Obtainment of PPT-Resistant Rice Plants
Primers In terms of site-specific integration of foreign genes in chloroplast genome by homologous recombination, the non-coding region between ndhF and trnL genes in the small single copy (SSC) region was chosen as the insertion site for bar gene according to the published sequence of rice chloroplast genome (Hiratsuka et al. 1989). Two homologous fragments (~1.5 kb for each) were amplified by PCR using the primers P1 (5´CGAGCTCCGCGGCTTTCGAATAAGCATGAGTGA TCAAATGG-3´) and P2 (5´-CGGGATCCTGCAGA CGGG AGGATAAAAGGAAGGG-3´), P3 (5´CGCGGATCCGAGCTCGGGGGATAGGCCCCCA TACC-3 ´) a nd P4 ( 5´-G GGC CCGTCGAC AG AGCCCATGAAAGGAAGATCAATGACTC-3´), respectively, and cloned into pBluescript SK (M13) for sequencing before they were inserted into the vector. A PPT-resistant bar gene (600 bp) expression cassette under the control of 16S rRNA gene promoter (144 bp) and psbA terminator sequence (psbA 3´) was inserted between ndhF and trnL fragments. According to the known sequence of bar gene, a pair of primers, P5 (5´TTAGGAAGTAACCATGAGCCC-3´) and P6 (5´ACGGATCAGATCTCGGTGAC-3´), was designed for PCR to identify bar locus in transformed populations. Additionally, primers P7 (5´-CCGATTCACCAAA CTAATTCTTATCTATTTCTG- 3´) a nd P8 ( 5´GTCTTTTTCTTCCAAAGATTTTTACGAATACGC3´) were designed for PCR ana lysis to detect homoplasmy of transplastomic rice lines.
Chloroplast expression vector pRB The chloroplasts were isolated from mature leaves of a rice cultivar Zhonghua 10 as described by Zhao et al. (1991). The chloroplast DNA was extracted from these isolated chloroplasts, and was used as template in PCR reactions containing primers P1/P2 or P3/P4 to amplify two homologous fragments corresponding to ndhF and trnL, respectively. These two fragments were then purified by Advantage PCR-Pure Kit, and cloned into pBluescript SK (M13) to construct sequencing vectors, pSKE and pSKF, for sequencing assay. Double digestion with Sac II and BamH I was performed to cut pSKE and produce a 1.5 kb DNA fragment. This fragment
64 5
was inserted between Sac II site and BamH I site of pSKF, the resulting vector contained rice homologous fragment and named pREF. pU16S was digested by Sac I, and the cut site was blunted with Klenow fragment, then cut with Hind III to generate a modified rice 16S promoter (150 bp long). This digested product was cloned into pT393 between Xba I (blunted) site and Hind III site to construct an expression vector p16ST, which harbored 16S promoter and psbA terminator sequence. pAZ was digested by Xba I, and the cut site was blunted, then cut with Hind III. The 0.5 kb digested product contained bar gene sequence. After purified, it was inserted into p16ST between Sal I (blunted) site and Hind III site to make an intermediate vector p16STB. Then, this vector was cut with BamH I to produce a 0.9 kb DNA fragment, which was cloned into pREF between BamH I sites to generate the rice chloroplast expression vector pRB. Molecular manipulation involving in plasmid extraction, DNA fragment cloning, and identification of recombinant plasmid was performed as described by Sambrook et al. (1989).
Preparation of plant materials for transformation Young ears were taken from the rice cultivar Zhonghua 10 plants at booting stage when the flag leaf is about 5 cm away from its adjacent leaves. The blades attached to the ears were removed with 2-3 leaves remaining. The young ears with sheaths were surface-sterilized with 75% ethanol solution and were pre-incubated at 4°C for 5-10 d. These pre-incubated ears were given another surface-sterilization in 75% ethanol and were sliced into fragments 1-2 cm in length, then placed onto MS medium containing 2 mg L-1 2,4-D for induction of calli. After sub-cultured for 1-2 times, the induced calli can be used as targets for transformation.
Bombardmentofgold-coatedDNAmicroprojectiles on rice calli Embryogenic calli were transferred on hypertonic medium (MS medium containing 0.2 mol L-1 mannitol and 0.2 mol L-1 sorbitol) and incubated for 4 h before bombardment. After the DNA concentration was adjusted to be 1 µg µL-1, the gold-DNA coating was pre-
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
64 6
pared according to Gordon-Kamm et al. (1990). The Bombardment was carried out to deliver the constructs into rice embryogenic calli using PDS-1000/He BIOLISTIC Particle Delivery System (Bio-Rad, Hercules, CA, USA). The parameters set for bombardment in this study were: 28 inches Hg vacuum, 9 cm target distance, 1 100 psi helium pressure, and 1.0 µm gold particle diameter.
Screening for bar-resistant calli and regeneration of plantlets The bombarded calli were incubated on hypertonic medium for 16-20 h, then transferred onto induction medium containing 10 mg L-1 PPT for screening of bar-resistant calli. After 2-3 weeks of cultivation, these calli were placed on the same fresh induction medium to be sub-cultured for further screening. 2-3 weeks later, the viable calli were picked off and air dried in the Petri dish with 3 layers of filter paper for 2-3 d. Subsequently, the air dried calli were transferred to regeneration medium (MS medium containing 2 mg L-1 6-BA, 0.5 mg L-1 NAA, and 10 mg L-1 PPT) to obtain plantlets. When grown to about 5 cm high, the plantlets were transferred to rooting medium (MS medium containing 10 mg L-1 PPT). Finally, the tender plantlets grown to about 10 cm high were acclimated indoors for 3-4 d, and were transplanted into soil for further growth.
LI Yi-nü et al.
ing Kit (Promega, Madison, WI, USA). Southern hybridization analysis was performed as described by Sambrook et al. (1989). For validating the site-specific integration of bar gene and detecting the homoplasmy of chloroplast genome in transformed plants by the product size of PCR reaction, the chloroplast DNA from transformed rice plants was used as template in a PCR reaction containing P7 and P8 primers. To test PPT resistance phenotype of transplastomic plants, two or three young upper leaves from transformed plants at a growth stage between late tillering and heading were smeared with 1 mg mL-1 PPT solution on the surfaces of both sides, and the same treatment was applied to non-transformed plants as the control. Genetic analysis of progenies from bartransplastomic rice lines. Reciprocal crosses between bar-transplastomic and the wild type rice were carried out, and the seeds of hybrid progeny were harvested. After surface-sterilized and dehusked, the seeds were transferred into a petri dish ( 9) containing MS medium supplemented with 1 mg mL-1 PPT, and incubated in growth chamber at 25°C with a 12 h/12 h light/dark regime to examine seed germination and seedling growth. 16 seeds from each cross (from direct cross and reciprocal cross) were placed in a Petri dish, and two more dishes were set as replicates.
RESULTS
Detection of bar-resistant transformants Expression vector for rice chloroplast Rice chloroplast was separated from transformed rice plants, and applied to extract chloroplast DNA according to the methods described by Zhao et al. (1991). The extracted chloroplast DNA was used as template in a reaction performed on a MJ Research PTC-200 thermocycler, in the presence of P5 and P6 primers and under routine temperature and time conditions, to detect the integration of bar gene in transformed plants. Chloroplast DNA from transformed rice plants was digested with Xba I and separated by gel electrophoresis and transferred onto a Hybond-N membrane. The bar gene fragment was labelled with [α-32P]dATP (Yahui Ltd., Beijing) as probe by using Random Primer Label-
Amplified products from a PCR reaction using P1 and P2 primers were double-digested with Sac II/BamH I, and cloned into pSK between Sac II and BamH I sites to generate sequencing vector pSKE. The sequencing results indicated the fragment was 1 487 bp long, and agreed completely with the published sequence. Therefore, it was constructed into the chloroplast expression vector as a homologous fragment corresponding to ndhF gene. Similarly, the amplified product from P3 and P4 primers was double-digested with BamH I and Sal I , and inserted into pSK between BamH I and Sal I sites to obtain pSKF, the sequencing results also confirmed the 1 463 bp long fragment could be used as
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Establishment of a Gene Expression System in Rice Chloroplast and Obtainment of PPT-Resistant Rice Plants
the other homologous fragment corresponding to trnL gene. By introduction the homologous fragment of ndhF gene into pSKF between Sac II and BamH I sites, the pREF vector containing rice homologous fragments was constructed (Fig.1-A). The 150 bp long modified rice 16S promoter was generated by cutting the plasmid pU16S with Sac I and Hind III, respectively, and cloned into Xba I (blunted)/ Hind III-digested pT393 to create p16ST expression vector containing 16S promoter and psbA terminator. The 0.5 kb long bar gene was recovered from pAZ by cutting with Xba I (blunted)/Hind III, and inserted into p16ST at Sal I (blunted) and Hind III sites to produce an intermediate vector p16STB, from which a 0.9 kb long DNA fragment was cut and inserted into BamH Idigested pREF to generate expression vector pRB for rice chloroplast genome (Fig.1-B).
Selection and regeneration of transplastomic plantlets from bombarded calli After incubated on highly osmotic medium, the bombarded calli were transferred onto PPT-containing induction medium for screening and subculture. Then, the survived resistant calli were transferred onto regeneration medium for induction and differentiation to regenerate shoots. After subcultured on rooting
64 7
medium, the regenerated plantlets were hardened and tr a nsferr ed i nto soi l for growt h into norma l transplastomic plants.
Molecular identification of the bar gene in transplastomic rice plants To screen of transplastomic plants, PCR reaction containing bar-specific P5 and P6 primers was performed on templates of isolated chloroplast DNA from regenerated transformed rice and non-transformed wild-type rice, respectively. The electrophoresis pattern showed PCR DNA samples from transformants always reveal a single 0.5 kb DNA band for the bar gene, which was the same in length as that from the positive control, while DNA sample from non-transformed wild-type didn’t present the corresponding band, suggesting the bar gene become integrated into the rice chloroplast genome (Fig.2).
Southern blotting analysis of bar gene in transplastomic rice plants The 0.5 kb bar gene fragment was used as a probe in a southern analysis of PCR-amplified products from four transformants. As shown in Fig.3, all the amplified bands from four transformants were probed with the
A
B
Fig. 1 Construction of chloroplast transformation vector and localization of foreign gene bar in the vector. A, plasmid pREF, showing the two homologous fragments, ndhF and trnL, in the wild-type rice chloroplast genome; B, plasmid pRB, showing the integration of the bar gene expression cassette between ndhF and trnL fragments of pREF. Gene bar is expressed under the control of 16S rRNA gene promoter Prrn (16S) and psbA terminator sequence (psbA 3´). The sites of primers (P7 and P8) for PCR assay of transplastomic plants are also shown in the maps.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
64 8
0.5 kb [α- 32P]-labelled bar gene, indicating that the amplified bands were the inserted exogenous gene, which further confirmed that the exogenous bar gene has been successfully integrated into the chloroplast genome in Oryza sativa L.
Site-specific integration and heteroplasmy of bar gene in chloroplast genome of transplastomic rice plants The primers P7 and P8 were, respectively, complementary to two homologous fragments corresponding to ndhF and trnL in rice chloroplast genome (Fig.1). PCR reaction with primers P7 and P8 should yield a 0.7 kb band from template of non-transformed wild-type rice or a 1.8 kb band from transformed rice in compl ete homopla smy (i ntegra ti on of transgenes into all chloroplast genomes). In the case of heteroplasmy in rice chloroplasts in a cell, both
LI Yi-nü et al.
bands would be generated from transformed and nontransformed chloroplast copies, respectively. We performed PCR reactions with primers P7 and P8, using chloroplast DNA harboring the inserted exogenous gene as templates and the chloroplast DNA from non-transformed wild-type rice as control. Results indicated that these transgenic plants turned out to be heterozygous plants in chloroplast genome and exhibited individual differences in the degree of homoplasmy (Fig.4).
The PPT-resistance of bar-transplastomic rice plants The resistance of transplastomic plants to herbicide PPT was scored one week after they were smeared by PPT solution on both sides of upper leaves. As showed in Fig.5, the wild-type control plants developed severe injury symptom such as chlorosis in the leaf veins and tips and died 16 d after PPT treatment, whereas these transformed plants, proved to harbor bar gene in their chloroplast genomes by molecular analysis, grew normally, implying they were resistant to PPT treatment though they were heteroplasmy in chloroplast populations within a cell.
Maternal inheritance of bar gene in the transplastomic rice lines Fig. 2 Detection of bar gene (0.5 kb) by PCR amplification from chloroplast genome of transplastomic rice plants. M, 1 kb DNA ladder; lane 1, positive control (plasmid pRB); lane 2, negative control (wild-type rice); lanes 3-8, transplastomic plants 1-6, respectively.
To detect the resistance trait in F1 progeny and its genetic transmission, crosses between transplastomic lines
Fig. 3 Southern bloting analysis of bar gene integration into chloroplast genome of transplastomic rice plantlets. After restriction digestion, gel electrophoresis, and Southern transfer, the chloroplast genomic DNAs from transplastomic rice plantlets hybridized with [α-32 P]-labelled bar fragment. Lane 1, positive control; lane 2, negative control; lanes 3-6, transplastomic plants 1-4, respectively.
Fig. 4 PCR assay of site-specific integration of foreign gene and homoplasmy of chloroplast genome in transformed rice. Primers P7 and P8 were used in the PCR assay. M, 1 kb DNA ladder; lane 1, negative control (plasmid pREF); lane 2, positive control (plasmid pRB); lane 3, wild-type rice (negative con trol); lanes 4-9, transplastomic plants 1-6, respectively.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Establishment of a Gene Expression System in Rice Chloroplast and Obtainment of PPT-Resistant Rice Plants
64 9
and wile-type lines were performed in the greenhouse. The seeds of F 1 progeny from cross between transplastomic line as female parent and wile-type line as male parent were labeled A, while those from transplastomic line as male parent were labeled B (Fig.6). These seeds were placed on MS PPT-supplemented medium for germination and seedling growth. The results showed that seeds from cross between transplastomic line ( ) and wile-type line ( ) could germinate and sprout green shoots based on its resis-
tance to PPT (Fig.6-A), whileas seeds from cross between transplastomic line ( ) and wile-type line ( ) yielded white shoots and failed to develop into seedlings due to its susceptibility (Fig.6-B), which suggested the resistant gene be transmitted maternally into next generation, excluding the possibility of pollen transmission, and also indicated that the bar gene became integrated into chloroplast genome rather than nuclear genome, and expressed and/or genetically transmitted.
Fig. 5 Herbicide sensitivity assay by smearing leaves of transplastomic rice plants with PPT solution. Left, bar-containing transplastomic rice plants; right, non-transplastomic wild-type rice plants.
Fig. 6 Genetic analysis for resistance to PPT of F1 progeny from reciprocal crosses between transplastomic rice lines and wild-type rice lines. Seeds were placed on PPT-supplemented medium. A, transplastomic line ( ) × wild-type line ( ); B, transplastomic line ( ) × wild-type line ( ).
DISCUSSION
a few plant species. Rice (Oryza sativa L.) is one of the most important plant crops throughout the world, and is also a critical monocotyledonous model plant species. Previous report showed that the bar gene conferring resistance to herbicide PPT is an appropriate selective marker used for the screening the transgenic lines in plant genetic engineering (Wehrmann et al. 1996). In a nuclear genetic engineering, Rathore et al. (1993) introduced bar gene into rice nuclear genome by PEG-mediated transformation of protoplasts. In this work, we developed rice chloroplast transformation system using the bar gene as selective marker and obtained transplastomic lines harboring bar gene. This implies that it will be possible to improve rice agronomic traits by introducing other genes of interest into chloroplast genome. Successful chloroplast transformation depends on
Chloroplast transformation of higher plants is the new research area of plant genetic engineering. It is also an extremely attractive technology for the development of genetically modified plants with transgenic traits, due to its distinct advantages over nuclear genetic engineering, such as high-throughput and compartmentalization of expressed products, site-specific integration, lack of gene silencing and position effects and the containment of the transgene (Daniell et al. 2002). Particularly, in chloroplast engineering, the foreign genes usually inherit in a maternal pattern, which greatly reduce hazards of horizontal gene transfer into related plants, and provide unique characteristics in biological safety. However, successful chloroplast transformation in higher plants reported so far was limited in only
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
65 0
the integration of the foreign DNA into the chloroplast genome through site-specific homologous recombination by double crossing. For most transformation vectors, favorable homologous fragment is 1-2 kb in length, because fragments that are too short would give rise to lower transformation efficiency (Sikdar et al. 1998) or that are too long would make it inconvenient to manipulate in vitro. In Khan and Maliga’s study, transplastomic rice (heteroplastomic) plants were obtained by inserting foreign gene into the region between trnV/rps12/7 within the IR region of rice chloroplast genome (Khan and Maliga 1999). Considering the possible disruption of native gene function by insertion of foreign sequences, we chose the non-coding region between ndhF and trnL within the small single copy region of chloroplast genome as the site for inserting and cloned two fragments about 1.5 kb upstream and/ or downstream non-coding region as homologous fragments. The ta rge t t is s ue for t he r i ce chl or opl a s t transformation, unlike for members of Solanaceae, is non-green callus. The prerequisite of successful transformation is that it should be possible to determine if the expression cassette is active or is inactive in non-green plastid. Silhavy and Maliga (1998) confirmed that eubacterial-type plastid-encoded RNA polymerase, required for transcription of plastid genes in higher plants, was not only active in chloroplast but active in non-green plastid as well. They transformed plastid genome with fluorescent antibiotic marker gene (FLARE-S) and detected fluorescent protein expression both in chromoplasts of petals and in other plastids of roots in transgenic tobacco (Khan and Maliga 1999). Similarly, it was reported in another study that aadA, integrated into tomato chloroplast genome, could efficiently express both in green leaves and immature fruits and in red mature fruits (Ruf et al. 2001). Additionally, green fluorescent protein was also proved to be expressed in potato tubers (Sidorov et al. 1999). It is well known that chloroplasts can present in green immature fruits and convert into chromoplasts in ripening tomato fruits and, therefore, the expression of foreign genes in red mature fruits together with the observation in potato tubers illuminated that a plastid expression cassette is usually capable of directing the expres-
LI Yi-nü et al.
sion of foreign genes in non-green plastids. This is further supported by our observations that transfor med non-gr ee n c a ll i gene ra t ed the gr ee n transplastomic rice plants. In this work, we analyzed the degrees of chloroplast homoplasmy by PCR using chloroplast genomic DNA as templates. Transgenic plants tested here were found to be heterozygous plants in chloroplast genome with transformed and non-transformed chloroplasts existing within the same cell or in the same plant. In addition, different plants presented different degrees in homoplasmy. It is tempting to speculate that this outcome was mirrored by differentiation-dependent development of homoplasmy, namely, longer duration and more times for differentiation on regeneration medium could accelerate the evolution of homoplasmy from heteroplasmy. In the future studies, we will undoubtedly focus on how heteroplasmy is resolved into homoplasmy and the affecting factors that are essential for this process.
CONCLUSION Unlike in the nuclear engineering, foreign genes are generally introduced into chloroplast genome in a manner of s it e -s pec i fi c i nte gra t ion vi a homologous recombination. Based on this mechanism, the foreign bar gene, also used as a selective marker gene in this study, has been introduced into rice chloroplast genome by particle bombardment technology. Molecular assay has validated that we obtained PPT-resistant bartransplastomic rice lines. Additionally, genetic analysis by reciprocal crosses confirmed that the stable inheritance of bar gene in rice chloroplast genome, and its inheritance pattern is consistent with maternal transmission genomic. Therefore, it is believed that the foreign gene expression system has been successfully developed in rice chloroplast genome.
Acknowledgements This study was funded by the 948 Program of the Ministry of Agriculture of China (991020) and by the Natural Science Foundation of the Science and Technology Department of Jiangsu Province, China (BK2001139).
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Establishment of a Gene Expression System in Rice Chloroplast and Obtainment of PPT-Resistant Rice Plants
65 1
References
a selectable marker gene and for the production of herbicide-
Boynton J E, Gillham N W, Harris E H, Hosler J P, Johnson A
resistant rice plants from protoplasts. Plant Molecular
M, Jones A R, Randolph-Anderson B L, Robertson D, Klein
Biology, 21, 871-884.
T M, Shark K B , Sanford J C. 198 8. Chloroplast
Ris H, Plaut W. 1962. Ultrastructure of DNA-containing areas
transformation in Chlamyd omonas with high velocity
in the chloroplast of Chlamydomonas. Journal of Cell Biology, 13, 383-391.
microprojectiles. Science, 240, 1534-1538. Daniell H, Khan M S, Allison L. 2002. Milestones in chloroplast
Ruf S, Hermann M, Berger I J, Carrer H, Bock R. 2001. Stable
genetic engineering: an environmentally friendly era in
genetic transformation of tomato plastids and expression of
biotechnology. Trends in Plant Science, 7, 84-91.
a foreign protein in fruit. Nature Biotechnology, 19, 870-875.
Fromm H, Edelman M, Aviv D, Galun E. 1987. The molecular
Sambrook J, Fritsch E F, Maniatis T. 1989. Molecular Cloning:
basis of rRNA-dependent spectinomycin resistance in
A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory
Nicotiana chloroplast. The EMBO Journal, 11, 3233-3237. Gordon-Kamm W J, Spencer T M, Mangano M L, Adams T R,
Sidorov V A, Kasten D, Pang S Z, Hajdukiewicz P T, Staub J M,
Daines R J, Start W G, O’Brien J V, Chambers S A, Adama
Nehra N S. 1999. Technical advance: stable chloroplast
W R, Willetts N G, Rice T B, Mackey C J, Krueger R W,
transformation in potato: use of green fluorescent protein as
Kausch A P, Lemaux P G. 1990. Transformation of maize
a plastid marker. The Plant Journal, 19, 209-216.
cells and regeneration of fertile transgenic plants. The Plant Cell, 2, 603-618. Hiratsuka J, Shimada H, Whittier R, Ishibashi T, Sakamoto M, Mori M, Kondo C, Honji Y, Sun C R, Meng B Y, Li Y Q,
Press, New York.
Sikdar S R, Serino G, Chaudhuri S, Maliga P. 1998. Plastid transformation in Arabidopsis thaliana. Plant Cell Reports, 18, 20-24. Silhavy D, Maliga P. 1998. Plastid promoter utilization in a rice
Kanno A, Nishizawa Y, Hirai A, Shinozaki K, Sugiura M.
embryogenic cell culture. Current Genetics, 34, 67-70.
1989. The complete sequence of the rice (Oryza sativa)
Su N, Sun M, Li Y N, Ni P C, Shen G F. 2003. Isolation and
chloroplast genome: intermolecular recombination between
modification of rice chloroplast 16S promoter, construction
distinct tRNA genes accounts for a major plastid DNA
of expression vector and transformation. Chinese Bulletin of
inversion during the evolution of the cereals. Molecular and General Genetics, 217, 185-194. Hou B K, Zhou Y H, Wan L H, Zhang Z L, Shen G F, Chen Z H, Hu ZM. 2003. Chloroplast transformation in oilseed rape. Transgenic Research, 12, 111-114.
Botany, 20, 295-301. (in Chinese) Svab Z, Hajdukiewicz P T, Maliga P. 1990. Stable transformation of plastid in higher plants. Proceedings of the National Academy of Sciences of the USA, 87, 8526-8530. Wehrmann A, Vliet A V, Opsomer C, Botterman J, Schulz A.
Khan M S, Maliga P. 1999. Fluorescent antibiotic resistance
1996. The similarities of the bar and pat gene products make
marker for tracking plastid transformation in higher plants.
them equally applicable for plant engineers. Nature
Nature Biotechnology, 17, 910-915.
Biotechnology, 14, 1274-1276.
Lutz K A, Knapp J E, Maliga P. 2001. Expression of bar in the
Zhao Y, Weng X H, Zou Q, Shen G F, Tang S, Chai J H, Wang X
plastid genome confers herbicide resistance. Plant Physiology,
M. 1991. Constructions of cosmid library and detailed
125, 1585-1590.
physical map of rice chloroplast. Acta Genetica Sinica, 8,
Rathore K S, Chowdhury V K, Hodges T K. 1993. Use of bar as
149-160. (in Chinese) (Edited by ZHANG Yi-min)
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.