Ethanol-induced expression of cytokines in a first-trimester trophoblast cell line

Ethanol-induced expression of cytokines in a first-trimester trophoblast cell line David M. Svinarich, PhD, John A. DiCerbo, BA, Fadi M. Zaher, MS, Frank D. Yelian, MD, PhD, and Bernard Gonik, MD Detroit, Michigan OBJECTIVES: Altered cytokine expression at the fetoplacental interface may be a potential mechanism for the development of fetal immune dysfunction in children with fetal alcohol syndrome. This study was conducted to determine whether first-trimester trophoblasts respond to ethanol exposure by the induction of specific cytokines. STUDY DESIGN: HTR-8/SVneo trophoblast cells were cultured in vitro in the presence of either ethanol (0.5% [vol/vol]), lipopolysaccharide (1 µg/mL), or ethanol and lipopolysaccharide. Expression of granulocyte colony–stimulating factor, regulated on activation normal T cell expressed and secreted, and interleukin-6 was examined by Northern analysis and enzyme-linked immunosorbent assay. RESULTS: Culture in the presence of ethanol, lipopolysaccharide, or lipopolysaccharide and ethanol resulted in the increased transcription and secretion of granulocyte colony–stimulating factor, regulated on activation normal T cell expressed and secreted, and interleukin-6 at significantly greater levels (P < .01) than control cultures. CONCLUSIONS: Human first-trimester trophoblasts express high levels of cytokines when cultured in the presence of ethanol. Trophoblasts may therefore be an important exogenous source of cytokines for the fetus, and altered cytokine levels during early gestation may have an adverse effect on the development of the fetal immune system. (Am J Obstet Gynecol 1998;179:470-5.)

Key words: Fetal alcohol syndrome, cytokines, trophoblasts, immune development

Fetal alcohol syndrome refers to a pattern of morphologic, developmental, neurologic, and behavioral abnormalities occurring in children born to alcoholic women.1, 2 The incidence of fetal alcohol syndrome is reported to be approximately 2 cases per 1000 live births in Western society.3 Fetal alcohol syndrome is strongly associated with a marked increase in the incidence of serious infectious diseases such as pneumonia, meningitis, gastroenteritis, and recurrent minor infections of the middle ear, upper respiratory tract, urinary tract, and soft tissues.4 The immunologic consequences of prenatal ethanol exposure are manifested in both the humoral and cellular components of the immune system, and these effects may persist well into adulthood.4-8 These abnormalities include reduced absolute lymphocyte counts, diminished lymphocyte response to specific mitogens, thymic involution, and decreased levels of particular antibody classes (hypogammaglobulinemia).4 At present, the pathoimmunologic

From the Department of Obstetrics and Gynecology, Wayne State University School of Medicine. Received for publication October 13, 1997; revised January 8, 1998; accepted January 15, 1998. Reprint requests: David M. Svinarich, PhD, Wayne State University School of Medicine, Department of Obstetrics and Gynecology, C.S. Mott Center, 275 E Hancock Ave, Detroit, MI 48201. Copyright © 1998 by Mosby, Inc. 0002-9378/98 $5.00 + 0 6/1/89120

470

mechanism(s) that underlie fetal immune dysfunction remain an enigma. However, altered expression of cytokines at the fetoplacental interface has been postulated as a potential mechanism for fetal immune dysfunction.9 Cytokines are polypeptide hormones that, among other functions, play an essential role in the development and maturation of the fetal immune system.10-15 The differentiation and proliferation of immature lymphocytes are largely directed by cytokines expressed by stromal cells lining the fetal thymus and liver. Furthermore, regulation of stromally expressed cytokines may also be controlled by cytokines operating in an autocrine or paracrine fashion.13 Placental trophoblasts are a recognized source of cytokines during pregnancy.16-18 Trophoblasts, by virtue of their anatomic location, may express cytokines that are unaffected by the placental barrier.19 These cytokines could therefore be introduced directly into the fetal circulation where they may adversely affect development of the fetal immune system. This study examines the transcriptional and translational expression of granulocyte colony–stimulating factor, regulated on activation normal T cell expressed and secreted (RANTES), and interleukin-6 in human trophoblasts cultured in the presence of alcohol. Granulocyte colony–stimulating factor and interleukin-6 are stromally expressed cytokines that direct the differentiation, maturation, and proliferation of fetal lymphocytes.20, 21

Volume 179, Number 2 Am J Obstet Gynecol

RANTES is a cytokine that belongs to a family of secreted, low-molecular mass (8 to 14 kDa) peptides, termed chemokines. RANTES is a potent chemoattractant for basophils, eosinophils, monocytes, and memory, helper, and effector T cells. Chemokines also have immunoregulatory capabilities such as control of the proliferative potential of hematopoietic progenitor cells.22 This study addresses the hypothesis that alcohol affects fetal immune development through the altered expression of immunoregulatory cytokines in human trophoblasts. Material and methods HTR-8/SVneo cells were derived from human firsttrimester extravillous trophoblasts and were immortalized by transfection with pSV3neo. HTR-8/SVneo cells possess a normal trophoblast structure, are positive for cytokeratin, and express human chorionic gonadotrophin and type IV collagenase.23 Cells between 18 and 23 passages were grown to confluency in Dulbecco’s modified Eagle’s medium–Ham’s F-12 media (Hyclone, Logan, Utah), supplemented with 10% nonheat inactivated fetal bovine serum, 1% L-glutamine, 50 U/mL penicillin, and 5 µg/mL streptomycin (Sigma Chemical Co, St Louis). Cells were maintained in culture at 37°C in an atmosphere of 5% carbon dioxide in 75-cm2 flasks (Corning Inc, Corning, NY). All culture media were tested for the presence of contaminating endotoxin before the addition of lipopolysaccharide or ethanol by a limulus assay with a sensitivity of 0.06 to 0.10 ng/mL (Endotect, ICN Biomedicals, Inc, Aurora, Ohio). Confluent HTR-8/SVneo cell monolayers were washed 3 times in 4 mL of Dulbecco’s modified Eagle’s medium– Ham’s F-12 media before culturing under experimental conditions. Cells were cultured in either Dulbecco’s modified Eagle’s medium–Ham’s F-12 media alone or media containing 0.5% (vol/vol) (0.4% [wt/vol], 87.7 mmol/L) ethanol, lipopolysaccharide (1 µg/mL), or ethanol and lipopolysaccharide. The concentration of ethanol used in this study represents a high but physiologically achievable level of ethanol and has not been shown to have significant cytotoxic effects on HTR-8/SVneo cells (unpublished observations). Ethanol (95%) was obtained from AAPER Alcohol and Chemical Co, Shelbyville, Ky. Lipopolysaccharide (Escherichia coli serotype 055.B5 lipopolysaccharide Sigma Chemical Co, St Louis) was solubilized in Dulbecco’s modified Eagle’s medium–Ham’s F-12 media to a stock concentration of 1 mg/mL. Lipopolysaccharide was included in these studies to serve as a known inducer of cytokines and to examine the influence of an infection stimulus on potentiating the ethanol-induced expression of cytokines in trophoblasts. Cells were cultured under experimental and control conditions for either 0, 2, 4, 6, 8, or 24 hours. Cultures were maintained under 4 mL of sterile tissue culture grade mineral oil (M8410) to preclude evaporation of ethanol (Sigma

Svinarich et al 471

Chemical Co, St Louis). Culture supernatants used to conduct enzyme-linked immunosorbent assays were obtained from single flasks to minimize variation from cell number. An 800-µL aliquot of culture supernatant was withdrawn at each of the previously described time intervals and centrifuged at 14,000g for 5 minutes to remove cellular debris. Supernatants were subsequently stored at –70°C, until needed. All experiments involving cell culture were conducted in duplicate. Total ribonucleic acid (RNA) was isolated from cultured trophoblast cells using the TRIzol Reagent (Gibco BRL Products, Grand Island, NY) in accordance with the manufacturer’s instructions. A 15-µg aliquot of total RNA from each time point was resolved on a 1% agaroseformaldehyde gel, and residual formaldehyde was removed by two 20-minute washes in 250 mL of diethyl pyrocarbonate–treated water. RNA was electrophoretically transferred onto Magna nylon transfer membranes (Micron Separations, Inc, Westboro, Mass) at a constant 50 V/250 mA for 16 hours in 1 × 0.04 mol/L Tris acetate, 0.001 mol/L ethylenediaminetetraacetic acid, pH 8.0 buffer with a Trans-Blot apparatus (Bio-Rad Laboratories, Richmond, Calif). RNA was covalently attached to the transfer membrane by exposure to ultraviolet radiation. Membranes were prehybridized at 65°C for 1 hour in 50 mmol/L Tris-hydroxymethylamino methane buffer (pH 7.5), containing 1.0 mol/L sodium chloride, 10% dextran sulfate, 1% sodium dodecyl sulfate, and 100 µg/mL denatured salmon testes deoxyribonucleic acid. Synthetic oligomeric antisense granulocyte colony–stimulating factor (5´GATCTTCCTCACTTGCTCTAAGCACTTGA3´0, R A N T E S ( 5 ´ T G C C A C T G G T G TA G A A ATA C T C CTTGATGT3´), interleukin-6 (5´TGTCAATTCGTTCTGAAGAGGTGAGTGGCTGTCTGTGTGG3´), and β-actin probes (5´GACGACGAGCGCGGCGATATCATCATC3´) (Integrated DNA Technologies, Inc, Coralville, Ia) were end-labeled with γ32P-deoxycytidine 5´-triphosphate (ICN Pharmaceuticals, Costa Mesa, Calif) and purified through a Sephadex G-25 column (5 Prime 3 Prime, Inc, Boulder, Colo). Hybridization was conducted under stringent conditions for 16 hours in the original solution containing 5 × 106 cpm/mL of radiolabeled probe. Northern blots were washed for 30 minutes at stringent temperatures in 2× SSC (3 mol/L sodium chloride, 0.3 mol/L sodium citrate, pH 7.0) and 0.1% sodium dodecyl sulfate and then for 5 minutes in fresh solution at room temperature. Autoradiography was performed for 1 to 10 days at –70°C with Fuji Medical X-Ray Film (Fuji Medical Systems, Stamford, Conn) and Kodak intensifying screens (Eastman Kodak Co, Rochester, NY). Autoradiographs were processed on a Kodak X-OMAT M43A automated processor. Cytokine signal intensities were compared against β-actin signal intensities obtained from the same membrane to control for equal RNA loading. Granulocyte colony–stimulating factor, RANTES, and

472 Svinarich et al

August 1998 Am J Obstet Gynecol

Fig 1. Transcriptional expression of cytokines in ethanol and ethanol-lipopolysaccharide–induced HTR-8/SVneo cells. Total RNA was isolated from cells after 0, 2, 4, 6, 8, and 24 hours of culture in medium containing ethanol alone (0.5% [vol/vol], 0.4% [wt/vol], 87.7 mmol/L) or ethanol and lipopolysaccharide (1 µg/mL) and subjected to hybridization with either granulocyte colony–stimulating factor (A), RANTES (B), or interleukin-6 (C) radiolabeled antisense oligomeric probes. Relative positions of the 18S and 28S ribosomal subunits are indicated on left. Approximate transcript sizes for each cytokine are indicated on right. Hybridization to β-actin is shown in lower panel of each corresponding autoradiograph.

Svinarich et al 473

Volume 179, Number 2 Am J Obstet Gynecol

interleukin-6 protein levels were measured with commercial enzyme-linked immunosorbent assay tests in accordance with the manufacturers’ instructions and validated for use with culture supernatant (R&D Systems, Minneapolis). All standards and supernatants from experimental and control cultures were assayed in duplicate and the values averaged. Absorbance values with a coefficient of variation greater than 12% were not used. Statistical significance was determined with the repeated measures analysis of variance. Results Hybridization of HTR-8/SVneo trophoblast total RNA with a human antisense granulocyte colony–stimulating factor probe demonstrated a single messenger RNA species of approximately 1.5 kb. Essentially no constitutive transcription was detected at 0 hours in culture under experimental conditions. Minimal levels of transcription were observed between 2 and 6 hours of culture in media containing either ethanol or ethanol and lipopolysaccharide. Under both experimental conditions, a substantial increase in the quantity of message was detected by 8 hours in culture and increased to 24 hours in culture, when the experiment was terminated. A severalfold increase in message level was detected by 24 hours in culture from cells cultured in the presence of ethanol and lipopolysaccharide over those cultured with either ethanol or lipopolysaccharide alone (Fig 1, A). Northern analysis with an antisense RANTES probe yielded a single hybridizing species of approximately 1.16 kb. Essentially no constitutive transcription was detected at 0 hours in culture. Only minimal levels of transcription were observed between 2 and 8 hours of culture in the presence of ethanol, lipopolysaccharide, or both. Maximum levels of RANTES message were detected at 24 hours in culture under experimental conditions. Message levels were severalfold greater from cells cultured in the presence of ethanol and lipopolysaccharide over those grown in media containing either ethanol or lipopolysaccharide alone (Fig 1, B). Northern analysis with an antisense interleukin-6 probe yielded a single hybridizing species of approximately 1.13 kb. High levels of constitutive transcription were observed at 0 hours in culture. Maximum transcription for cells cultured in the presence of either ethanol alone or ethanol and lipopolysaccharide occurred by 24 hours, when the experiment was terminated. Message levels were again severalfold greater from cells cultured in the presence of both ethanol and lipopolysaccharide over those cells cultured in the presence of ethanol alone (Fig 1, C). Production of granulocyte colony–stimulating factor immunoreactive protein was detected after approximately 2 hours in culture under both experimental and control conditions. By 24 hours in culture, trophoblasts cultured

in the presence of ethanol alone, lipopolysaccharide alone, or ethanol and lipopolysaccharide produced granulocyte colony–stimulating factor at levels 20-fold, 10-fold, and 45-fold greater than control cultures, respectively. The addition of lipopolysaccharide to cultures containing ethanol increased the level of production by 2.25-fold over cultures containing ethanol alone (Fig 2, A). RANTES was undetected in either control or experimental cultures at 0 hours in culture. Cultures containing either ethanol or ethanol and lipopolysaccharide produced detectable levels of RANTES by 2 hours in culture. Cultures containing lipopolysaccharide alone did not produce detectable levels of RANTES until approximately 6 hours in culture. Control cultures failed to express detectable levels of RANTES until approximately 24 hours in culture. By 24 hours in culture, RANTES expression in cultures containing ethanol alone, lipopolysaccharide alone, or ethanol and lipopolysaccharide were 53-fold, 8.5-fold, and 60-fold greater than control cultures, respectively. The addition of lipopolysaccharide to experimental cultures containing ethanol resulted in less than a onefold increase in RANTES production over cells cultured in the presence of ethanol alone by 24 hours (Fig 2, B). Immunoreactive interleukin-6 protein was detectable by 0 hours in cultures containing either ethanol, lipopolysaccharide, or ethanol and lipopolysaccharide. Cells cultured in media alone did not produce detectable interleukin-6 levels until approximately 2 hours in culture. By 24 hours, trophoblasts cultured in the presence of ethanol, lipopolysaccharide, or ethanol and lipopolysaccharide secreted interleukin-6 at levels twofold, 1.8-fold, and threefold greater than control cultures, respectively (Fig 2, C). In all instances, trophoblasts cultured in the presence of either ethanol, lipopolysaccharide, or ethanol and lipopolysaccharide produced levels of granulocyte colony–stimulating factor, RANTES, and interleukin-6 that were significantly greater (P < .01) than control cultures by 24 hours. Lipopolysaccharide and ethanol in culture consistently induced the greatest cytokine production followed by culture in media containing ethanol alone and lipopolysaccharide alone, respectively. These results were similarly found to be statistically significant (P < .01) by 24 hours in culture for each cytokine tested. Comment Children with fetal alcohol syndrome demonstrate a marked increase in the incidence of serious infections and recurrent minor infections.4 Despite overwhelming evidence confirming the relationship between prenatal ethanol exposure and fetal immune impairment, the mechanism(s) underlying these effects remains unclear. However, altered cytokine expression at the fetoplacental interface after maternal ethanol consumption may be a mechanism through which fetal immune development

474 Svinarich et al

August 1998 Am J Obstet Gynecol

Fig 2. Enzyme-linked immunosorbent assay analysis of cytokine production in HTR-8/SVneo cells. Cell culture supernatants were analyzed for either granulocyte colony–stimulating factor (A), RANTES (B), or interleukin-6 (C) secretion after 0, 2, 4, 6, 8, and 24 hours of culture in medium alone or medium containing either ethanol (0.5% [vol/vol], 0.4% [wt/vol], 87.7 mmol/L) or ethanol and lipopolysaccharide (1 µg/mL). Expressed levels of granulocyte colony–stimulating factor, RANTES, and interleukin-6 under ethanol or ethanollipopolysaccharide induction were significantly greater than cytokine levels expressed in the absence of inducing agents (P < .01).

Volume 179, Number 2 Am J Obstet Gynecol

could be altered.9, 24, 25 A role for cytokines in mediating the effects of ethanol appears likely given the essential function they play in directing ontogeny, differentiation, and maturation of fetal immune cells.10 The data presented in this study demonstrate that human first-trimester trophoblasts respond to ethanol exposure by the induction and secretion of immunoregulatory cytokines. Furthermore, the presence of lipopolysaccharide in cultures containing ethanol potentiated the ethanol-induced transcription and secretion of granulocyte colony–stimulating factor, RANTES, and interleukin-6. This suggests that ethanol induction of these cytokines in human trophoblasts may be exacerbated by the presence of an infection stimulus in vivo. The gestational period examined in this study correlates with a critical time point in early fetal immune development: the ontogeny of hematopoietic stem cells and differentiation of fetal T and B cells. Altered fetal immune development could potentially occur directly after exposure of undifferentiated stem cells or lymphocytes to either abnormal cytokine concentrations or an altered repertoire of cytokines. Disruption of immune development might also arise indirectly after exposure of fetal stromal cells to the abnormal cytokine milieu. Stromal cells, which are themselves regulated by specific cytokines, direct the differentiation of fetal lymphocytes, in part, through the temporal expression of various cytokines. The cytokines interleukin-6 and granulocyte colony–stimulating factor, for instance, which were highly expressed by first-trimester trophoblast cell line HTR-8/SVneo after in vitro exposure to ethanol, are both expressed by fetal stromal cells. It is also conceivable that tissues of fetal origin may respond similarly to ethanol exposure and therefore contribute to the observed phenotype. Exposure of developing fetal immune cells and stromal cells to an altered cytokine milieu could therefore disrupt immune development. These alterations may ultimately be responsible for the reduced lymphocyte counts, diminished mitogenic responses, hypogammaglobulinemia, abnormal T cell differentiation, and thymic involution observed in patients with fetal alcohol syndrome. We thank Dr Charles H. Graham, PhD, for his kind gift of the HTR-8/SVneo cell line, Ms Ornella M. Bitonti for her technical expertise, and Mr Michael Kruger for performing statistical analysis. REFERENCES

1. Jones KL, Smith DW. Recognition of the fetal alcohol syndrome in early infancy. Lancet 1973;2:999-1001. 2. Hanson JW, Jones KL, Smith DW. Fetal alcohol syndrome: experience with 41 patients. JAMA 1976;235:1458-60. 3. Abel EL. An update on incidence of FAS: FAS is not an equal opportunity birth defect. Neurotoxicology 1995;17:437-43. 4. Johnson S, Knight R, Mariner DJ, Steele RW. Immune deficiency in fetal alcohol syndrome. Pediatr Res 1981;15:908-11. 5. Weald SJ, Frost WW. Effect of prenatal exposure to ethanol on the development of the thymus. Thymus 1987;9:211-5. 6. Jerrels TR, Peritt D, Marietta C, Eckardt MJ. Mechanisms of sup-

Svinarich et al 475

pression of cellular immunity induced by alcohol. Alcohol Clin Exp Res 1989;13:490-3. 7. Grossman A, Astley SJ, Liggitt HD, Clarren SK, Shiota F, Kennedy B, et al. Immune function in offspring of nonhuman primates (Macaca nemestrina) exposed weekly to 1.8g/kg ethanol during pregnancy: preliminary observations. Alcohol Clin Exp Res 1993;17:822-7. 8. Wolcott RM, Jennings SR, Cheryenak R. In utero exposure to ethanol affects postnatal development of T- and B-lymphocytes, but not natural killer cells. Alcohol Clin Exp Res 1995;19:170-6. 9. Chiappelli F, Taylor AN. The fetal alcohol syndrome and fetal alcohol effects on immune competence. Alcohol Alcohol 1995;30:259-63. 10. Suda T, Murray R, Guidos C, Zlotnik A. Growth-promoting activity of IL-1α, IL-6, and tumor necrosis factor-α in combination with IL-2, IL-4, or IL-7 on murine thymocytes: differential effects on CD4/CD8 subsets and on CD3+/CD3- double- negative thymocytes. J Immunol 1990;144:3039-45. 11. Suda T, Zlotnik A. In vitro induction of CD8 expression on thymic pre-T cells. I. Transforming growth factor-β and tumor necrosis factor-α induce CD8 expression on CD8- thymic subsets including the CD25+CD3–CD4–CD8– pre-T cell subset. J Immunol 1992;146:1737-45. 12. Punnonen J, de Vries JE. IL-13 induces proliferation, Ig isotype switching, and Ig synthesis by immature human fetal B cells. J Immunol 1994;152:1094-1102. 13. Gutierrez-Ramos JC, Olsson C, Palacios R. Interleukin (IL1 to IL7) gene expression in fetal liver and bone marrow stromal cell clones: cytokine-mediated positive and negative regulation. Exp Hematol 1992;20:986-90. 14. Godfrey DI, Kennedy J, Gately MK, Hakimi J, Hubbard BR, Zlotnik A. IL-12 influences intrathymic T cell development. J Immunol 1994;152:2729-35. 15. Suda T, Zlotnik A. IL-7 maintains the T cell precursor potential of CD3–CD4–CD8– thymocytes. J Immunol 1991;146(9):3068-73. 16. Gonik B, Rachmilewitz J, Hochberg A, Goshen R, deGroot N. Induction of tumor necrosis factor and interleukin-6 mRNA in human cytotrophoblast cells exposed to lipopolysaccharide. Infect Dis Obstet Gynecol 1994;2:3-9. 17. Svinarich DM, Bitonti OM, Romero R, Gonik B. Induction and post-translational expression of cytokines in a first-trimester trophoblast cell line by lipopolysaccharide. Am J Obstet Gynecol 1996;175:970-3. 18. Svinarich DM, Bitonti OM, Araneda H, Romero R, Gonik B. Induction and postranslational expression of G-CSF and RANTES in a first trimester trophoblast cell line by lipopolysaccharide. Am J Reprod Immunol 1996;36:256-9. 19. Medlock ES, Kaplan DL, Cecchine M, Ulich TR, Castello J, Andresen J. Granulocyte colony–stimulating factor crosses the placenta and stimulates fetal rat granulopoiesis. Blood 1993;81:916-22. 20. Gutierrez-Ramos JC, Olsson C, Palacios R. Interleukin (IL1 to IL7) gene expression in fetal liver and bone marrow stromal clones: cytokine-mediated positive and negative regulation. Exp Hematol 1992;20:986-90. 21. Moore NC, Anderson G, Smith CA, Owen JJT, Jenkinson EJ. Analysis of cytokine gene expression in subpopulations of freshly isolated thymocytes and thymic stromal cells using semiquantitative polymerase chain reaction. Eur J Immunol 1993;23:922-7. 22. Miller MD, Krangel MS. Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines. Crit Rev Immunol 1992;12:17-46. 23. Graham CH, Hawley TS, Hawley RG, MacDougall JR, Kerbel RS, Khoo N et al. Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp Cell Res 1993;206:204-11. 24. Dudley DJ, Trautman MS, Mitchell MD. Inflammatory mediators regulate interleukin-8 production by cultured gestational tissues: evidence for a cytokine network at the chorio-decidual interface. J Clin Endocrinol Metab 1993;76:404-10. 25. Wegman TG, Guilbert LJ. Immune signaling at the maternalfetal interface and trophoblast differentiation. Dev Comp Immunol 1992;16:425-30.