- Email: [email protected]
Estradiol-induced RORα expression positively regulates osteoblast differentiation
Steroids 149 (2019) 108412
Contents lists available at ScienceDirect
Steroids journal homepage: www.elsevier.com/locate/steroids
Estradiol-induced RORα expression positively regulates osteoblast differentiation Hyeon-Young Mina,b, Hyo-Eun Sona,b, Won-Gu Janga,b, a b
T
⁎
Department of Biotechnology, College of Engineering, Daegu University, Gyeongbuk 38453, Republic of Korea Research Institute of Anti-Aging, Daegu University, Gyeongbuk 38453, Republic of Korea
A R T I C LE I N FO
A B S T R A C T
Keywords: RORα Estradiol Osteoblast differentiation BMP2 Runx2
The retinoic acid receptor-related orphan receptor alpha (RORα) is a member of the nuclear hormone receptor superfamily. Several studies show that estradiol is related to RORα expression. However, the link between estradiol and RORα in osteoblast differentiation remains unknown. Here, we showed that estradiol induces RORα expression in C3H10T1/2 and MC3T3-E1 cells. RORα overexpression increased the expression of osteogenic genes including bone morphogenetic protein 2 (BMP2), distal-less homeobox 5, inhibitor of DNA binding, runt-related transcription factor 2 (Runx2), and osteocalcin. In addition, RORα increased phosphorylation of smad1/5/9. Furthermore, RORα knockdown suppressed estradiol-induced BMP2 and Runx2 protein level. Also, we confirmed that estradiol-induced ALP staining and matrix mineralization was attenuated in RORα knockdown. Summarily, these results suggest that estradiol-induced RORα promotes osteoblast differentiation.
1. Introduction The skeleton is a metabolically active organ and is continuously regenerated by osteoclasts and osteoblasts. Osteoblast is differentiated from mesenchymal stem cells (MSCs) which can differentiate into adipocytes, osteoblasts, chondrocytes, and myocytes. Osteoblastic differentiation is regulated by complex signaling pathways [1,2]. Bone morphogenetic proteins (BMPs) are members of the transforming growth factor-β (TGF-β) superfamily, and control diverse cellular pathways, including development, cell proliferation, and differentiation [3–5]. BMP2 promotes bone formation by Smad signaling pathway activation, which induces expression of osteogenic genes such as Runtrelated transcription factor 2 (Runx2), collagen type I, osteocalcin (OC), and osteopontin [6,7]. Retinoic acid receptor-related orphan receptor alpha (RORα) is a member of the nuclear hormone receptor superfamily and is an element of the circadian clock proteins, which regulate diurnal rhythm [8]. RORα is generally expressed in several tissues and acts as a transcription factor [9]. RORα regulates many cellular pathways such as inflammation, and differentiation [10]. Growing evidence show that RORα regulates bone metabolism. It has been reported that RORα regulates osteoblast metabolism in osteosarcoma cells [11].
Homozygous staggerer (RORα sg/sg) mice have thin long bones and display osteopenia [12]. In addition, RORα mediates biological function of melatonin and also regulated by other hormone including estradiol [13–15]. RORα promotes production of estradiol through aromatase activation in breast cancer [16]. In neuroblastoma cells, estradiol induces RORα expression [17]. However, whether estradiol regulates RORα expression in bone metabolism remains unknown. Estradiol, one of three types of naturally occurring estrogen, is the most biologically active type and well-known to mediate bone homeostasis [18,19]. Estradiol suppresses osteoclastogenesis in bone marrow and induces bone formation through estrogen receptors (ERs) in MSCs [20,21]. In this study, we sought to examine whether estradiol regulates RORα expression in osteoblasts. Here, we show that estradiol-induced RORα expression can enhance osteogenic gene expression in MC3T3-E1 cells. 2. Materials and methods 2.1. Reagents Ascorbic acid (AA), β-glycerophosphate, and 17β-estradiol were
Abbreviations: RORα, retinoic acid receptor-related orphan receptor alpha; Id1, inhibitor of DNA binding; Runx2, Runt-related transcription factor 2; OC, osteocalcin; BMPs, bone morphogenetic proteins; TGF-β, transforming growth factor-β; pCMV-RORα, expression vector encoding mouse RORα; α-MEM, α-minimal essential medium; siRNAs, small interfering RNAs ⁎ Corresponding author at: Department of Biotechnology, College of Engineering, Daegu University, Gyeongbuk 38453, Republic of Korea. E-mail address: [email protected] (W.-G. Jang). https://doi.org/10.1016/j.steroids.2019.05.004 Received 13 September 2018; Received in revised form 3 May 2019; Accepted 15 May 2019 Available online 30 May 2019 0039-128X/ © 2019 Elsevier Inc. All rights reserved.
Steroids 149 (2019) 108412
H.-Y. Min, et al.
cotransfected with the pRL-sv40 plasmid expressing Renilla luciferase. Firefly luciferase and Renilla luciferase activities were measured using the Dual-Luciferase reporter assay system (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Luciferase activity was measured using luminometer.
purchased from Sigma-Aldrich Co. (St. Louis, MO, USA). 2.2. Plasmids and small interfering RNA (siRNA) The expression vector encoding mouse RORα (pCMV-RORα) was provided from Korea Human Gene Bank, Medical Genomics Research Center, KRIBB (Daejeon, Korea). For 5′ deletion construction of mouse BMP2 promoter, deletion fragment of BMP2 promoter were fused to firefly luciferase in the pGL3 vector. The siRNA targeting RORα was purchased from Bioneer (Daejeon, Korea).
2.6. Western blot analysis Total cell extracts were lysed using RIPA buffer supplemented with protease inhibitor and phosphatase inhibitor (ATTO Corp., Tokyo, Japan), and centrifuged at 13,000 rpm for 10 min at 4 °C. Total protein was quantified using Bradford protein assay reagent. Equal amount of protein samples were separated by 10% SDS-PAGE and transferred onto PVDF membranes (Roche, Mannheim, Germany). Then, the membranes were blocked with 5% milk in TBS containing Tween 20, followed by incubation with the specific primary antibody. Signals were detected using ECL reagent (Advansta, Menlo Park, CA, USA) according to the manufacturer's protocol. Blot images were acquired with Fusion Solo (Vilber Lourmat, Eberhardzell, Germany). BMP2, ERα, Runx2, Smad1, p-Smad1/5/9, and β-actin antibodies were obtained from Santa Cruz Biotechnology (Dallas, TX, USA) and RORα antibody from Abcam (Cambridge, MA, USA).
2.3. Cell culture Mouse pre-osteoblastic cell line MC3T3-E1 and mouse mesenchymal stem cell line C3H10T1/2 were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). MC3T3-E1 cells were cultured in α-minimal essential medium (α-MEM; Gibco, Grand Island, NY, USA) and C3H10T1/2 cells were cultured in Dulbecco's Modified Eagles Medium (DMEM; Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Atlas, Fort Collins, Colorado, USA), 100 U/ml penicillin, and 100 μg/ml streptomycin (Gibco, Grand Island, NY, USA). Cells were maintained in humidified air containing 5% CO2 at 37 °C.
2.7. ALP staining and alizarin red S staining
2.4. RT-PCR and real-time RT-PCR Total RNA was extracted from cells using TRI-Solution™ (Bio Science Technology, Daegu, Korea) according to the manufacturer’s instructions. For cDNA synthesis, RNA was reverse-transcribed using TOPscript™ RT DryMIX (Enzynomics, Daejeon, Korea) according to the manufacturer’s instructions. To measure mRNA expression, cDNA was amplified on a LightCycler Nano Instrument (Roche, Mannheim, Germany) using AmpiGene™ qPCR Green Mix Hi-ROX (Enzo Life Sciences, Farmingdale, NY, USA). The specific primers used for qPCR are listed in Table 1. The mRNA expressions of target genes were normalized to the expression of the β-actin.
MC3T3-E1 cells were seeded into 24-well plates and cultured for 24 h in α-MEM containing 10% FBS. For ALP staining, the cells cultured with estradiol for 7 days were fixed with 70% ethanol and rinsed three times with deionized water. Fixed cells were treated with BCIP®/NBT solution (Sigma-Aldrich, St. Louis, MO, USA) for 30 min. For alizarin red S staining, the cells cultured with estradiol for 21 days were fixed with 70% ethanol and rinsed three times with deionized water. Fixed cells were treated with 2% alizarin red stain solution (pH 4.2) for 10 min and rinsed with deionized water. Staining was then photographed with an Epson Perfection V37 scanner (Seiko Epson, Suwa, Japan).
2.5. Transient transfection and luciferase assay
2.8. Statistical analysis
MC3T3-E1 cells were seeded into 24-well plates and cultured for 24 h in α-MEM containing 10% FBS. To investigate BMP2 promoter activity, cells were transiently cotransfected with 400 ng of BMP2-Luc reporter plasmids and pCMV-RORα plasmids using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). As an internal control, the cells were
All experiments were repeated at least three times, and statistical analyses were performed using a Student’s t test. p values < 0.05 were considered significant. The results are expressed as the mean ± S.E. of triplicate independent experiments. 3. Results
Table 1 Specific primers for PCR.
3.1. Estradiol induces RORα expression in osteoblasts Sequences (5′ → 3′)
Primer ALP BMP2 CYP19A1 Dlx5 ERα Id1 OC RORα Runx2 β-actin
F R F R F R F R F R F R F R F R F R F R
Previous studies suggest a relationship between estradiol and RORα in breast cancer [16,22]. Another study has shown that RORα is induced by estradiol in neuroblastoma cells [17]. To investigate whether estradiol induces RORα expression in osteoblasts, MC3T3-E1 cells were stimulated by 20 nM or 100 nM estradio1. As shown in Fig. 1A and B, ERα, RORα, BMP2, and Runx2 mRNA expression was induced by estradiol. In addition, estradiol increased ERα and RORα protein levels (Fig. 1C). Similar results were obtained using C3H10T1/2 cells (Supplementary Fig. 1). These results suggest that RORα may be involved in estradiol-induced osteoblast differentiation.
AACCCAGACACAAGCATTCC GAGAGCGAAGGGTCAGTCAG AAGCGTCAAGCCAAACACAAAC GCCACGATCCAGTCATTCCAC ATGTTCTTGGAAATGCTGAACCC AGGACCTGGTATTGAAGACGAG GCCCACCAACCAGCCAGAGA GCGAGGTACTGAGTCTTCTGAAACC CCTCCCGCCTTCTACAGGT CACACGGCACAGTAGCGAG CTTCAGGAGGCAAGAGGAAA CAAACCCTCTACCCACTGGA CTGACCTCACAGATGCCAAG GTAGCGCCGGAGTCTGTTC GCACCTGACCGAAGACGAAA GAGCGATCCGCTGACATCA AGATGACATCCCCATCCATC GTGAGGGATGAAATGCTTGG TTCTACAATGAGCTGCGTGTG GGGGTGTTGAAGGTCTCAAA
3.2. RORα overexpression increases osteogenic marker expression To examine the effects of RORα on osteoblast differentiation, we transduced MC3T3-E1 cells with pCMV-RORα. RORα overexpression increased the expression of osteogenic marker genes including BMP2, Dlx5, Runx2, Id1, OC, and ALP (Fig. 2A). In addition, BMP2 and Runx2 mRNA level were analyzed using conventional RT-PCR (Fig. 2B). 2
Steroids 149 (2019) 108412
H.-Y. Min, et al.
Fig. 1. RORα is upregulated by E2 treatment in osteoblasts. (A and B) MC3T3-E1 cells were cultured with 20 nM or 100 nM 17β-estradiol for 12, 24, and 36 h, respectively. Real-time PCR analyses of (A) ERα and RORα mRNA expression and (B) BMP2 and Runx2 mRNA expression. Relative mRNA expression was normalized to β-actin. (C) MC3T3-E1 cells were cultured with 20 nM 17β-estradiol. Cells were harvested at 0, 24, and 48 h, respectively. ERα and RORα protein levels were determined by western blot analysis. Relative protein level was normalized to β-actin. *p < 0.05; **p < 0.01; ***p < 0.001 compared to the 0 nM group.
examined the effect of RORα knockdown in MC3T3-E1 cells. Estradiolinduced expression of BMP2, Runx2 and ALP were attenuated by their specific siRNAs, although Runx2 mRNA expression was not significantly changed by RORα knockdown (Fig. 4B). In addition, these observations were confirmed in C3H10T1/2 cells (Supplementary Fig. 2A and B). The protein level of BMP2, Runx2, and p-Smad1/5/9 were reduced by knockdown of RORα (Fig. 4C). Moreover, knockdown of RORα attenuated estradiol-induced ALP staining (Fig. 4D). The extracellular matrix mineralization by estradiol was not significantly reduced to about 81% of estradiol-treated group by RORα knockdown (Fig. 4E). These results suggest that estradiol-induced osteoblast differentiation is mediated by RORα.
Western blot analysis showed that RORα induces BMP2 and Runx2 protein level (Fig. 2C). Phosphorylation of smad1/5/9 was increased by RORα overexpression (Fig. 2D). These results indicate that RORα induces osteoblast differentiation. To determine the promoter region for activation of the BMP2 promoter by RORα, BMP2 promoter with 5′ serial deletions were inserted into pGL3-basic luciferase plasmid vector and transiently transfected into MC3T3-E1 pre-osteoblastic cells. Dual-Luciferase reporter assay system showed that full-length BMP2 promoter (-1910/+284) significantly activated by RORα overexpression (Fig. 2E). However, deletion of the region from −1910 to −957 or −406 reduced to about 53% and 45% of full-length promoter upon overexpression of RORα, respectively. These results suggest that the region responsible for the BMP2 promoter activation by RORα is located between −1910 and −957 bp of the 5′ flanking region of BMP2 promoter.
4. Discussion It has been previously demonstrated that RORα increased BSP promoter activity in human MSCs (hMSCs) derived from bone marrow, whereas RORα suppressed vitamin D-induced OC promoter activity [12]. Also, in vivo experiments showed that sg/sg mouse have thin long bone and reduced bone mineral contents. Benderdour and colleagues reported that RORα overexpression increased mRNA expression of late osteoblast differentiation markers including ALP, OC, and collagen type 1 in MG-63 cell line [11]. In the present study, we focused early osteoblast differentiation indicator. We observed that RORα overexpression up-regulated BMP2 mRNA, protein level, and promoter activity in MC3T3-E1 pre-osteoblasts, and these results are consistent with previous study showing that siRORα reduced BMP2 mRNA expression in hMSCs [23]. Our analysis of luciferase assay with 5′ deletion of BMP2 promoter revealed the presence of an element responsible for the activation by RORα within the region from −1910 to −957. The region contain putative RORE element 5′-TGACCT-3′ (-1184/-1179). Moreover, our data indicated that RORα stimulates the phosphorylation of smad1/5/9. RORα is involved in feedback loop regulated by sex hormones in neuronal cells [24]. CYP19A1 encodes aromatase, which
3.3. RORα increases ALP activity and mineralization in osteoblasts To confirm the effects of RORα on osteogenic differentiation, we performed ALP staining in MC3T3-E1 cells. RORα increased ALP activity (Fig. 3A). In addition, RORα significantly increased ALP activity in osteogenic medium compared to the osteogenic medium group without overexpressed RORα. To examine the effects of RORα on mineralized nodule formation in osteoblasts, alizarin red S staining was performed. Overexpressed RORα induced matrix mineralization in MC3T3-E1 cells (Fig. 3B). 3.4. RORα knockdown attenuates osteoblast differentiation To investigate whether downregulation of RORα leads to inhibition of osteoblast differentiation, we performed knockdown of this gene using small interfering RNAs (siRNAs). ERα mRNA was knocked down by siRNAs in MC3T3-E1 cells. Knockdown of ERα reduces estradiolinduced RORα, BMP2, and Runx2 mRNA expression (Fig. 4A). Next, we 3
Steroids 149 (2019) 108412
H.-Y. Min, et al.
Fig. 2. RORα increases the expression of osteogenic markers. (A–E) MC3T3-E1 cells were transiently transfected with pCMV-RORα. (A) Real-time RT-PCR analyses of RORα, BMP2, Id1, Dlx5, Runx2, OC, and ALP mRNA in MC3T3-E1 cells. (B) RT-PCR analyses of BMP2 and Runx2. (C and D) BMP2, Runx2, p-Smad1/5/9, and Smad1 protein level. Relative protein level was normalized to β-actin. (E) The schematic diagrams of BMP2 promoter deletion constructs are shown in the left panel. BMP2luc (−1910/+284) reporter contain putative RORE site 5′-TGACCT-3′. MC3T3-E1 cells were co-transfected with 400 ng of indicated BMP2-luc construct and pCMVRORα. *p < 0.05; **p < 0.01; ***p < 0.001 compared to the control. #p < 0.05 compared to the full-length BMP2 promoter (−1910/+284). Fig. 3. RORα increases ALP activity and osteogenic mineralization. (A and B) MC3T3-E1 cells were transiently transfected with pCMV-RORα and subsequently incubated in the absence or presence of 50 μg/ml ascorbic acid and 5 mM β-glycerophosphate for (A) 7 day or (B) 21 day. (A) ALP staining. (B) Alizarin red S staining. *p < 0.05; **p < 0.01; ***p < 0.001 compared to the control. #p < 0.05.
4
Steroids 149 (2019) 108412
H.-Y. Min, et al.
Fig. 4. Knockdown of RORα attenuates estradiol-induced osteoblast differentiation. (A) MC3T3-E1 cells were transiently transfected with siERα and incubated in the absence or presence of 20 nM 17β-estradiol. ERα, RORα, BMP2, and Runx2 mRNA expression was determined by Real time RT-PCR analyses. (B–E) MC3T3-E1 cells were transiently transfected with siRORα and incubated in the absence or presence of 20 nM 17β-estradiol. (B) Real time RT-PCR analyses of RORα, BMP2, Runx2, and ALP mRNA expression. (C) BMP2, p-Smad1/5/9, Smad1, and Runx2 protein level was determined by western blot analysis. (D) After transfection, MC3T3-E1 cells were cultured with 20 nM 17β-estradiol for 7 day. The cells were stained with BCIP®/NBT solution for ALP staining. (E) Alizarin red S staining. After transfection, MC3T3-E1 cells were cultured with 17β-estradiol for 21 day. *p < 0.05; **p < 0.01; ***p < 0.001 compared to the control. #p < 0.05; ##p < 0.01 compared to the estradiol-treated control.
estradiol. These findings suggest that RORα is a regulator of estradiolinduced osteoblast differentiation through BMP2 signaling pathway including smad1/5/9 phosphorylation in pre-osteoblast MC3T3-E1 cells.
convert testosterone to estradiol. In present study, RORα overexpression increases CYP19A1 mRNA expression in MC3T3-E1 cells (Supplementary Fig. 3). Additional studies are required to determine whether RORα forms positive feedback loop by estradiol in osteoblasts. Estradiol increases BMP2 expression in mouse MSCs obtained from ovariectomized mice and BMP4-induced osteoblastic differentiation [20,25]. Estradiol regulates Period2 (PER2) and RORα expression in uterus and neuroblastoma cells, respectively [17,26]. Estrogen receptor beta is modulated by molecular clock components, such as BMAL1, CLOCK, and PER1 [27]. Here, we determined for the first time that RORα was induced by estradiol in osteoblasts. ERα knockdown suppressed estradiol-induced RORα, BMP2, Runx2 mRNA expression. Furthermore, knockdown of RORα was diminished estradiol-induced BMP2 and ALP expression. Previous study and present observation suggest that RORα is important for bone metabolism [11,12,23]. Besides, RORβ has been reported to function as an important regulator of osteogenesis [28]. Therefore, RORγ, an isoform of RORs, also needs to be investigated in further studies. In summary, the present study determined that RORα induces BMP2 expression in MC3T3-E1 cells and that this effect is controlled by
Declaration of Competing Interest The authors declare that there are no conflicts of interest.
Acknowledgement This research was supported by Daegu University Research Grant 2017.
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.steroids.2019.05.004. 5
Steroids 149 (2019) 108412
H.-Y. Min, et al.
References [16]
[1] A. Yamaguchi, T. Komori, T. Suda, Regulation of osteoblast differentiation mediated by bone morphogenetic proteins, hedgehogs, and Cbfa1, Endocrine Rev. 21 (4) (2000) 393–411. [2] T. Komori, Regulation of osteoblast differentiation by transcription factors, J. Cell. Biochem. 99 (5) (2006) 1233–1239. [3] R.D. Welch, A.L. Jones, R.W. Bucholz, C.M. Reinert, J.S. Tjia, W.A. Pierce, J.M. Wozney, X.J. Li, Effect of recombinant human bone morphogenetic protein-2 on fracture healing in a goat tibial fracture model, J. Bone Mineral Res. 13 (9) (1998) 1483–1490. [4] E. Canalis, A.N. Economides, E. Gazzerro, Bone morphogenetic proteins, their antagonists, and the skeleton, Endocrine Rev. 24 (2) (2003) 218–235. [5] W.G. Jang, E.J. Kim, D.K. Kim, H.M. Ryoo, K.B. Lee, S.H. Kim, H.S. Choi, J.T. Koh, BMP2 protein regulates osteocalcin expression via Runx2-mediated Atf6 gene transcription, J. Biol. Chem. 287 (2) (2012) 905–915. [6] A. Javed, J.S. Bae, F. Afzal, S. Gutierrez, J. Pratap, S.K. Zaidi, Y. Lou, A.J. van Wijnen, J.L. Stein, G.S. Stein, J.B. Lian, Structural coupling of Smad and Runx2 for execution of the BMP2 osteogenic signal, J. Biol. Chem. 283 (13) (2008) 8412–8422. [7] A. Hoffmann, G. Gross, BMP signaling pathways in cartilage and bone formation, Crit. Rev. Eukaryotic Gene Exp. 11 (1–3) (2001) 23–45. [8] D.J. Kojetin, T.P. Burris, REV-ERB and ROR nuclear receptors as drug targets, Nature reviews, Drug Disc. 13 (3) (2014) 197–216. [9] V. Giguere, M. Tini, G. Flock, E. Ong, R.M. Evans, G. Otulakowski, Isoform-specific amino-terminal domains dictate DNA-binding properties of ROR alpha, a novel family of orphan hormone nuclear receptors, Genes Dev. 8 (5) (1994) 538–553. [10] D.N. Cook, H.S. Kang, A.M. Jetten, Retinoic acid-related orphan receptors (RORs): regulatory functions in immunity, development, circadian rhythm, and metabolism, Nucl. Receptor Res. 2 (2015). [11] M. Benderdour, H. Fahmi, F. Beaudet, J.C. Fernandes, Q. Shi, Nuclear receptor retinoid-related orphan receptor alpha1 modulates the metabolic activity of human osteoblasts, J. Cell. Biochem. 112 (8) (2011) 2160–2169. [12] T. Meyer, M. Kneissel, J. Mariani, B. Fournier, In vitro and in vivo evidence for orphan nuclear receptor RORalpha function in bone metabolism, Proc. Natl. Acad. Sci. USA 97 (16) (2000) 9197–9202. [13] L. Naji, A. Carrillo-Vico, J.M. Guerrero, J.R. Calvo, Expression of membrane and nuclear melatonin receptors in mouse peripheral organs, Life Sci. 74 (18) (2004) 2227–2236. [14] C. Tomas-Zapico, J. Antonio Boga, B. Caballero, I. Vega-Naredo, V. Sierra, O. Alvarez-Garcia, D. Tolivia, M. Josefa Rodriguez-Colunga, A. Coto-Montes, Coexpression of MT1 and RORalpha1 melatonin receptors in the Syrian hamster Harderian gland, J. Pineal Res. 39 (1) (2005) 21–26. [15] C. Venegas, J.A. Garcia, C. Doerrier, H. Volt, G. Escames, L.C. Lopez, R.J. Reiter,
[17]
[18] [19] [20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
6
D. Acuna-Castroviejo, Analysis of the daily changes of melatonin receptors in the rat liver, J. Pineal Res. 54 (3) (2013) 313–321. H. Odawara, T. Iwasaki, J. Horiguchi, N. Rokutanda, K. Hirooka, W. Miyazaki, Y. Koibuchi, N. Shimokawa, Y. Iino, I. Takeyoshi, N. Koibuchi, Activation of aromatase expression by retinoic acid receptor-related orphan receptor (ROR) alpha in breast cancer cells: identification of a novel ROR response element, J. Biol. Chem. 284 (26) (2009) 17711–17719. T. Sarachana, V.W. Hu, Differential recruitment of coregulators to the RORA promoter adds another layer of complexity to gene (dys) regulation by sex hormones in autism, Mole. Autism 4 (1) (2013) 39. J.A. Files, M.G. Ko, S. Pruthi, Bioidentical hormone therapy, Mayo Clinic Proc. 86 (7) (2011) 673–680 quiz 680. R. Eastell, Role of oestrogen in the regulation of bone turnover at the menarche, J. Endocrinol. 185 (2) (2005) 223–234. S. Zhou, G. Turgeman, S.E. Harris, D.C. Leitman, B.S. Komm, P.V. Bodine, D. Gazit, Estrogens activate bone morphogenetic protein-2 gene transcription in mouse mesenchymal stem cells, Mole. Endocrinol. 17 (1) (2003) 56–66. P. Taxel, H. Kaneko, S.K. Lee, H.L. Aguila, L.G. Raisz, J.A. Lorenzo, Estradiol rapidly inhibits osteoclastogenesis and RANKL expression in bone marrow cultures in postmenopausal women: a pilot study, Osteoporos. Int. 19 (2) (2008) 193–199. C. Dong, L. Yuan, J. Dai, L. Lai, L. Mao, S. Xiang, B. Rowan, S.M. Hill, Melatonin inhibits mitogenic cross-talk between retinoic acid-related orphan receptor alpha (RORalpha) and ERalpha in MCF-7 human breast cancer cells, Steroids 75 (12) (2010) 944–951. S. Miyamoto, L. Cooper, K. Watanabe, S. Yamamoto, H. Inoue, K. Mishima, I. Saito, Role of retinoic acid-related orphan receptor-alpha in differentiation of human mesenchymal stem cells along with osteoblastic lineage, Pathobiology 77 (1) (2010) 28–37. T. Sarachana, M. Xu, R.C. Wu, V.W. Hu, Sex hormones in autism: androgens and estrogens differentially and reciprocally regulate RORA, a novel candidate gene for autism, PLoS One 6 (2) (2011) e17116. Y. Matsumoto, F. Otsuka, M. Takano-Narazaki, T. Katsuyama, E. Nakamura, N. Tsukamoto, K. Inagaki, K.E. Sada, H. Makino, Estrogen facilitates osteoblast differentiation by upregulating bone morphogenetic protein-4 signaling, Steroids 78 (5) (2013) 513–520. T.J. Nakamura, M.T. Sellix, M. Menaker, G.D. Block, Estrogen directly modulates circadian rhythms of PER2 expression in the uterus, Am. J. Physiol. Endocrinol. Metabolism 295 (5) (2008) E1025–E1031. W. Cai, J. Rambaud, M. Teboul, I. Masse, G. Benoit, J.A. Gustafsson, F. Delaunay, V. Laudet, I. Pongratz, Expression levels of estrogen receptor beta are modulated by components of the molecular clock, Mole. Cell. Biol. 28 (2) (2008) 784–793. M.M. Roforth, G. Liu, S. Khosla, D.G. Monroe, Examination of nuclear receptor expression in osteoblasts reveals Rorbeta as an important regulator of osteogenesis, J. Bone Min. Res. 27 (4) (2012) 891–901.
Contents lists available at ScienceDirect
Steroids journal homepage: www.elsevier.com/locate/steroids
Estradiol-induced RORα expression positively regulates osteoblast differentiation Hyeon-Young Mina,b, Hyo-Eun Sona,b, Won-Gu Janga,b, a b
T
⁎
Department of Biotechnology, College of Engineering, Daegu University, Gyeongbuk 38453, Republic of Korea Research Institute of Anti-Aging, Daegu University, Gyeongbuk 38453, Republic of Korea
A R T I C LE I N FO
A B S T R A C T
Keywords: RORα Estradiol Osteoblast differentiation BMP2 Runx2
The retinoic acid receptor-related orphan receptor alpha (RORα) is a member of the nuclear hormone receptor superfamily. Several studies show that estradiol is related to RORα expression. However, the link between estradiol and RORα in osteoblast differentiation remains unknown. Here, we showed that estradiol induces RORα expression in C3H10T1/2 and MC3T3-E1 cells. RORα overexpression increased the expression of osteogenic genes including bone morphogenetic protein 2 (BMP2), distal-less homeobox 5, inhibitor of DNA binding, runt-related transcription factor 2 (Runx2), and osteocalcin. In addition, RORα increased phosphorylation of smad1/5/9. Furthermore, RORα knockdown suppressed estradiol-induced BMP2 and Runx2 protein level. Also, we confirmed that estradiol-induced ALP staining and matrix mineralization was attenuated in RORα knockdown. Summarily, these results suggest that estradiol-induced RORα promotes osteoblast differentiation.
1. Introduction The skeleton is a metabolically active organ and is continuously regenerated by osteoclasts and osteoblasts. Osteoblast is differentiated from mesenchymal stem cells (MSCs) which can differentiate into adipocytes, osteoblasts, chondrocytes, and myocytes. Osteoblastic differentiation is regulated by complex signaling pathways [1,2]. Bone morphogenetic proteins (BMPs) are members of the transforming growth factor-β (TGF-β) superfamily, and control diverse cellular pathways, including development, cell proliferation, and differentiation [3–5]. BMP2 promotes bone formation by Smad signaling pathway activation, which induces expression of osteogenic genes such as Runtrelated transcription factor 2 (Runx2), collagen type I, osteocalcin (OC), and osteopontin [6,7]. Retinoic acid receptor-related orphan receptor alpha (RORα) is a member of the nuclear hormone receptor superfamily and is an element of the circadian clock proteins, which regulate diurnal rhythm [8]. RORα is generally expressed in several tissues and acts as a transcription factor [9]. RORα regulates many cellular pathways such as inflammation, and differentiation [10]. Growing evidence show that RORα regulates bone metabolism. It has been reported that RORα regulates osteoblast metabolism in osteosarcoma cells [11].
Homozygous staggerer (RORα sg/sg) mice have thin long bones and display osteopenia [12]. In addition, RORα mediates biological function of melatonin and also regulated by other hormone including estradiol [13–15]. RORα promotes production of estradiol through aromatase activation in breast cancer [16]. In neuroblastoma cells, estradiol induces RORα expression [17]. However, whether estradiol regulates RORα expression in bone metabolism remains unknown. Estradiol, one of three types of naturally occurring estrogen, is the most biologically active type and well-known to mediate bone homeostasis [18,19]. Estradiol suppresses osteoclastogenesis in bone marrow and induces bone formation through estrogen receptors (ERs) in MSCs [20,21]. In this study, we sought to examine whether estradiol regulates RORα expression in osteoblasts. Here, we show that estradiol-induced RORα expression can enhance osteogenic gene expression in MC3T3-E1 cells. 2. Materials and methods 2.1. Reagents Ascorbic acid (AA), β-glycerophosphate, and 17β-estradiol were
Abbreviations: RORα, retinoic acid receptor-related orphan receptor alpha; Id1, inhibitor of DNA binding; Runx2, Runt-related transcription factor 2; OC, osteocalcin; BMPs, bone morphogenetic proteins; TGF-β, transforming growth factor-β; pCMV-RORα, expression vector encoding mouse RORα; α-MEM, α-minimal essential medium; siRNAs, small interfering RNAs ⁎ Corresponding author at: Department of Biotechnology, College of Engineering, Daegu University, Gyeongbuk 38453, Republic of Korea. E-mail address: [email protected] (W.-G. Jang). https://doi.org/10.1016/j.steroids.2019.05.004 Received 13 September 2018; Received in revised form 3 May 2019; Accepted 15 May 2019 Available online 30 May 2019 0039-128X/ © 2019 Elsevier Inc. All rights reserved.
Steroids 149 (2019) 108412
H.-Y. Min, et al.
cotransfected with the pRL-sv40 plasmid expressing Renilla luciferase. Firefly luciferase and Renilla luciferase activities were measured using the Dual-Luciferase reporter assay system (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Luciferase activity was measured using luminometer.
purchased from Sigma-Aldrich Co. (St. Louis, MO, USA). 2.2. Plasmids and small interfering RNA (siRNA) The expression vector encoding mouse RORα (pCMV-RORα) was provided from Korea Human Gene Bank, Medical Genomics Research Center, KRIBB (Daejeon, Korea). For 5′ deletion construction of mouse BMP2 promoter, deletion fragment of BMP2 promoter were fused to firefly luciferase in the pGL3 vector. The siRNA targeting RORα was purchased from Bioneer (Daejeon, Korea).
2.6. Western blot analysis Total cell extracts were lysed using RIPA buffer supplemented with protease inhibitor and phosphatase inhibitor (ATTO Corp., Tokyo, Japan), and centrifuged at 13,000 rpm for 10 min at 4 °C. Total protein was quantified using Bradford protein assay reagent. Equal amount of protein samples were separated by 10% SDS-PAGE and transferred onto PVDF membranes (Roche, Mannheim, Germany). Then, the membranes were blocked with 5% milk in TBS containing Tween 20, followed by incubation with the specific primary antibody. Signals were detected using ECL reagent (Advansta, Menlo Park, CA, USA) according to the manufacturer's protocol. Blot images were acquired with Fusion Solo (Vilber Lourmat, Eberhardzell, Germany). BMP2, ERα, Runx2, Smad1, p-Smad1/5/9, and β-actin antibodies were obtained from Santa Cruz Biotechnology (Dallas, TX, USA) and RORα antibody from Abcam (Cambridge, MA, USA).
2.3. Cell culture Mouse pre-osteoblastic cell line MC3T3-E1 and mouse mesenchymal stem cell line C3H10T1/2 were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). MC3T3-E1 cells were cultured in α-minimal essential medium (α-MEM; Gibco, Grand Island, NY, USA) and C3H10T1/2 cells were cultured in Dulbecco's Modified Eagles Medium (DMEM; Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Atlas, Fort Collins, Colorado, USA), 100 U/ml penicillin, and 100 μg/ml streptomycin (Gibco, Grand Island, NY, USA). Cells were maintained in humidified air containing 5% CO2 at 37 °C.
2.7. ALP staining and alizarin red S staining
2.4. RT-PCR and real-time RT-PCR Total RNA was extracted from cells using TRI-Solution™ (Bio Science Technology, Daegu, Korea) according to the manufacturer’s instructions. For cDNA synthesis, RNA was reverse-transcribed using TOPscript™ RT DryMIX (Enzynomics, Daejeon, Korea) according to the manufacturer’s instructions. To measure mRNA expression, cDNA was amplified on a LightCycler Nano Instrument (Roche, Mannheim, Germany) using AmpiGene™ qPCR Green Mix Hi-ROX (Enzo Life Sciences, Farmingdale, NY, USA). The specific primers used for qPCR are listed in Table 1. The mRNA expressions of target genes were normalized to the expression of the β-actin.
MC3T3-E1 cells were seeded into 24-well plates and cultured for 24 h in α-MEM containing 10% FBS. For ALP staining, the cells cultured with estradiol for 7 days were fixed with 70% ethanol and rinsed three times with deionized water. Fixed cells were treated with BCIP®/NBT solution (Sigma-Aldrich, St. Louis, MO, USA) for 30 min. For alizarin red S staining, the cells cultured with estradiol for 21 days were fixed with 70% ethanol and rinsed three times with deionized water. Fixed cells were treated with 2% alizarin red stain solution (pH 4.2) for 10 min and rinsed with deionized water. Staining was then photographed with an Epson Perfection V37 scanner (Seiko Epson, Suwa, Japan).
2.5. Transient transfection and luciferase assay
2.8. Statistical analysis
MC3T3-E1 cells were seeded into 24-well plates and cultured for 24 h in α-MEM containing 10% FBS. To investigate BMP2 promoter activity, cells were transiently cotransfected with 400 ng of BMP2-Luc reporter plasmids and pCMV-RORα plasmids using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). As an internal control, the cells were
All experiments were repeated at least three times, and statistical analyses were performed using a Student’s t test. p values < 0.05 were considered significant. The results are expressed as the mean ± S.E. of triplicate independent experiments. 3. Results
Table 1 Specific primers for PCR.
3.1. Estradiol induces RORα expression in osteoblasts Sequences (5′ → 3′)
Primer ALP BMP2 CYP19A1 Dlx5 ERα Id1 OC RORα Runx2 β-actin
F R F R F R F R F R F R F R F R F R F R
Previous studies suggest a relationship between estradiol and RORα in breast cancer [16,22]. Another study has shown that RORα is induced by estradiol in neuroblastoma cells [17]. To investigate whether estradiol induces RORα expression in osteoblasts, MC3T3-E1 cells were stimulated by 20 nM or 100 nM estradio1. As shown in Fig. 1A and B, ERα, RORα, BMP2, and Runx2 mRNA expression was induced by estradiol. In addition, estradiol increased ERα and RORα protein levels (Fig. 1C). Similar results were obtained using C3H10T1/2 cells (Supplementary Fig. 1). These results suggest that RORα may be involved in estradiol-induced osteoblast differentiation.
AACCCAGACACAAGCATTCC GAGAGCGAAGGGTCAGTCAG AAGCGTCAAGCCAAACACAAAC GCCACGATCCAGTCATTCCAC ATGTTCTTGGAAATGCTGAACCC AGGACCTGGTATTGAAGACGAG GCCCACCAACCAGCCAGAGA GCGAGGTACTGAGTCTTCTGAAACC CCTCCCGCCTTCTACAGGT CACACGGCACAGTAGCGAG CTTCAGGAGGCAAGAGGAAA CAAACCCTCTACCCACTGGA CTGACCTCACAGATGCCAAG GTAGCGCCGGAGTCTGTTC GCACCTGACCGAAGACGAAA GAGCGATCCGCTGACATCA AGATGACATCCCCATCCATC GTGAGGGATGAAATGCTTGG TTCTACAATGAGCTGCGTGTG GGGGTGTTGAAGGTCTCAAA
3.2. RORα overexpression increases osteogenic marker expression To examine the effects of RORα on osteoblast differentiation, we transduced MC3T3-E1 cells with pCMV-RORα. RORα overexpression increased the expression of osteogenic marker genes including BMP2, Dlx5, Runx2, Id1, OC, and ALP (Fig. 2A). In addition, BMP2 and Runx2 mRNA level were analyzed using conventional RT-PCR (Fig. 2B). 2
Steroids 149 (2019) 108412
H.-Y. Min, et al.
Fig. 1. RORα is upregulated by E2 treatment in osteoblasts. (A and B) MC3T3-E1 cells were cultured with 20 nM or 100 nM 17β-estradiol for 12, 24, and 36 h, respectively. Real-time PCR analyses of (A) ERα and RORα mRNA expression and (B) BMP2 and Runx2 mRNA expression. Relative mRNA expression was normalized to β-actin. (C) MC3T3-E1 cells were cultured with 20 nM 17β-estradiol. Cells were harvested at 0, 24, and 48 h, respectively. ERα and RORα protein levels were determined by western blot analysis. Relative protein level was normalized to β-actin. *p < 0.05; **p < 0.01; ***p < 0.001 compared to the 0 nM group.
examined the effect of RORα knockdown in MC3T3-E1 cells. Estradiolinduced expression of BMP2, Runx2 and ALP were attenuated by their specific siRNAs, although Runx2 mRNA expression was not significantly changed by RORα knockdown (Fig. 4B). In addition, these observations were confirmed in C3H10T1/2 cells (Supplementary Fig. 2A and B). The protein level of BMP2, Runx2, and p-Smad1/5/9 were reduced by knockdown of RORα (Fig. 4C). Moreover, knockdown of RORα attenuated estradiol-induced ALP staining (Fig. 4D). The extracellular matrix mineralization by estradiol was not significantly reduced to about 81% of estradiol-treated group by RORα knockdown (Fig. 4E). These results suggest that estradiol-induced osteoblast differentiation is mediated by RORα.
Western blot analysis showed that RORα induces BMP2 and Runx2 protein level (Fig. 2C). Phosphorylation of smad1/5/9 was increased by RORα overexpression (Fig. 2D). These results indicate that RORα induces osteoblast differentiation. To determine the promoter region for activation of the BMP2 promoter by RORα, BMP2 promoter with 5′ serial deletions were inserted into pGL3-basic luciferase plasmid vector and transiently transfected into MC3T3-E1 pre-osteoblastic cells. Dual-Luciferase reporter assay system showed that full-length BMP2 promoter (-1910/+284) significantly activated by RORα overexpression (Fig. 2E). However, deletion of the region from −1910 to −957 or −406 reduced to about 53% and 45% of full-length promoter upon overexpression of RORα, respectively. These results suggest that the region responsible for the BMP2 promoter activation by RORα is located between −1910 and −957 bp of the 5′ flanking region of BMP2 promoter.
4. Discussion It has been previously demonstrated that RORα increased BSP promoter activity in human MSCs (hMSCs) derived from bone marrow, whereas RORα suppressed vitamin D-induced OC promoter activity [12]. Also, in vivo experiments showed that sg/sg mouse have thin long bone and reduced bone mineral contents. Benderdour and colleagues reported that RORα overexpression increased mRNA expression of late osteoblast differentiation markers including ALP, OC, and collagen type 1 in MG-63 cell line [11]. In the present study, we focused early osteoblast differentiation indicator. We observed that RORα overexpression up-regulated BMP2 mRNA, protein level, and promoter activity in MC3T3-E1 pre-osteoblasts, and these results are consistent with previous study showing that siRORα reduced BMP2 mRNA expression in hMSCs [23]. Our analysis of luciferase assay with 5′ deletion of BMP2 promoter revealed the presence of an element responsible for the activation by RORα within the region from −1910 to −957. The region contain putative RORE element 5′-TGACCT-3′ (-1184/-1179). Moreover, our data indicated that RORα stimulates the phosphorylation of smad1/5/9. RORα is involved in feedback loop regulated by sex hormones in neuronal cells [24]. CYP19A1 encodes aromatase, which
3.3. RORα increases ALP activity and mineralization in osteoblasts To confirm the effects of RORα on osteogenic differentiation, we performed ALP staining in MC3T3-E1 cells. RORα increased ALP activity (Fig. 3A). In addition, RORα significantly increased ALP activity in osteogenic medium compared to the osteogenic medium group without overexpressed RORα. To examine the effects of RORα on mineralized nodule formation in osteoblasts, alizarin red S staining was performed. Overexpressed RORα induced matrix mineralization in MC3T3-E1 cells (Fig. 3B). 3.4. RORα knockdown attenuates osteoblast differentiation To investigate whether downregulation of RORα leads to inhibition of osteoblast differentiation, we performed knockdown of this gene using small interfering RNAs (siRNAs). ERα mRNA was knocked down by siRNAs in MC3T3-E1 cells. Knockdown of ERα reduces estradiolinduced RORα, BMP2, and Runx2 mRNA expression (Fig. 4A). Next, we 3
Steroids 149 (2019) 108412
H.-Y. Min, et al.
Fig. 2. RORα increases the expression of osteogenic markers. (A–E) MC3T3-E1 cells were transiently transfected with pCMV-RORα. (A) Real-time RT-PCR analyses of RORα, BMP2, Id1, Dlx5, Runx2, OC, and ALP mRNA in MC3T3-E1 cells. (B) RT-PCR analyses of BMP2 and Runx2. (C and D) BMP2, Runx2, p-Smad1/5/9, and Smad1 protein level. Relative protein level was normalized to β-actin. (E) The schematic diagrams of BMP2 promoter deletion constructs are shown in the left panel. BMP2luc (−1910/+284) reporter contain putative RORE site 5′-TGACCT-3′. MC3T3-E1 cells were co-transfected with 400 ng of indicated BMP2-luc construct and pCMVRORα. *p < 0.05; **p < 0.01; ***p < 0.001 compared to the control. #p < 0.05 compared to the full-length BMP2 promoter (−1910/+284). Fig. 3. RORα increases ALP activity and osteogenic mineralization. (A and B) MC3T3-E1 cells were transiently transfected with pCMV-RORα and subsequently incubated in the absence or presence of 50 μg/ml ascorbic acid and 5 mM β-glycerophosphate for (A) 7 day or (B) 21 day. (A) ALP staining. (B) Alizarin red S staining. *p < 0.05; **p < 0.01; ***p < 0.001 compared to the control. #p < 0.05.
4
Steroids 149 (2019) 108412
H.-Y. Min, et al.
Fig. 4. Knockdown of RORα attenuates estradiol-induced osteoblast differentiation. (A) MC3T3-E1 cells were transiently transfected with siERα and incubated in the absence or presence of 20 nM 17β-estradiol. ERα, RORα, BMP2, and Runx2 mRNA expression was determined by Real time RT-PCR analyses. (B–E) MC3T3-E1 cells were transiently transfected with siRORα and incubated in the absence or presence of 20 nM 17β-estradiol. (B) Real time RT-PCR analyses of RORα, BMP2, Runx2, and ALP mRNA expression. (C) BMP2, p-Smad1/5/9, Smad1, and Runx2 protein level was determined by western blot analysis. (D) After transfection, MC3T3-E1 cells were cultured with 20 nM 17β-estradiol for 7 day. The cells were stained with BCIP®/NBT solution for ALP staining. (E) Alizarin red S staining. After transfection, MC3T3-E1 cells were cultured with 17β-estradiol for 21 day. *p < 0.05; **p < 0.01; ***p < 0.001 compared to the control. #p < 0.05; ##p < 0.01 compared to the estradiol-treated control.
estradiol. These findings suggest that RORα is a regulator of estradiolinduced osteoblast differentiation through BMP2 signaling pathway including smad1/5/9 phosphorylation in pre-osteoblast MC3T3-E1 cells.
convert testosterone to estradiol. In present study, RORα overexpression increases CYP19A1 mRNA expression in MC3T3-E1 cells (Supplementary Fig. 3). Additional studies are required to determine whether RORα forms positive feedback loop by estradiol in osteoblasts. Estradiol increases BMP2 expression in mouse MSCs obtained from ovariectomized mice and BMP4-induced osteoblastic differentiation [20,25]. Estradiol regulates Period2 (PER2) and RORα expression in uterus and neuroblastoma cells, respectively [17,26]. Estrogen receptor beta is modulated by molecular clock components, such as BMAL1, CLOCK, and PER1 [27]. Here, we determined for the first time that RORα was induced by estradiol in osteoblasts. ERα knockdown suppressed estradiol-induced RORα, BMP2, Runx2 mRNA expression. Furthermore, knockdown of RORα was diminished estradiol-induced BMP2 and ALP expression. Previous study and present observation suggest that RORα is important for bone metabolism [11,12,23]. Besides, RORβ has been reported to function as an important regulator of osteogenesis [28]. Therefore, RORγ, an isoform of RORs, also needs to be investigated in further studies. In summary, the present study determined that RORα induces BMP2 expression in MC3T3-E1 cells and that this effect is controlled by
Declaration of Competing Interest The authors declare that there are no conflicts of interest.
Acknowledgement This research was supported by Daegu University Research Grant 2017.
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.steroids.2019.05.004. 5
Steroids 149 (2019) 108412
H.-Y. Min, et al.
References [16]
[1] A. Yamaguchi, T. Komori, T. Suda, Regulation of osteoblast differentiation mediated by bone morphogenetic proteins, hedgehogs, and Cbfa1, Endocrine Rev. 21 (4) (2000) 393–411. [2] T. Komori, Regulation of osteoblast differentiation by transcription factors, J. Cell. Biochem. 99 (5) (2006) 1233–1239. [3] R.D. Welch, A.L. Jones, R.W. Bucholz, C.M. Reinert, J.S. Tjia, W.A. Pierce, J.M. Wozney, X.J. Li, Effect of recombinant human bone morphogenetic protein-2 on fracture healing in a goat tibial fracture model, J. Bone Mineral Res. 13 (9) (1998) 1483–1490. [4] E. Canalis, A.N. Economides, E. Gazzerro, Bone morphogenetic proteins, their antagonists, and the skeleton, Endocrine Rev. 24 (2) (2003) 218–235. [5] W.G. Jang, E.J. Kim, D.K. Kim, H.M. Ryoo, K.B. Lee, S.H. Kim, H.S. Choi, J.T. Koh, BMP2 protein regulates osteocalcin expression via Runx2-mediated Atf6 gene transcription, J. Biol. Chem. 287 (2) (2012) 905–915. [6] A. Javed, J.S. Bae, F. Afzal, S. Gutierrez, J. Pratap, S.K. Zaidi, Y. Lou, A.J. van Wijnen, J.L. Stein, G.S. Stein, J.B. Lian, Structural coupling of Smad and Runx2 for execution of the BMP2 osteogenic signal, J. Biol. Chem. 283 (13) (2008) 8412–8422. [7] A. Hoffmann, G. Gross, BMP signaling pathways in cartilage and bone formation, Crit. Rev. Eukaryotic Gene Exp. 11 (1–3) (2001) 23–45. [8] D.J. Kojetin, T.P. Burris, REV-ERB and ROR nuclear receptors as drug targets, Nature reviews, Drug Disc. 13 (3) (2014) 197–216. [9] V. Giguere, M. Tini, G. Flock, E. Ong, R.M. Evans, G. Otulakowski, Isoform-specific amino-terminal domains dictate DNA-binding properties of ROR alpha, a novel family of orphan hormone nuclear receptors, Genes Dev. 8 (5) (1994) 538–553. [10] D.N. Cook, H.S. Kang, A.M. Jetten, Retinoic acid-related orphan receptors (RORs): regulatory functions in immunity, development, circadian rhythm, and metabolism, Nucl. Receptor Res. 2 (2015). [11] M. Benderdour, H. Fahmi, F. Beaudet, J.C. Fernandes, Q. Shi, Nuclear receptor retinoid-related orphan receptor alpha1 modulates the metabolic activity of human osteoblasts, J. Cell. Biochem. 112 (8) (2011) 2160–2169. [12] T. Meyer, M. Kneissel, J. Mariani, B. Fournier, In vitro and in vivo evidence for orphan nuclear receptor RORalpha function in bone metabolism, Proc. Natl. Acad. Sci. USA 97 (16) (2000) 9197–9202. [13] L. Naji, A. Carrillo-Vico, J.M. Guerrero, J.R. Calvo, Expression of membrane and nuclear melatonin receptors in mouse peripheral organs, Life Sci. 74 (18) (2004) 2227–2236. [14] C. Tomas-Zapico, J. Antonio Boga, B. Caballero, I. Vega-Naredo, V. Sierra, O. Alvarez-Garcia, D. Tolivia, M. Josefa Rodriguez-Colunga, A. Coto-Montes, Coexpression of MT1 and RORalpha1 melatonin receptors in the Syrian hamster Harderian gland, J. Pineal Res. 39 (1) (2005) 21–26. [15] C. Venegas, J.A. Garcia, C. Doerrier, H. Volt, G. Escames, L.C. Lopez, R.J. Reiter,
[17]
[18] [19] [20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
6
D. Acuna-Castroviejo, Analysis of the daily changes of melatonin receptors in the rat liver, J. Pineal Res. 54 (3) (2013) 313–321. H. Odawara, T. Iwasaki, J. Horiguchi, N. Rokutanda, K. Hirooka, W. Miyazaki, Y. Koibuchi, N. Shimokawa, Y. Iino, I. Takeyoshi, N. Koibuchi, Activation of aromatase expression by retinoic acid receptor-related orphan receptor (ROR) alpha in breast cancer cells: identification of a novel ROR response element, J. Biol. Chem. 284 (26) (2009) 17711–17719. T. Sarachana, V.W. Hu, Differential recruitment of coregulators to the RORA promoter adds another layer of complexity to gene (dys) regulation by sex hormones in autism, Mole. Autism 4 (1) (2013) 39. J.A. Files, M.G. Ko, S. Pruthi, Bioidentical hormone therapy, Mayo Clinic Proc. 86 (7) (2011) 673–680 quiz 680. R. Eastell, Role of oestrogen in the regulation of bone turnover at the menarche, J. Endocrinol. 185 (2) (2005) 223–234. S. Zhou, G. Turgeman, S.E. Harris, D.C. Leitman, B.S. Komm, P.V. Bodine, D. Gazit, Estrogens activate bone morphogenetic protein-2 gene transcription in mouse mesenchymal stem cells, Mole. Endocrinol. 17 (1) (2003) 56–66. P. Taxel, H. Kaneko, S.K. Lee, H.L. Aguila, L.G. Raisz, J.A. Lorenzo, Estradiol rapidly inhibits osteoclastogenesis and RANKL expression in bone marrow cultures in postmenopausal women: a pilot study, Osteoporos. Int. 19 (2) (2008) 193–199. C. Dong, L. Yuan, J. Dai, L. Lai, L. Mao, S. Xiang, B. Rowan, S.M. Hill, Melatonin inhibits mitogenic cross-talk between retinoic acid-related orphan receptor alpha (RORalpha) and ERalpha in MCF-7 human breast cancer cells, Steroids 75 (12) (2010) 944–951. S. Miyamoto, L. Cooper, K. Watanabe, S. Yamamoto, H. Inoue, K. Mishima, I. Saito, Role of retinoic acid-related orphan receptor-alpha in differentiation of human mesenchymal stem cells along with osteoblastic lineage, Pathobiology 77 (1) (2010) 28–37. T. Sarachana, M. Xu, R.C. Wu, V.W. Hu, Sex hormones in autism: androgens and estrogens differentially and reciprocally regulate RORA, a novel candidate gene for autism, PLoS One 6 (2) (2011) e17116. Y. Matsumoto, F. Otsuka, M. Takano-Narazaki, T. Katsuyama, E. Nakamura, N. Tsukamoto, K. Inagaki, K.E. Sada, H. Makino, Estrogen facilitates osteoblast differentiation by upregulating bone morphogenetic protein-4 signaling, Steroids 78 (5) (2013) 513–520. T.J. Nakamura, M.T. Sellix, M. Menaker, G.D. Block, Estrogen directly modulates circadian rhythms of PER2 expression in the uterus, Am. J. Physiol. Endocrinol. Metabolism 295 (5) (2008) E1025–E1031. W. Cai, J. Rambaud, M. Teboul, I. Masse, G. Benoit, J.A. Gustafsson, F. Delaunay, V. Laudet, I. Pongratz, Expression levels of estrogen receptor beta are modulated by components of the molecular clock, Mole. Cell. Biol. 28 (2) (2008) 784–793. M.M. Roforth, G. Liu, S. Khosla, D.G. Monroe, Examination of nuclear receptor expression in osteoblasts reveals Rorbeta as an important regulator of osteogenesis, J. Bone Min. Res. 27 (4) (2012) 891–901.