Estimation of phosphoenolpyruvate carboxylation mediated by phosphoenolpyruvate carboxykinase (PCK) in engineered Escherichia coli having high ATP

Enzyme and Microbial Technology 53 (2013) 13–17

Contents lists available at SciVerse ScienceDirect

Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt

Estimation of phosphoenolpyruvate carboxylation mediated by phosphoenolpyruvate carboxykinase (PCK) in engineered Escherichia coli having high ATP Hyo Jung Lee, Hye-Jung Kim 1 , Jiyoon Seo 2 , Yoon Ah Na, Jiyeon Lee, Joo-Young Lee, Pil Kim ∗ Department of Biotechnology, The Catholic University of Korea, Bucheon, Gyeonggi 420-743, Republic of Korea

a r t i c l e

i n f o

Article history: Received 19 February 2013 Received in revised form 29 March 2013 Accepted 1 April 2013 Keywords: Phosphoenolpyruvate carboxylkinase (PCK) Phosphoenolpyruvate carboxylase (PPC) High intracellular ATP concentration Enzyme kinetics

a b s t r a c t We have previously reported that phosphoenolpyruvate carboxykinase (PCK) overexpression under glycolytic conditions enables Escherichia coli to harbor a high intracellular ATP pool resulting in enhanced recombinant protein synthesis. To estimate how much PCK-mediated phosphoenolpyruvate (PEP) carboxylation is contributed to the ATP increase under engineered conditions, the kinetics of PEP carboxylation by PCK and substrate competing phosphoenolpyruvate carboxylase (PPC) were measured using recombinant enzymes. The PEP carboxylation catalytic efficiency (kcat /Km ) of the recombinant PCK was 660 mM−1 min−1 , whereas that of the recombinant PPC was 1500 mM−1 min−1 . Under the presence of known allosteric effectors (fructose 1,6-bisphosphate, acetyl-CoA, ATP, malate, and aspartate) close to in vivo conditions, the catalytic efficiency of PCK-mediated PEP carboxylation (84 mM−1 min−1 ) was 28-folds lower than that of PPC (2370 mM−1 min−1 ). To verify the above results, an E. coli strain expressing native PCK and PPC under control of identical promoter was constructed by replacing PCK promoter region with that of PPC in chromosome. The native PCK activity (33 nmol/mg-protein min) was 5-folds lower than PPC activity (160 nmol/mg-protein min) in the cell extract from the promoter-exchanged strain. Intracellular modifications of ATP concentration by PCK activity and the consequences for biotechnology are further discussed. © 2013 Elsevier Inc. All rights reserved.

1. Introduction

both PEP carboxylation and OAA decarboxylation (reaction (2)) [3].

Escherichia coli under glycolytic conditions expresses phosphoenolpyruvate carboxylase (PPC, EC 4.1.1.31) that mediates carboxylation of phosphoenolpyruvate (PEP), a C3 glycolysis intermediate containing a high energy bond, into oxaloacetate (OAA), a C4 tricarboxylic acid cycle intermediate, and releases an inorganic phosphate (Pi). PEP carboxykinase (PCK, EC 4.1.1.49) mediating OAA decarboxylation into PEP with consumption of a high energy ATP bond in vivo is expressed under gluconeogenic conditions. The known functions of PCK have focused on OAA decarboxylation under gluconeogenic conditions [1] and the futile cycling of ATP drain for cellular energy balance [2]. Unlike PPC, which only mediates the PEP carboxylation direction (reaction (1)), PCK mediates

PEP + HCO− 3 → OAA + Pi

(1)

PEP + HCO− 3 + ADP ↔ OAA + ATP

(2)

∗ Corresponding author. Tel.: +82 2 2164 4922; fax: +82 2 2164 4865. E-mail address: [email protected] (P. Kim). 1 Present address: R&D, Samyang Genex Co., Daejeon 305-717, Republic of Korea. 2 Present address: ST Pharm Co., Siheung, Gyeonggi 429-912, Republic of Korea. 0141-0229/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.enzmictec.2013.04.001

Indeed, artificial expression of PCK under glycolytic conditions with surplus bicarbonate resulted in a higher intracellular ATP concentration driven from PCK-mediated PEP carboxylation reaction [4], and the E. coli harboring high ATP concentrations was beneficial for recombinant protein synthesis [5]. However, PCKmediated PEP carboxylation competes for the substrate (i.e., PEP) with the reaction of PPC under engineered conditions (PCK artificial expression under glycolysis with a bicarbonate supplement). Unfortunately, the flux in PCK-mediated PEP carboxylation cannot be distinguished from PPC-mediated reaction based on 13 C-labeled flux analysis, because both PCK and PPC possess the same substrates and products. The only difference is ATP formation by PCK and Pi formation by PPC [6]. Although substrate affinities of PCK and PPC have been reported [7,8], it remains unclear to estimate how much extra ATP is formed from the PCK-mediated PEP carboxylation under engineered conditions in vivo. Because the increase in

14

H.J. Lee et al. / Enzyme and Microbial Technology 53 (2013) 13–17

ATP by PCK-mediated PEP carboxylation under glycolytic conditions is beneficial to recombinant protein synthesis, it is necessary to understand PEP carboxylation flux either by PCK or PPC under artificial conditions. In this study, we report the kinetic parameters of recombinant PCK and PPC on the PEP carboxylation reactions in the presence of allosteric effectors. The PEP carboxylation by native PCK and PPC activities derived from identical promoter is also compared under engineered conditions. The increase in ATP by PCK-mediated PEP carboxylation and the consequences of this reaction are discussed in light of biotechnology. 2. Materials and methods 2.1. Recombinant enzyme preparation E. coli ER2566 (New England Biolabs Inc., Hertfordshire, UK) and pET-28a (Novagen, Darmstadt, Germany) were used as the recombinant enzyme expression host and vector, respectively. The genes for ppc (GenBank BAE77355.1) and pckA (GenBank BAE77888) were amplified by polymerase chain reaction (PCR) using oligonucleotides: (for ppc: CATATGAACGAACAATATTCCGCATT [NdeI site underlined], and GAATTCTTAGCCGGTATTACGCATAC [EcoRI site underlined]; for pckA: CATATGCGCGTTAACAATG [NdeI site underlined], and GAATTCTTACAGTTTCGGACCAGC [EcoRI site underlined]) based on E. coli W3110 genomic DNA (KCTC 2223; GenBank AP009048.1). The PCR fragments (2.7 kb for PPC and 1.6 kb for PCK) were subcloned into the T-vector (T&A Cloning Vector, RBC Bioscience Co., Taipei, Taiwan) and sequenced by a DNA sequencing facility (Macrogen Co., Seoul, Korea). The DNA fragments from the T-vectors were further digested with NdeI-EcoRI and ligated into similarly digested pET-28a after purification, resulting in pEPPC and pEPCK, respectively. The constructed plasmids were transformed into E. coli ER2566 by electroporation (BTX ECM, Harvard Apparatus, Holliston, MS, USA). Luria–Bertani medium (1.0% tryptone, 0.5% yeast extract, and 1.0% sodium chloride) containing 50 ␮g/mL kanamycin was used for routine DNA manipulations. A single E. coli colony was inoculated into a 15-mL tube containing 3 mL of medium and maintained at 37 ◦ C with 250 rpm shaking for 12 h to express recombinant phosphoenolpyruvate carboxylase (PPCr ) and recombinant phosphoenolpyruvate carboxykinase (PCKr ). Five hundred microliters of culture was transferred to a 250-mL Erlenmeyer flask containing 50 mL medium and maintained at 37 ◦ C with 250 rpm shaking. When the optical density at 600 nm reached 0.6, isopropyl-␤-dthiogalactopyranoside was added to a final concentration of 0.1 mM to induce PPCr and PCKr . The culture was then incubated at 16 ◦ C for 16 h with shaking at 150 rpm. 2.2. PPCr and PCKr purification Cells were harvested from culture broth via centrifugation (3000 × g, 4 ◦ C) and resuspended in a buffer containing 100 mM Tris·HCl buffer (pH 8.0) and 1 mM phenylmethylsulfonyl fluoride. The suspended cells (50 mL) were disrupted on ice for 20 min using a sonic vibrator (UP200S; Hielscher Ultrasonics GmbH, Teltow, Germany) set at 170 W at 1-s intervals. After removing cell debris by centrifugation (10,000 rpm for 20 min), the supernatant was applied to a Ni+ affinity chromatography column (Novagen). The active fraction was dialyzed against 100 mM Tis·HCl buffer (pH 7.2) at 4 ◦ C for 24 h resulting in the purified enzyme. All purification steps using columns were carried out in a cold chamber (4 ◦ C). Protein concentration was quantified by the Bradford method. Purified proteins were visualized on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with Coomassie Brilliant Blue staining, and the band densities on SDS-PAGE were estimated with the ImageJ program (http://rsbweb.nih.gov/ij). 2.3. PPCr and PCKr kinetic analysis PEP carboxylation kinetic parameters of the purified PCKr and the PPCr were determined in various PEP concentrations. The PCKr reaction mixture contained 50 mM NaHCO3 , 5 mM MgCl2 , and 2 mM ADP in 100 mM HEPES (2-[4-(2hydroxyethyl)piperazin-1-yl]ethanesulfonic acid) buffer (pH 7.0). The PPCr reaction mixture was the same with the exception of ADP. PEP concentrations were varied from 0.04 mM to 5 mM. After adding the purified enzyme, the mixture was maintained at 37 ◦ C for 10 min to allow formation of OAA. OAA formation from the reaction was coupled to the malate dehydrogenase reaction, and oxidation of NADH was measured at 340 nm [9]. Km and kcat values were determined by fitting data to the Michaelis–Menten equation. All biochemical reagents were purchased from Sigma Co. (St. Louis, MO, USA). The PEP carboxylation kinetic parameters in the presence of allosteric effectors were studied as described above methods with additions of the allosteric effectors including fructose 1,6-bisphosphate (15 mM), acetyl-CoA (0.61 mM), ATP (9.6 mM), aspartate (4.2 mM), and malate (1.7 mM). The concentrations of each allosteric effector were decided according to the absolute metabolite concentrations in glucose-fed aerobically growing E. coli [10].

2.4. Construction of strain expressing native PPC and PCK from identical promoter To estimate the native enzyme activities, an E. coli expressing native PPC and PCK from identical promoter were constructed by replacing the promoter region of pckA gene (ppckA ) with the promoter region of ppc gene (pppc ) in chromosome. Three DNA fragments were PCR-amplified from genomic DNA of E. coli: Fragment I (1490 bp) encoding the upstream of ppckA (C-terminal part of yhgE) using ACCAGGACGCATGCGTCTTTTT (SphI site underlined, mutation in bold) and TCTAGAATGGATAACGTTGAAC (XbaI site underlined); Fragment II (512 bp) encoding pppc region using TCTAGAACCTACAGTGACTCAAACGATG (XbaI site underlined) and CTGCAGATTACCCCAGACACCCCATCTT (PstI site underlined); Fragment III (614 bp) encoding the N-terminal part of pckA using CTGCAGATGCGCGTTAACAATGGT (PstI site underlined) and AGCTGCATGCGCTCGGTC (SphI site underlined). The three fragments were sequentially ligated into a cloning vector, pUC19. The recombined DNA fragment (Fragment I + II + III, 2616 bp) in the cloning vector was digested with SphI and further ligated with the same digested pCVD442 vector [11], a suicide vector containing bla and sacB selection marker, resulting pYhgE-pppc -PckA. The plasmid was transformed into E. coli W3110 (KCTC 2223) and colonies showing double crossover were negatively selected. Actively growing W3110 pppc pckA cells in glucose-M9 minimal medium were harvested by centrifugation and dispersed in a 100 mM Tris·HCl buffer (pH 7.2). Cells were disrupted by sonic vibration and cell debris was removed by centrifugation. The resulting cell extract was subjected into the determination of enzyme activities for native PCK and PPC according to previous report [12]. Total PEP carboxylation activities both by PCK and PPC were determined by the formation of OAA. The reaction mixture (200 ␮L) containing 2 mM PEP, 50 mM NaHCO3 , cell extract (20 ␮L) 5 mM MgCl2 , 2 mM ADP, malate dehydrogenase (2.5 U), and 0.14 mM NADH in a 100 mM HEPES buffer (pH 7.0) was incubated at 37 ◦ C for 10 min. The OAA formation was calculated by NADH oxidation. The PCK-mediated PEP carboxylation activity was determined by the formation of ATP. The reaction mixture (200 ␮L) containing 2 mM PEP, 50 mM NaHCO3 , cell extract (20 ␮L) 5 mM MgCl2 , 2 mM ADP, and the ATP assay premix containing luciferase and luciferin in a 100 mM HEPES buffer (pH 7.0). The reaction was initiated by adding 20 ␮L of the cell extract and the mixture was allowed to form ATP for 10 min. ATP formation was measured by a luminometer (20/20n Luminometer System, Turner Biosystem Inc., Sunnyvale, CA, USA) and by ATP standard curve. The PPC-mediated PEP carboxylation by was calculated by subtracting PCK activity from the OAA-forming activity both by PCK and PPC.

3. Results 3.1. Kinetics of PCKr and PPCr without allosteric effectors A 6× His tag was fused to each N-terminal of PCKr and PPCr to determine the kinetic parameters. Purified PCKr and PPCr were obtained at quantities of 4.2 and 8.3 mg, respectively, with >95% purity based on SDS-PAGE band density chromatograms. To determine the enzyme concentrations for the kinetic study, reaction mixtures containing 2 mM PEP were incubated with the purified enzyme at 1–10 ␮g-purified enzyme /mL. The formation of OAA increased linearly at 5 ␮g-purified enzyme /mL concentration among the concentrations tested; thus, we used this enzyme concentration for further studies. When no allosteric effectors were present with surplus bicarbonate (50 mM) at pH 7.0 conditions, the PCKr -mediated PEP carboxylation was at a turnover rate (kcat ) of 40 min−1 with PEP affinity (Km ) of 0.06 mM, whereas the purified PPCr resulted in a turnover rate of 129 min−1 with PEP affinity of 0.09 mM (Table 1). Therefore, catalytic efficiency (kcat /Km ) of PCKr -mediated PEP carboxylation (660 mM−1 min−1 ) was less than half of that of PPCr -mediated PEP carboxylation (1500 mM−1 min−1 ). 3.2. Kinetics of PCKr and PPCr with allosteric effectors Native PCK and PPC have been reported that they are allosterically controlled in vivo depending on the metabolite concentrations. Fructose 1,6-bisphosphate and acetyl-CoA are PPC activators and aspartate, malate, and ATP are inhibitors of both PCK and PPC [7,8]. To investigate the influences of allosteric effectors on the recombinant PCKr or PPCr , the kinetic parameters were determined in the presence of known allosteric effectors (Table 2) and the concentrations of the allosteric effectors were

H.J. Lee et al. / Enzyme and Microbial Technology 53 (2013) 13–17

15

Table 1 Kinetic parameters of recombinant PCK and PPC for PEP carboxylation. Km (mM, PEP)

kcat (min−1 )

kcat /Km (mM−1 min−1 )

Reaction conditions

a

r

PCK b PCKn

0.06 ± 0.01 0.07

40 ± 5 NR

660 NR

50 mM HCO3 − , pH 7.0, 37 ◦ C (This study) 50 mM HCO3 − , pH 8.5, 30 ◦ C

c

PPCr PPCn

0.09 ± 0.01 0.6

129 ± 4 NR

1500 NR

50 mM HCO3 − , pH 7.0, 37 ◦ C (This study) 10 mM HCO3 − , pH 8.5, 25 ◦ C

d

ND, not reported. a Recombinant PCK (6× His at N-terminal). Data from Lineweaver–Burk plot, Supplementary Fig. S1. b Native PCK. Data from reference [8]. c Recombinant PPC (6× His at N-terminal). Data from Lineweaver–Burk plot, Supplementary Fig. S2. d Native PPC. Data from Ref. [7]. Table 2 Kinetic parameters of recombinant PCK and PPC for PEP carboxylation in the presence of allosteric effectors. Allosteric effectors

Km (mM) for PEP

r

PCK

Mixture F-1,6-P Ac-CoA ATP Mal Asp

0.31 ± 0.042 0.08 ± 0.006 0.14 ± 0.013 0.08 ± 0.015 0.14 ± 0.007 0.37 ± 0.148

PPCr

Mixture F-1,6-P Ac-CoA ATP Mal Asp

1.09 0.37 0.57 0.17 2.35 0.16

± ± ± ± ± ±

kcat (min−1 ) 24 ± 4 32 ± 4 58 ± 2 15 ± 3 48 ± 5 61 ± 9

0.16 0.056 0.020 0.038 0.198 0.025

2531 2740 3697 162 784 25

± ± ± ± ± ±

70 345 273 15 20 3

kcat /Km (mM−1 min−1 ) 84 413 403 211 345 193 2370 7460 6500 1062 338 163

PCKr and PPCr , recombinant PCK and recombinant PPC, respectively. F-1,6-P, fructose 1,6-bisphosphate 15 mM; Ac-CoA, acetyl-CoA 0.61 mM; ATP, 9.6 mM; Mal, malate 1.7 mM; Asp, aspartate 4.2 mM; Mixture: sum of F-1,6-P, Ac-CoA, ATP, Mal, and Asp. The concentrations of allosteric effectors were based on the absolute metabolites in glucose-fed exponentially growing E. coli [10]. All parameters were obtained under 50 mM bicarbonate conditions. Data from Lineweaver–Burk plots are in Supplementary Fig. S2.

set to the absolute intracellular concentrations of the metabolites in exponentially growing E. coli with glucose, as presented previously [10]. The presence of 9.6 mM ATP decreased 3-folds the catalytic efficiency of PCKr (kcat /Km = 211 mM−1 min−1 ). Fructose 1,6-bisphosphate (15 mM), acetyl-CoA (0.61 mM), malate (1.7 mM), and aspartate (4.2 mM) also inhibited PCKr , though the degrees were not as significant as ATP. In contrast, PPCr -mediated PEP carboxylation was activated in the presence of 15 mM fructose 1,6-bisphosphate and 0.61 mM acetyl-CoA by 5–6-folds in catalytic efficiency (kcat /Km = 7460 and 6500 mM−1 min−1 , respectively). Presence of ATP, malate, and aspartate inhibited PPCr -mediated PEP carboxylation. In the presence of all known allosteric effectors to achieve close to in vivo-like conditions, the catalytic efficiency of PCKr was 84 mM−1 min−1 and that of PPCr was 2370 mM−1 min−1 . Therefore the PCKr -mediated PEP carboxylation was 28-folds lower than PPCr -mediated reaction under presence of allosteric effectors in near in vivo concentrations. 3.3. Estimation of PEP carboxylation competition by native PPC and PCK To compare the PEP carboxylation activities of native PPC and PCK, the promoter region of pckA was replaced with the ppc promoter in E. coli chromosome, which was designed to express equal molar of native PPC and PCK under glycolytic conditions. (Fig. 1A). Enzyme extract from the actively growing W3110Pppc pckA cells under glucose-minimal medium was obtained to measure the intracellular ATP concentration and the PEP carboxylation activities (Fig. 1B). The intracellular ATP concentration of the promoter exchanged strain was 0.46 ␮mole/g-cell , which was 33% higher than that of wild type (0.35 ␮mole/g-cell ). This result implied PCK activity of W3110Pppc pckA was increased compared with that of wild-type. The PEP carboxylation activity of native PCK was

33 nmol/mg-protein ·min in the promoter exchanged strain, while that of native PPC was 160 nmol/mg-protein ·min. Therefore, native PCK showed 5-folds less PEP carboxylation activity than native PPC under 50 mM bicarbonate conditions when both enzymes were expressed under control of identical promoter. 4. Discussion Wild-type E. coli in the presence of glucose carboxylates PEP into OAA through PPC, not through PCK. This regulation is due to the observation that transcription of the pckA gene is not activated by CRP-cAMP complex or Cra, a dual functional catabolite repressor and activator protein, in the presence of glucose [13,14]. Thus, only a basal level of PCK is present with the full complement of PPC in E. coli under glycolytic conditions [15]. However, Cra represses transcription of ppc and activates transcription of pckA when glucose is absent. Both PCK and PPC could be only present under glycolytic conditions in an E. coli artificially expressing PCK. Although PEP affinity for PCK is higher than that for PPC, PCK mediated a slower turnover rate (kcat ) (Table 1), and the intracellular bicarbonate concentration under normal aerobic conditions is too low for PCK to mediate the carboxylation reaction (∼10 ␮M) [16], considering that the affinity of HCO3 − for PCK is far lower than that for PPC (HCO3 − Km for PCK = 13 mM and HCO3 − Km for PPC = 0.1 mM) [7,8]. Therefore, PEP carboxylation would still be preferably mediated by PPC rather than PCK even if PCK was were present at the same time. The PCK-mediated PEP carboxylation was estimated 2 to 5-folds lower than PPC-mediated reaction (Table 1, Fig. 1B), and the activity proportion could be emphasized depending on the concentrations of allosteric effectors (Table 2). From the view point of metabolic engineering, that extra ATP formation by PCK-mediated PEP carboxylation could be modified by controlling PCK expression level. Because PCK

16

H.J. Lee et al. / Enzyme and Microbial Technology 53 (2013) 13–17

Fig. 1. Chromosome of E. coli strain expressing native PCK and PPC from identical promoter and their enzyme activities in the cell extract. (A) Chromosome of wild-type (upper) and the constructed E. coli exchanged pckA promoter region with ppc promoter region (lower). (B) Native enzyme activities of PPC and PCK in the pckA promoter exchanged strain.

was inhibited by allosteric effectors including ATP (Table 2), protein engineering for a PCK that is de-regulated by ATP would be another way to maximize the benefit from the PCKmediated extra ATP formation. Even though artificial increase of ATP concentration was beneficial for recombinant protein synthesis [5], it also reduced growth rate, that is, E. coli overexpressing PCK grew 22% slower than wild-type, and even the ppc-knockout E. coli overexpressing PCK showed even lower growth rate (>0.05 h−1 ) under glucose-minimal medium conditions [4,17]. Therefore, control of activity ratio of PCK/PPC is needed to minimize the growth inhibition during biotechnological applications using the high ATP harboring E. coli. Pyruvate kinase (pykF and pykA) and the phosphotransferase system (PTS) also require PEP as substrate for glucose catabolism. The known PEP Km for pyruvate kinase is 0.31 mM [18], which is higher than that of PCKr under surplus bicarbonate conditions (Table 1). Therefore, the fluxes by pyruvate kinase and PTS would have been decreased under engineered conditions, and that might be the reason why artificial PCK expression under glycolytic and surplus bicarbonate conditions reduced biomass yield, because of a shortage of precursor metabolites during glucose catabolism [4,5]. It is unknown whether increased intracellular ATP from PCK in engineered E. coli would have similar concentrations of allosteric effectors as in normal exponentially growing cells. Further studies regarding the absolute metabolite concentrations in the engineered strain and the regulatory pathways depending on the intracellular ATP levels would provide a detailed understanding. Notably, the additional ATP formation by PCK under engineered conditions might be a biotechnological benefit besides a previously reported cellular factory for synthesizing foreign proteins [5]. Active transport of substrate influx and product efflux, which requires cellular energy, could be enhanced by biotechnology processes using cells. Therefore, further studies on the applications of the extra ATP formation by PCK under engineered conditions are needed. Acknowledgements This study was financially supported by the Korean Ministry of Science, ICT & Future Planning (Intelligent Synthetic Biology Center of Global Frontier Project 2012M3A6A8054887) and P. Kim

was supported by The Catholic University of Korea through a 2012 research fellowship. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j. enzmictec.2013.04.001. References [1] Matte A, Tari LW, Goldie H, Delbaere LT. Structure and mechanism of phosphoenolpyruvate carboxykinase. Journal of Biological Chemistry 1997;272(13):8105–8. [2] Chao YP, Liao JC. Metabolic responses to substrate futile cycling in Escherichia coli. Journal of Biological Chemistry 1994;269(7):5122–6. [3] Sauer U, Eikmanns BJ. The PEP-pyruvate-oxaloacetate node as the switch point for carbon flux distribution in bacteria. FEMS Microbiology Review 2005;29(4):765–94. [4] Kwon YD, Lee SY, Kim P. A physiology study of Escherichia coli overexpressing phosphoenolpyruvate carboxykinase. Bioscience, Biotechnology, and Biochemistry 2008;72(4):1138–41. [5] Kim HJ, Kwon YD, Lee SY, Kim P. An engineered Escherichia coli having a high intracellular level of ATP and enhanced recombinant protein production. Applied Microbiology and Biotechnology 2012;94(4):1079–86. [6] Petersen S, Mack C, de Graaf AA, Riedel C, Eikmanns BJ, Sahm H. Metabolic consequences of altered phosphoenolpyruvate carboxykinase activity in Corynebacterium glutamicum reveal anaplerotic regulation mechanisms in vivo. Metabolic Engineering 2001;3(4):344–61. [7] Wohl RC, Markus G. Phosphoenolpyruvate carboxylase of Escherichia coli. Purification and some properties. Journal of Biological Chemistry 1972;247(18):5785–92. [8] Krebs A, Bridger WA. The kinetic properties of phosphoenolpyruvate carboxykinase of Escherichia coli. Canadian Journal of Biochemistry 1980;58(4):309–18. [9] Chang HC, Lane MD. The enzymatic carboxylation of phosphoenolpyruvate. II. Purification and properties of liver mitochondrial phosphoenolpyruvate carboxykinase. Journal of Biological Chemistry 1966;241(10):2413–20. [10] Bennett BD, Kimball EH, Gao M, Osterhout R, Van Dien SJ, Rabinowitz JD. Absolute metabolite concentrations and implied enzyme active site occupancy in Escherichia coli. Nature Chemical Biology 2009;5(8):593–9. [11] Philippe N, Alcaraz JP, Coursange E, Geiselmann J, Schneider D. Improvement of pCVD442, a suicide plasmid for gene allele exchange in bacteria. Plasmid 2004;51(3):246–55. [12] Kim P, Laivenieks M, Vieille C, Zeikus JG. Effect of overexpression of Actinobacillus succinogenes phosphoenolpyruvate carboxykinase on succinate production in Escherichia coli. Applied and Environment Microbiology 2004;70(2):1238–41. [13] Gosset G, Zhang Z, Nayyar S, Cuevas WA, Saier Jr MH. Transcriptome analysis of Crp-dependent catabolite control of gene expression in Escherichia coli. Journal of Bacteriology 2004;186(11):3516–24.

H.J. Lee et al. / Enzyme and Microbial Technology 53 (2013) 13–17 [14] Perrenoud A, Sauer U. Impact of global transcriptional regulation by ArcA, ArcB, Cra, Crp, Cya, Fnr, and Mlc on glucose catabolism in Escherichia coli. Journal of Bacteriology 2005;187(9):3171–9. [15] Rahman M, Hasan MR, Oba T, Shimizu K. Effect of rpoS gene knockout on the metabolism of Escherichia coli during exponential growth phase and early stationary phase based on gene expressions, enzyme activities and intracellular metabolite concentrations. Biotechnology and Bioengineering 2006;94(3):585–95. [16] Merlin C, Masters M, McAteer S, Coulson A. Why is carbonic anhydrase essential to Escherichia coli? Journal of Bacteriology 2003;185(21):6415–24.

17

[17] Kim S, Lee CH, Nam SW, Kim P. Alteration of reducing powers in an isogenic phosphoglucose isomerase (pgi)-disrupted Escherichia coli expressing NAD(P)-dependent malic enzymes and NADP-dependent glyceraldehyde 3-phosphate dehydrogenase. Letters in Applied Microbiology 2011;52(5): 433–40. [18] Boiteux A, Markus M, Plesser T, Hess B, Malcovati M. Analysis of progress curves. Interaction of pyruvate kinase from Escherichia coli with fructose 1,6-bisphosphate and calcium ions. Biochemical Journal 1983;211(3): 631–40.