Eugenol for dairy cows fed low or high concentrate diets: Effects on digestion, ruminal fermentation characteristics, rumen microbial populations and milk fatty acid profile

Animal Feed Science and Technology 178 (2012) 139–150

Contents lists available at SciVerse ScienceDirect

Animal Feed Science and Technology journal homepage: www.elsevier.com/locate/anifeedsci

Eugenol for dairy cows fed low or high concentrate diets: Effects on digestion, ruminal fermentation characteristics, rumen microbial populations and milk fatty acid profile C. Benchaar a,∗ , A. Lettat a , F. Hassanat a , W.Z. Yang b , R.J. Forster b , H.V. Petit a , P.Y. Chouinard c a b c

Agriculture and Agri-Food Canada, Dairy and Swine Research and Development Centre, Sherbrooke, Quebec J1M 0C8, Canada Agriculture and Agri-Food Canada, Research Centre, Lethbridge, Alberta T1J 4B1, Canada Université Laval, Département des Sciences Animales, Québec, Québec G1V 0A6, Canada

a r t i c l e

i n f o

Article history: Received 13 July 2012 Received in revised form 11 October 2012 Accepted 14 October 2012

Keywords: Essential oil Eugenol Forage:concentrate ratio Dairy cow

a b s t r a c t Four ruminally cannulated primiparous lactating cows were used in a 4 × 4 Latin square design experiment (28 d periods) with a 2 × 2 factorial arrangement of treatments to examine effects of eugenol supplementation, concentrate proportion of the diet and their interaction on digestion, ruminal fermentation, microbial populations, milk production and milk composition, including milk fatty acid (FA) profile. Cows were fed for ad libitum intake a low (LC) or high (HC) concentrate total mixed ration (TMR) without or with eugenol (50 mg/kg of dry matter (DM) intake. The forage:concentrate ratio was (DM basis) 650:350 and 350:650 for LC and HC, respectively. Adding eugenol to the diets had no effects on DM intake, digestion, ruminal fermentation, rumen microbial populations of bacteria and protozoa and milk performance. Increasing the concentrate proportion of the diet resulted in changes typical of cows fed high starch diets (i.e., lower ruminal pH and acetate:propionate ratio; shift in bacterial populations; lower milk fat and higher milk protein concentrations). The ratio t-11 18:1 to t-10 18:1 was not affected by dietary treatments, indicating no changes in the pathway of biohydrogenation of FA in the rumen. Despite the alteration of rumen function due to increasing the proportion of the concentrate of the diet, adding eugenol to these high or low concentrate diets did not modify digestion, ruminal fermentation and microbial populations, suggesting that the effect (i.e., antimicrobial) of eugenol is neither pH nor diet dependant. The lack of efficacy of eugenol at the dosage rate evaluated under the experimental conditions of this study suggests that this essential oil may have low potential for use as feed additive in dairy cow nutrition. Crown Copyright © 2012 Published by Elsevier B.V. All rights reserved.

1. Introduction In recent years, use of plant bioactive compounds such as essential oils in animal nutrition has been of increasing interest. The resurgence of interest in using essential oils in ruminant nutrition and production has increased, particularly in Europe,

Abbreviations: ADF, acid detergent fiber; BCVFA, branched-chain VFA; BW, body weight; CP, crude protein; DM, dry matter; EUG, eugenol; FA, fatty acid; HC, high concentrate diet; LC, low concentrate diet; MUN, milk urea nitrogen; aNDF, neutral detergent fiber with residual ash; OM, organic matter; PCR, polymerase chain reaction; TMR, total mixed ration; VFA, volatile fatty acid. ∗ Corresponding author at: Agriculture and Agri-Food Canada, Dairy and Swine Research and Development Centre, 2000 College Street, Sherbrooke, Quebec, J1M 0C8, Canada. Tel.: +1 819 780 7117; fax: +1 819 564 5507. E-mail address: [email protected] (C. Benchaar). 0377-8401/$ – see front matter Crown Copyright © 2012 Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.anifeedsci.2012.10.005

140

C. Benchaar et al. / Animal Feed Science and Technology 178 (2012) 139–150

after the EU ban on use of growth promoting antibiotics, including ionophores, in livestock production in January 2006 (OJEU, 2003). Accordingly, several research studies have been conducted to evaluate the potential of essential oils to manipulate rumen microbial fermentation and increase feed efficiency in ruminants (Benchaar et al., 2009). Among the essential oils, eugenol has attracted much attention because of its potential antimicrobial activity against rumen microbes (Benchaar and Greathead, 2011). Eugenol (4-allyl-2-methoxyphenol) is a phenolic monoterpene present in high quantities in clove bud (Syzygium aromaticum) and cinnamon leaf (Cinnamomum cassia) essential oils, accounting for 850–900 g/kg (Màthé, 2009) and 800 g/kg (Fraser et al., 2007) of these essential oils, respectively. This compound has been shown to have antimicrobial activity against Gram positive and Gram negative bacteria (Walsh et al., 2003). A number of in vitro studies have been conducted to determine effects of eugenol on rumen microbial fermentation (Benchaar et al., 2007a, 2008). Reported results were variable depending on the in vitro technique and dose used (Busquet et al., 2006; Castillejos et al., 2006; Fraser et al., 2007). In vitro supplementation of eugenol resulted in a decrease in ammonia N, branched-chain volatile fatty acid (BCVFA) and total VFA concentrations (Busquet et al., 2006; Castillejos et al., 2006), an indication of inhibition of amino acid deamination in the rumen and feed digestion. It has been suggested that effects of eugenol on rumen microbial fermentation is diet and pH dependant (Cardozo et al., 2005; Calsamiglia et al., 2007). For instance, at pH 5.5, supplementation with eugenol in 24 h batch fermentation increased total VFA concentration (i.e., improved energy utilization) and decreased BCVFA concentration (i.e., improved N utilization) while no effects occurred at pH 7.0 (Cardozo et al., 2005). However, information from animal studies with eugenol is limited (Benchaar et al., 2009) and to the best of our knowledge, no studies have been conducted to assess the effectiveness of eugenol in manipulating rumen microbial fermentation in lactating cows. Based on these considerations, this study was undertaken to examine effects of eugenol supplementation to a low or a high concentrate diet on feed intake, digestion, ruminal fermentation, microbial populations, milk production and milk FA profile of lactating cows. 2. Materials and methods 2.1. Cows, experimental design, and treatments Four lactating primiparous Holstein cows fitted with ruminal cannulas (10 cm, Bar Diamond Inc., Parma, ID, USA) were used in a 4 × 4 Latin square design experiment (28 d periods) balanced for residual effects (Cochran and Cox, 1957) with a 2 × 2 factorial arrangement of treatments. The cows averaged 67 ± 3.2 days in milk at the start of the experiment with an average body weight (BW) of 568 ± 27.3 kg. They were housed in individual tie stalls and had free access to water during the experiment. Cows were fed for ad libitum intake low (LC) or high (HC) concentrate total mixed rations (TMR) without or with eugenol (EUG) supplementation. The forage:concentrate ratio was (DM basis) 650:350 and 350:650 for the LC and HC diet, respectively. Composition (ingredients and chemical) of the experimental diets are in Table 1. Eugenol (C10 H12 O2 , purity > 0.99, Phodé S.A., Albi, France) was premixed with ground corn (i.e., the carrier) and supplemented at the concentration of 50 mg/kg of DM. Adaptation to experimental treatments was from d 1 to 18, in sacco ruminal degradation measurements on d 19, ruminal sampling on d 20, milk yield and sampling, total fecal and urine collection from d 21 to 28. Cows were cared for in accordance with the guidelines of the Canadian Council on Animal Care (CCAC, 1993). 2.2. Feed intake, apparent total-tract digestibility, and nitrogen balance Diets were offered in equal amounts twice daily at 08:30 and 16:00 h. Feed consumption was recorded daily by weighing feeds offered to and refused by the cows. Samples of TMR, feed ingredients, and orts were collected daily and frozen. Samples were composited by cow within period, freeze-dried, ground to pass a 1 mm screen using a Wiley mill (standard model 4; Arthur M. Thomas, Philadelphia, PA, USA) and analyzed for DM, organic matter (OM), total N, neutral detergent fiber (aNDF), acid detergent fiber (ADF), starch, ether extract, gross energy, and FA composition. On d 21 of each experimental period, cows were fitted with harnesses and tubes allowing collection of feces and urine separately. For 7 consecutive days, feces were weighed and mixed daily, and a representative sample (20 g/kg) was collected, stored at −20 ◦ C and, subsequently, thawed, freeze dried, and ground to pass a 1 mm screen using a Wiley mill for later chemical analyses. Total urine was collected daily into stainless containers and acidified with sulfuric acid to maintain pH < 2.0. A representative sample (20 g/kg) was collected and kept frozen at −20 ◦ C until analysis. 2.3. In sacco ruminal degradation The extent of ruminal degradation of soybean meal, grass hay and corn grain was determined using a nylon bag procedure. Feeds were freeze dried (for silage), ground to pass a 2 mm screen using a Wiley mill, and 5 g samples (DM) were weighed in duplicate into polyester bags (17 × 9 cm; 53 ␮m pore size) made of monofilament PeCAP Polyester (Sefar Nitex® , Sefar AG, Heiden, Switzerland). Bags were placed in large mesh (20 × 30 cm) retaining sacs with 3 × 5 mm pores that allowed ruminal fluid to circulate freely. Bags were soaked in 37 ◦ C water for 5 min before being placed in triplicate in the ventral sac of the rumen of each cow for 16 h. Upon removal from the rumen, bags were immediately immersed in ice water to impede

C. Benchaar et al. / Animal Feed Science and Technology 178 (2012) 139–150

141

Table 1 Ingredient and chemical composition of the basal diets. Total mixed ration Low concentrate (LC)

High concentrate (HC)

Ingredient (g/kg DM) Corn, silage Legume/grass, silage Corn, dry rolled Soybean, meal Barley, grain Beet pulp, dehydrated Top supplementa Megalac® b Corn gluten meal Wheat bran Mineral/Vitamin premixc Calcium carbonate Sodium chloride

327 322 40 94 83 48 – 27 39 – 17 – 2

171 169 196 90 83 60 61 – – 142 17 9 2

Chemical composition Organic matter (g/kg DM) Crude protein (g/kg DM) aNeutral detergent fiber (g/kg DM)d Acid detergent fiber (g/kg DM) Starch (g/kg DM) Gross energy (MJ/kg DM)

922 173 347 226 119 18.5

92.6 171 331 177 187 18.5

Fatty acid (g/kg DM)e 14:0 16:0 c9 16:1 18:0 c9 18:1 c11 18:1 c9, c12 18:2 c9, c12, c15 18:3 20:0 Total FA

0.35 16.18 0.11 1.43 10.85 0.61 11.31 4.41 0.31 45.55

0.06 5.87 0.07 0.65 6.19 0.49 15.05 2.99 0.20 31.58

a Contained (g/kg): 208 corn gluten meal, 283 soybean meal Trituro® (Soya Excel Inc., Beloeil, QC, Canada), 167 canola meal, 342 corn, distillers grains with solubles. b Calcium salts of palm oil (Church and Dwight Co., Inc., Princeton, NJ, USA). c Contained: Ca, 125 g/kg; P, 6.8 g/kg; S, 6.8 g/kg; Na, 7.7 g/kg; K, 2 g/kg; I, 96 mg/kg; Fe, 2877 mg/kg; Cu, 620 mg/kg; Mn, 2520 mg/kg; 3777 mg/kg; Zn, Co, 83 mg/kg; vitamin A, 628000 IU/kg; vitamin D, 81000 IU/kg; vitamin E, 3739 IU/kg; and SE, 27.8 mg/kg. d aNeutral detergent fiber with residual ash. e c, cis; t, trans.

microbial activity, then thoroughly rinsed with cold tap water and frozen at –20 ◦ C. Bags were later thawed, washed in a domestic washing machine and freeze dried. Bags and contents were weighed, and dried residues were ground through a 1 mm screen (1093 Cyclotec® Sample Mill, Höganäs, Sweden) and stored for subsequent analyses.

2.4. Ruminal fermentation characteristics Ruminal content (∼ 1 L) was collected from multiple sites within the rumen at 0, 1, 2, 4, 6 and 8 h after the morning feeding. Samples were withdrawn using a syringe screwed to a stainless tube ending with a probe covered by a fine metal mesh (RT Rumen Fluid Collection Tube, Bar Diamond Inc., Parma, ID, USA). The pH was measured immediately after collection (Accumet® pH meter; Fisher Scientific, Montreal, QC, Canada) and two 10 ml samples were acidified by the addition of 0.2 ml of sulfuric acid (500 ml/l) and frozen at −20 ◦ C for later determination of VFA and ammonia N concentrations.

2.5. Protozoa enumeration Protozoa counts were completed out on rumen fluid collected 0, 2 and 4 h after the 08:00 h feeding. Ruminal fluid was strained through two layers of cheesecloth and a 3 ml portion of the strained ruminal fluid was preserved using 3 ml of methyl green formalin-saline solution (Ogimoto and Imai, 1981). Preserved samples were stored at 20–22 ◦ C in darkness until counting. Protozoa were microscopically enumerated using a counting chamber (Neubauer Improved Bright-Line counting cell, 0.1 mm depth; Hausser Scientific, Horshamm, PA, USA).

142

C. Benchaar et al. / Animal Feed Science and Technology 178 (2012) 139–150

Table 2 Genus and species specific primers used in the quantitative PCR assays for 16S rRNA genes of the examined ruminal bacteria. Target Taxon or Strain

Primer sequence 5 to 3

Tm a

Reference

Ruminococcus Genus

F:AGTGAAGTAGAGGTAAGCGGAATTC R:GCCGTACTCCCCAGGTGG F:CAATAAGCATTCCGCCTGGG R:TTCACTCAATGTCAAGCCCTGG F:GCGGGTAGCAAACAGGATTAGA R:CCCCCGGACACCCAGTAT F:GGTTCTGAGAGGAAGGTCCCC R:TCCTGCACGCTACTTGGCTG

60

Weimer et al. (2008)

61

Stevenson and Weimer (2007) Li et al. (2009) Stevenson and Weimer (2007) Li et al. (2009) Stevenson and Weimer (2007)

Selenomonas ruminantium D Fibrobacter succinogenes S85 Bacteriodes-Prevotella a

59 61

Primer melting temperature.

2.6. Quantification of bacterial 16S rRNA Sampling (before and 4 h after the 8:00 h feeding) of cows for liquid and solid associated rumen bacteria was completed as previously described (Kong et al., 2010). Briefly, 100 ml samples of rumen content were separated into liquids and solids using a bodum filter (Bodum Inc., Triengen, Switzerland). After rinsing in a phosphate buffer, solid associated bacteria were dislodged from rumen particles using a methyl-cellulose elution buffer. The sample for the planktonic fraction (1 ml) and the particulate biofilm (5 ml) were centrifuged at 10,000 × g for 10 min at +4 ◦ C in a desktop centrifuge (Eppendof 5415D, Eppendorf, Mississauga, ON, Canada) or at 5000 × g at +4 ◦ C for 10 min in a DuPont RC5 super speed centrifuge (Sorvall, Newtown, CT, USA), respectively, to collect microorganisms. After decanting the supernatant, 1.4 ml ASL stool lysis buffer (QIAamp DNA stool kit, QIAGEN, Mississauga, ON, Canada) was added to each pellet and the pellet was resuspended. Suspended samples were transferred into 2 ml screw cap eppendorf tubes and stored at −80 ◦ C until DNA was extracted. Extraction of DNA was as described by Kong et al. (2010) using a repeated bead beating method that includes incubation steps with lysozyme and mutanolysin. Species-specific PCR primers were used in real-time quantitative PCR (qPCR) to amplify partial 16S rRNA regions. The bacterial species targeted were F. succinogenes, Prevotella spp., Ruminococcus spp., and S. ruminantium. Standard curves were constructed using cloned 16S rRNA sequences with 100% matches to the target sequence as described by Ohene-Adjei et al. (2007). The reaction was in a final volume of 25 ␮l, containing the following: SYBR Green PCR mastermix (ABI, Warrington, UK), 150 nM of each primer, and 1 ␮g/ml of template DNA. All qPCR reactions were performed in an ABI 7900HT Fast Real-Time PCR System (AB Applied Biosystems, Life Technologies Corp. Carlsbad, CA, USA). QPCR conditions for detection were: −10 min at 95 ◦ C for initial denaturation/polymerase activation, 10 s 95 ◦ C denaturation, 30 s at the specific annealing temperature specified for the primers in Table 2, and the cycles were repeated 35 times. To confirm production of a single product of the expected molecular weight high resolution melt profiles were examined and amplification products were visualized on agarose gel (2 g/100 ml). 2.7. Milk production and milk composition Cows were milked twice daily in their stalls at 07:00 and 19:00 h and milk yield was recorded at each milking. During the last week of each 28 d period, milk samples were collected from each cow at each milking, stored at +4 ◦ C with a preservative (2-bromo-2-nitropropan- 1,3-diol) and then sent to a commercial laboratory (Valacta Laboratories, Ste-Anne-de-Bellevue, QC, Canada) for analyses of fat, true protein, lactose, urea N and somatic cell counts. Milk FA composition was determined on samples pooled (4 consecutive milkings) on a milk yield basis and frozen without preservative at −80 ◦ C until analysis. 2.8. Chemical analyses Analytical DM was determined by drying the oven-dried samples at 135 ◦ C for 2 h, followed by hot weighing (AOAC, 1990; # 930.15). Ash was determined by incineration at 550 ◦ C overnight in a muffle furnace (AOAC, 1990; # 942.05) and the OM content was calculated as the difference between 100 and the proportion of ash (AOAC, 1990; # 942.05). For determination of CP (N × 6.25), samples were ground using a ball mill (Mixer Mill MM2000, Retsch, Haan, Germany) to a fine powder and total N was quantified by thermal conductivity (Leco model FP-428 Nitrogen Determinator, Leco, St. Joseph, MI, USA). The concentration of NDF was determined as described by Van Soest et al. (1991) without use of sodium sulfite but with inclusion of a heat stable ␣-amylase. The ADF content was determined according to AOAC (# 973.18; 1990). The NDF and ADF procedures were adapted for use in an Ankom200 Fiber Analyzer (Ankom Technology Corp., Macedon, NY) and fiber contents (i.e., NDF and ADF) were expressed including residual ash (aNDF and ADF). Starch was determined colorimetrically according to the procedure of Hall (2000). Ether extract was determined using a Soxtec system HT6 apparatus (Tecator, Fisher Scientific, Montreal, QC, Canada) according to # 920.39 of AOAC (1990). Gross energy was determined using an adiabatic calorimeter (model 1241, Parr, Moline, IL, USA). The concentration of N in acidified urine samples was determined by micro-Kjeldahl analysis (AOAC, 1990; # 960.52).

C. Benchaar et al. / Animal Feed Science and Technology 178 (2012) 139–150

143

Ruminal ammonia was determined using the method of Weatherburn (1967), modified for use with a microplate spectrophotometer (MRX Microplate Reader, Dynatech Laboratories, Chantilly, VA, USA). Ruminal VFA were quantified using a gas chromatograph (model 5890, Hewlett-Packard Lab, Palo Alto, CA, USA) with a capillary column (30 m × 0.32 mm i.d., 1 ␮ phase thickness, Zebron ZB-FAAP, Phenomenex, Torrance, CA, USA), and flame ionization detection. The oven temperature was 170 ◦ C held for 4 min, which was increased by 5 ◦ C/min to 185 ◦ C, and then by 3 ◦ C/min to 220 ◦ C, and held at this temperature for 1 min. The injector temperature was 225 ◦ C, the detector temperature was 250 ◦ C, and the carrier gas was He. True protein, fat, lactose, urea N, and somatic cell counts in milk samples were analyzed by infrared spectroscopy (System 4000 Milkoscan; Foss Electric of Hillerød, Denmark). Milk composition was corrected for differences in milk yield between the two milkings. For the analysis of milk FA, methyl esters were prepared by base-catalyzed transmethylation according to Chouinard et al. (1997). Fatty acid analyses used a gas chromatograph (HP 5890A Series II, Hewlett Packard, Palo Alto, CA, USA) equipped with a 100 m CP-Sil 88 capillary column (i.d., 0.25 mm; film thickness, 0.20 ␮m; Chrompack, Middelburg, Netherlands) and a flame ionization detector as previously described (Farnworth et al., 2007). Composition of FA in feed samples was analyzed according to Sukhija and Palmquist (1988). 2.9. Statistical analyses Statistical analyses used the MIXED procedure of SAS (2008). Treatments were arranged as a 2 × 2 factorial with period, concentrate proportion of the diet, eugenol supplementation and their interactions as fixed effects and cow as a random effect. For statistical analysis of ruminal fermentation characteristics (i.e., pH, VFA, ammonia, protozoa counts), sampling time, and sampling time × treatment were added to the model and analyzed as repeated measures using the MIXED procedure of SAS. Statistical differences were declared significant if P≤0.05. 3. Results 3.1. Dry matter intake, apparent total-tract digestibility, and nitrogen balance There were no interactions between the concentrate proportion of the diet and eugenol supplementation for DM intake, apparent total tract digestibility of nutrients and N balance (Table 3). Addition of eugenol in HC and LC diets had no effect on DM intake, apparent total tract digestibility of nutrients and N partitioning. Dry matter intake was higher (P<0.01) and apparent whole tract digestibility of nutrients was lower (P≤0.05) for cows fed HC versus LC diets. Nitrogen retention (g/d or g/kg of N intake) was similar between cows fed HC and LC diets. 3.2. In sacco ruminal degradation Data in Table 4 show that there was no interaction between the proportion of the concentrate of the diet and eugenol supplementation for in sacco ruminal degradation (16 h incubation) of grass hay (OM and ADF), soybean meal (OM and CP) and corn grain (OM and starch). Adding eugenol to HC or LC diets had no effect on ruminal degradation of chemical components of the hay, soybean meal or corn grain. In contrast, increasing the proportion of the concentrate of the diet decreased (P≤0.01) ruminal degradation of OM and ADF of the hay. 3.3. Ruminal fermentation characteristics and protozoa There was no interaction between eugenol supplementation and the concentrate proportion of the diet for ruminal fermentation characteristics or protozoal numbers (Table 5). With the exception of the BCVFA molar proportion, which was higher in cows fed eugenol, supplementation with eugenol to HC and LC diets neither affected ruminal fermentation parameters nor protozoal counts. Mean and minimum daily ruminal pH were lower (P≤0.01) in cows fed HC diets than in cows fed LC diets. Molar proportion of acetate decreased (P<0.01) while that of propionate increased (P=0.01) in cows fed HC diets compared to cows fed LC diets. As a consequence, the acetate:propionate ratio was lower in cows fed HC diets than in cows fed LC diets. Feeding HC diets to cows increased (P=0.02) total protozoal numbers compared to feeding LC diets. 3.4. Bacterial populations (16S rRNA) Except for Ruminococcus in the rumen solid fraction sampled 4 h post-feeding, there were no interactions between dietary concentrate proportion and eugenol supplementation for the rumen bacteria examined (Table 6). Similarly, addition of eugenol to the diets had no effect on rumen bacteria numbers. However, some changes occurred in rumen bacteria when the concentrate proportion of the diet increased. Indeed, the number (i.e., copies of 16S rRNA/mg of genomic DNA) of S. ruminantium was higher (P≤0.05) in ruminal contents (i.e., liquid and solid fractions both before and at 4 h post-feeding) of cows fed HC diets than in cows fed LC diets. The number of Ruminococcus spp. in the liquid fraction at 4 h post-feeding was

144

C. Benchaar et al. / Animal Feed Science and Technology 178 (2012) 139–150

Table 3 Dry matter (DM) intake, apparent total tract digestibility and N balance in cows fed low (LC) or high concentrate (HC) diets without (−) or with (+) eugenol (EUG) supplementation (50 mg/kg of DM intake). Diet LC

Pa

HC

− EUG

− EUG

+ EUG

+ EUG

SEM

Conc.

Suppl.

Interaction

DM intake kg/d kg/kg BW

17.0 0.0293

16.8 0.0290

19.9 0.0342

20.0 0.0345

0.40 0.00065

<0.01 <0.01

0.90 0.94

0.77 0.63

Digestibility DM OM CP ADF Starch Gross energy

0.693 0.706 0.693 0.565 0.929 0.688

0.694 0.710 0.683 0.584 0.932 0.688

0.671 0.684 0.652 0.558 0.852 0.664

0.666 0.680 0.667 0.542 0.841 0.660

0.0053 0.0049 0.0064 0.0099 0.0091 0.0050

<0.01 <0.01 <0.01 0.05 <0.01 <0.01

0.76 0.97 0.74 0.79 0.71 0.76

0.66 0.43 0.12 0.12 0.44 0.72

N balance Intake (g/d)

476

471

529

554

<0.01

0.52

0.35

Feces g/d g/kg N intake

146 307

150 317

183 348

184 333

4 6.4

<0.01 <0.01

0.57 0.74

0.77 0.12

Urine g/d g/kg N intake

122 261

129 274

128 243

132 237

6 15.3

0.49 0.12

0.41 0.82

0.77 0.57

Milk g/d g/kg N intake

144 303

146 311

162 307

168 302

3 6.3

<0.01 0.76

0.29 0.85

0.70 0.37

Retained g/d g/kg N intake

64 129

46 99

56 102

71 128

0.49 0.95

0.91 0.90

0.19 0.23

15

11 21

a P for the effects of concentrate proportion (Conc.: HC versus LC); eugenol supplementation (Suppl.: − EUG versus + EUG) and their interaction (Conc. × Suppl.).

higher (P=0.03) in cows fed HC diets than in cows consuming LC diets. Feeding HC diets tended (0.07≤P≤0.10) to decrease the number of F. succinogenes in the solid fraction of rumen content before and at 4 h post-feeding. 3.5. Milk production and composition There were no interactions between the concentrate proportion of the diet and eugenol supplementation for milk production, milk composition or yield of milk components (Table 7). Supplementation of eugenol to HC or LC diets did not change milk production, milk composition or yield of milk components. Conversely, milk production was higher with HC diets compared with LC diets (+1.4 kg/d, P=0.03). The concentration of fat was lower while that of true protein was higher in Table 4 In sacco degradation of grass hay, soybean meal, and corn grain incubated (16 h) in the rumen of cows fed low (LC) or high concentrate (HC) diets without (−) or with (+) eugenol (EUG) supplementation (50 mg/kg of DM intake). Diet LC

Pa

HC

− EUG

+ EUG

− EUG

+ EUG

SEM

Conc.

Suppl.

Interaction

Grass, hay OM ADF

0.519 0.332

0.496 0.293

0.406 0.169

0.425 0.195

0.0181 0.0269

<0.01 <0.01

0.90 0.82

0.29 0.27

Soybean meal OM CP

0.777 0.660

0.739 0.610

0.704 0.569

0.695 0.543

0.0291 0.0515

0.09 0.17

0.46 0.49

0.64 0.83

Corn, grain OM Starch

0.698 0.703

0.678 0.686

0.680 0.636

0.686 0.680

0.0273 0.0350

0.85 0.34

0.87 0.71

0.72 0.42

a P for the effects of concentrate proportion (Conc.: HC versus LC); eugenol supplementation (Suppl.: − EUG versus + EUG) and their interaction (Conc. × Suppl.).

C. Benchaar et al. / Animal Feed Science and Technology 178 (2012) 139–150

145

Table 5 Fermentation characteristics and protozoa counts of ruminal fluid of cows fed low (LC) or high concentrate (HC) diets without (−) or with (+) eugenol (EUG) supplementation (50 mg/kg of DM intake). Diet LC

pH Mean Minimum Maximum Total VFA (mM) VFA (mol/100 mol) Acetate (A) Propionate (P) Butyrate Valerate Caproate BCVFAb A:P Ammonia (mM) Protozoa (cell × 105 /ml)

Pa

HC

– EUG

+ EUG

– EUG

+ EUG

SEM

Conc.

Suppl.

Interaction

6.22 5.99 6.58 130

6.23 6.04 6.64 124

6.05 5.78 6.43 135

6.03 5.73 6.48 135

0.053 0.056 0.072 3.9

0.01 <0.01 0.08 0.09

0.96 0.97 0.46 0.45

0.79 0.43 0.93 0.43

63.9 19.3 13.1 1.23 0.51 1.96 3.37 5.97 2.62

63.5 19.6 13.0 1.23 0.49 2.09 3.30 5.88 2.50

59.8 23.1 13.5 1.34 0.35 1.91 2.68 5.80 4.34

59.6 23.4 13.0 1.35 0.30 2.29 2.60 6.36 3.89

0.78 1.05 0.36 0.053 0.050 0.072 0.138 0.260 0.490

<0.01 0.01 0.59 0.07 0.01 0.31 <0.01 0.56 0.02

0.76 0.79 0.47 0.95 0.50 0.01 0.59 0.40 0.59

0.92 0.99 0.58 0.98 0.76 0.14 0.98 0.26 0.75

a P for the effects of concentrate proportion (Conc.: HC versus LC); eugenol supplementation (Suppl.: − EUG versus + EUG) and their interaction (Conc. × Suppl.). b branched-chain VFA = isobutyrate + isovalerate.

milk of cows fed HC diets compared to cows fed LC diets. Milk fat yield did not differ between HC and LC diets, while yield of true protein was higher (P<0.01) in cows fed HC diets than in cows fed LC diets. 3.6. Milk fatty acid profile There were no interactions between concentrate proportion of the diet and eugenol supplementation for any of the FA measured (Table 8). Supplementation with eugenol had no effect on milk FA with the exception of minor changes in c11, c14, c17 20:3; 22:0 and c4, c7, c10, c-13, c16, c19 22:6 that were very slightly affected (0.03≤P≤0.08). Table 6 Copies of 16S rRNA/ng of genomic DNA of Fibrobacter succinogenes, Prevotella spp., Ruminococcus spp., and Selenomonas ruminantium in the fluid and solid phase of rumen content collected from cows fed low (LC) or high concentrate (HC) diets without (−) or with (+) eugenol (EUG) supplementation (50 mg/kg of DM intake). Diet LC

Pa

HC

Rumen content

– EUG

+ EUG

– EUG

+ EUG

SEM

Liquid phase Before feeding F. succinogenes Prevotella spp. Ruminococcus spp. S. ruminantium

0.12 10.7 5.38 0.056

0.11 10.1 5.28 0.068

0.21 13.1 6.51 0.16

0.12 11.1 6.32 0.16

0.041 1.82 0.827 0.025

4-h post-feeding F. succinogenes Prevotella spp. Ruminococcus spp. S. ruminantium

0.12 10.4 4.73 0.054

0.15 9.66 5.53 0.056

0.14 12.1 6.97 0.13

0.10 14.3 7.01 0.092

Solid phase Before feeding F. succinogenes Prevotella spp. Ruminococcus spp. S. ruminantium

1.03 7.03 6.95 0.042

1.05 8.35 8.69 0.029

0.81 9.61 9.29 0.12

4-h post-feeding F. succinogenes Prevotella spp. Ruminococcus spp. S. ruminantium

0.70 6.03 6.71 0.026

0.88 7.09 6.63 0.034

0.33 7.09 6.33 0.095

Conc.

Suppl.

Interaction

0.27 0.40 0.24 0.01

0.29 0.50 0.87 0.88

0.41 0.70 0.96 0.74

0.021 1.72 0.652 0.023

0.53 0.11 0.03 0.05

0.80 0.69 0.55 0.43

0.11 0.44 0.58 0.39

0.55 8.72 8.34 0.10

0.165 1.509 0.530 0.009

0.07 0.37 0.11 <0.01

0.51 0.89 0.48 0.16

0.43 0.49 0.04 0.84

0.52 8.22 8.05 0.084

0.188 0.966 1.015 0.015

0.10 0.30 0.62 0.01

0.36 0.30 0.45 0.93

0.99 0.97 0.41 0.56

a P for the effects of concentrate proportion (Conc.: HC versus LC); eugenol supplementation (Suppl.: − EUG versus + EUG) and their interaction (Conc. × Suppl.).

146

C. Benchaar et al. / Animal Feed Science and Technology 178 (2012) 139–150

Table 7 Milk production and milk composition of cows fed low- (LC) or high-concentrate (HC) diets without (−) or with (+) eugenol (EUG) supplementation (50 mg/kg of DM intake). Diet LC

Pa

HC

– EUG

+ EUG

– EUG

+ EUG

SEM

Conc.

Suppl.

Interaction

Milk yield (kg/d)

30.8

30.9

31.7

32.7

0.47

0.03

0.30

0.35

Composition (g/kg) Fat True protein Lactose MUNb (mg/dl) SCCc (cell × 103 /ml)

40.1 30.0 46.4 9.60 30.5

38.3 30.4 45.9 9.78 33.3

36.2 33.0 46.8 9.33 39.3

36.7 33.2 46.7 9.37 27.4

0.84 0.57 0.31 0.66 3.62

0.02 <0.01 0.08 0.62 0.71

0.46 0.63 0.35 0.87 0.26

0.24 0.85 0.43 0.92 0.09

Yield (kg/d) Fat True protein Lactose

1.21 0.92 1.33

1.16 0.93 1.42

1.13 1.04 1.48

1.17 1.07 1.53

0.024 0.022 0.050

0.14 <0.01 0.04

0.83 0.29 0.23

0.09 0.70 0.73

a P for the effects of concentrate proportion (Conc.: HC versus LC); eugenol supplementation (Suppl.: − EUG versus + EUG) and their interaction (Conc. × Suppl.). b Milk urea N. c Somatic cell count.

Milk fat proportions of 16:0, c9 18:1 and c9, c12, c15 18:3 were higher (P<0.01) while the proportion of c9, c12 18:2 was lower (P<0.01) in milk fat of cows fed LC diets than in that of cows fed HC diets. Milk fat proportions of t10 18:1, t11 18:1 (P=0.08), and c9, t11 18:2 increased in cows fed LC diets compared to cows fed HC diets, but the ratio t11 18:1 to t10 18:1 was not affected by concentrate proportion, although it tended (P=0.09) to be higher for HC diets than in LC diets. 4. Discussion To the best of our knowledge, this is the first study assessing the effectiveness of using eugenol alone as a feed additive in dairy cow diets. Other studies (Benchaar et al., 2006a; Cardozo et al., 2006) used mixtures of essential oils and/or essential oil compounds containing eugenol in beef cattle and, thus, effects in those studies cannot be attributed to eugenol because synergetic, antagonistic and additive effects between essential oil compounds have been reported (Burt, 2004). To date, only one study (Yang et al., 2010) has investigated effects of eugenol in vivo, but in feedlot cattle. 4.1. Effects of eugenol addition to the diets There were no interactions between dietary concentrate proportion and eugenol supplementation on any response variables, despite changes in ruminal fermentation (i.e., lower ruminal pH, shifts in VFA pattern and microbial populations) with the higher concentrate proportion in the diet. Results from an in vitro study (Cardozo et al., 2005) suggested that effects of eugenol on rumen fermentation may be pH dependent. In that study, the authors evaluated effects of eugenol on rumen microbial fermentation in vitro (24 h batch cultures) when added in buffered ruminal fluid artificially treated to adjust pH at 7.0 and 5.5. At pH 5.5, addition of eugenol at 0.3, 3 and 30 mg/l increased total VFA concentration and decreased molar proportions of propionate and BCVFA whereas no effects occurred at pH 7.0, thereby indicating that effects of eugenol on rumen microbial fermentation may be pH dependent. However, our findings do not support this conclusion and several factors could explain the discrepancy between the two studies. First, the pH 5.5 in the study of Cardozo et al. (2005) is lower than mean daily ruminal pH (6.04) and the minimal pH (5.74) in our study, which may have not been low enough to induce the effects reported by those authors. Also, the experimental conditions (i.e., constant pH) in the study of Cardozo et al. (2005) are not representative of in vivo conditions because of diurnal fluctuations of pH of ruminal fluid (Nocek, 1992). In addition, it is unknown whether the abrupt changes of pH by adding concentrated acids and bases directly into cultures in that study may have had a direct effect on the microbial populations such as numbers and/or species. Finally, results from short term in vitro studies must be interpreted with caution as they report effects over a set incubation time (e.g., 24 h) and do not account for adaptation by microbial populations that may occur as a result of continuous exposure of microbes to essential oils. Indeed, it is apparent from several studies (e.g., Cardozo et al., 2004; Busquet et al., 2005) that rumen microbes are able to adapt to essential oils, and adaptation may result from shifts in microbial populations and/or changes in individual microbial species (Benchaar and Greathead, 2011). The lack of effects of eugenol on ruminal fermentation characteristics in our study is consistent with no changes in DM intake, in sacco ruminal degradation and apparent total-tract digestibility. Our observations agree with Yang et al. (2010) who found that adding eugenol at 40, 80 or 160 mg/kg of DM to a feedlot cattle diet (800 g/kg dry rolled barley grain) had no effect on ruminal fermentation parameters, which was consistent with the lack of effects of eugenol on DM intake and ruminal degradation of OM and its constituents (except NDF) in that study. In Yang et al. (2010), ruminal digestion of

C. Benchaar et al. / Animal Feed Science and Technology 178 (2012) 139–150

147

Table 8 Milk fat composition (g/100 g) of cows fed low (LC) or high concentrate (HC) diets without (−) or with (+) eugenol (EUG) supplementation (50 mg/kg of DM intake). Fatty acidb

Diet LC − EUG

4:0 6:0 8:0 10:0 12:0 14:0 c9 14:1 15:0 16:0 c9 16:1 17:0 18:0 c9 18:1 c11 18:1 c12 18:1 c13 18:1 c15 18:1 t5 18:1 t6-8 18:1 t9 18:1 t10 18:1 t11 18:1 t12 18:1 t15 18:1 t16 18:1 c9, c12 18:2 c9, t11 18:2 c9, t12 18:2 t9, c12 18:2 t9, t12 18:2 t11, c15 18:2 c6, c9, c12 18:3 c9, c12, c15 18:3 c9, t11, c15 18:3 c6, c9, c12, c15 18:4 20:0 c11 20:1 c11, c14 20:2 c8, c11, c14 20:3 c11, c14, c17 20:3 c5, c8, c11, c14 20:4 c8, c11, c14, c17 20:4 c5, c8, c11, c14, c17 20:5 22:0 c7, c10, c13, c16 22:4 c4, c7, c10, c13, c16 22:5 c7, c10, c13, c16, c19 22:5 c4, c7, c10, c13, c16, c19 22:6 24:0 Glycerol

3.41 1.83 1.06 2.16 2.39 8.22 0.62 0.79 28.05 1.14 1.71 8.67 19.44 0.56 0.20 0.078 0.076 0.031 0.38 0.26 0.35 1.09 0.50 0.27 0.31 2.02 0.53 0.079 0.03 0.16 0.09 0.029 0.49 0.026 0.031 0.13 0.10 0.038 0.071 0.018 0.12 0.026 0.04 0.011 0.023 0.011 0.064 0.011 0.008 12.25

Pa

HC + EUG

− EUG

+ EUG

3.48 1.77 1.02 2.05 2.27 8.26 0.64 0.81 28.40 1.19 1.62 8.52 19.45 0.57 0.22 0.081 0.089 0.029 0.41 0.25 0.35 1.03 0.46 0.26 0.31 2.06 0.52 0.088 0.038 0.16 0.092 0.029 0.52 0.023 0.034 0.13 0.11 0.037 0.076 0.016 0.13 0.026 0.041 0.007 0.024 0.009 0.069 0.009 0.011 12.24

3.30 2.07 1.40 3.21 3.74 10.36 0.85 1.17 24.18 1.07 1.80 9.13 16.66 0.61 0.28 0.073 0.094 0.018 0.30 0.21 0.30 0.98 0.39 0.26 0.35 2.67 0.47 0.100 0.029 0.18 0.051 0.026 0.45 0.021 0.029 0.13 0.10 0.042 0.093 0.017 0.17 0.021 0.037 0.007 0.033 0.011 0.082 0.012 0.004 12.45

3.35 2.12 1.43 3.33 3.81 10.48 0.79 1.28 24.79 0.98 1.83 9.39 15.62 0.55 0.26 0.061 0.081 0.016 0.28 0.20 0.29 0.94 0.38 0.26 0.33 2.70 0.42 0.079 0.028 0.16 0.047 0.026 0.45 0.019 0.023 0.13 0.10 0.042 0.089 0.013 0.16 0.02 0.035 0.006 0.030 0.009 0.079 0.009 0.004 12.50

SEM 0.12 0.06 0.04 0.09 0.11 0.22 0.04 0.05 0.47 0.05 0.04 0.35 0.72 0.05 0.01 0.007 0.007 0.002 0.02 0.01 0.01 0.05 0.02 0.01 0.01 0.08 0.03 0.008 0.002 0.01 0.003 0.002 0.01 0.002 0.002 0.004 0.003 0.001 0.004 0.001 0.004 0.001 0.001 0.001 0.002 0.001 0.002 0.001 0.002 0.051

Conc. 0.32 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 0.04 0.01 0.11 <0.01 0.82 <0.01 0.10 0.50 <0.01 <0.01 <0.01 0.01 0.08 <0.01 0.78 0.03 <0.01 0.03 0.46 0.08 0.06 <0.01 0.18 <0.01 0.07 0.02 0.50 0.32 <0.01 <0.01 0.12 <0.01 <0.01 0.01 0.04 <0.01 0.97 <0.01 0.97 0.06 <0.01

Suppl. 0.61 0.92 0.86 0.99 0.82 0.73 0.61 0.25 0.35 0.71 0.51 0.88 0.50 0.64 0.91 0.53 0.99 0.28 0.83 0.12 0.35 0.33 0.20 0.46 0.48 0.72 0.32 0.48 0.23 0.20 0.72 0.97 0.16 0.26 0.43 0.55 0.68 0.71 0.95 0.03 0.98 0.86 0.73 0.07 0.79 0.15 0.71 0.08 0.71 0.68

Interaction 0.94 0.40 0.33 0.25 0.45 0.85 0.30 0.39 0.79 0.27 0.20 0.58 0.49 0.49 0.31 0.29 0.12 0.94 0.41 0.60 0.75 0.86 0.38 0.32 0.72 0.93 0.51 0.09 0.13 0.07 0.49 0.80 0.15 0.84 0.10 0.95 0.29 0.50 0.26 0.36 0.19 0.38 0.16 0.19 0.24 0.98 0.13 0.83 0.61 0.63

a P for the effects of concentrate proportion (Conc.: HC versus LC); eugenol supplementation (Suppl.: – EUG versus + EUG) and their interaction (Conc. × Suppl.). b c, cis; t, trans.

NDF was not affected when eugenol was fed at 41 mg/kg of DM intake, which is close to the feeding rate in our study at 50 mg/kg of DM. However, ruminal digestion of NDF was reduced when eugenol was supplemented at high levels (80 and 160 mg/kg) in Yang et al. (2010). Our results and those from Yang et al. (2010), suggest that high eugenol dosage rates are required to alter ruminal fiber degradation. In fact, we (Fraser et al., 2007) reported a reduction in NDF degradability when a high concentration (500 mg/l of ruminal fluid) of cinnamon leaf essential oil (containing 760 g/kg eugenol) was added to continuous culture fermenters. At the same dosage rate in Rusitec, cinnamon leaf essential oil reduced aNDF degradability of a barley grain based concentrate, but not the aNDF degradability of barley silage, suggesting that the effect of eugenol on fiber degradation may vary with substrate.

148

C. Benchaar et al. / Animal Feed Science and Technology 178 (2012) 139–150

There is very limited information on effects of eugenol on ruminal protozoa. In our study, the total number of protozoa was unaffected by eugenol supplementation, which agrees with the findings of Yang et al. (2010) who also reported no change in total numbers and the genera distribution of protozoa in ruminal fluid of feedlot cattle fed eugenol. Benchaar et al. (2009) reported that essential oils and their main compounds, including eugenol, do not have marked effects on the ruminal ciliate protozoa population. Information on effects of feeding eugenol on milk performance of cows is also scarce. In our study, neither milk production nor its composition were affected by including eugenol, which is consistent with the lack of eugenol effects on DM intake, digestion and ruminal fermentation. That supplementation with eugenol had no effect on milk FA which contrasts with Morsy et al. (2012) who reported that supplying clove essential oil (which is mainly composed of eugenol) decreased concentrations of 18:0 and c9 18:1 and increased polyunsaturated FA in milk fat of dairy goats. However, in the latter study, the level of supplementation was higher (2 ml clove oil/d) compared with our experiment. Conversely, the lack of an effect on the milk FA profile of our dairy cows is consistent with results of Lourenc¸o et al. (2008), obtained by using a continuous culture fermenter fed perennial ryegrass, who showed that eugenol at 250 mg/l had no effect on apparent efficiency of biohydrogenation of polyunsaturated FA; despite a slightly higher concentration of c-9 18:1 and other minor 18:1 isomers (e.g., t6–8, t15, and c15) in the in vitro culture. The lack of effects on milk FA profile is also consistent with previous in vivo studies with dairy cows using different sources of essential oil compounds that included (Benchaar et al., 2006b, 2007b) or did not include (Benchaar and Chouinard, 2009) eugenol. 4.2. Effects of diet concentrate level Increasing the proportion of dietary concentrate resulted in predictable changes (i.e., lower ruminal pH and acetate:propionate ratio; reduction in ruminal fiber degradation; decreased milk fat concentration) typical of cows fed high-grain diets. However, not so predictable was that the HC diet increased total protozoal number compared to feeding LC diets, which agrees with the results of Hook et al. (2011). In contrast, Hristov et al. (2001) reported a 40% decrease in protozoal numbers in steers fed a 950 g/kg barley grain based diet than in steers fed a 620 g/kg barley grain based diet. Discrepancies between studies could be due to a shift within individual protozoal populations. Franzolin and Dehority (1996) suggested that variations could also be a result of the genus of protozoa in the rumen, with different genera having varying sensitivities to ruminal pH. Feeding the HC diet tended to reduce the abundance of F. succinogenes in the solid fraction at 4 h post feeding because its growth requires fermentable fiber (Fernando et al., 2010; Petri et al., 2012). That Ruminococcus spp. number remained similar, or even increased, in the liquid fraction at 4 h post feeding) when the HC diets were fed may be due to a shift in its population toward more amylolytic species such as Ruminococcus bromii, because Ruminococcus spp. encompasses both fibrolytic and amylolytic species (Klieve et al., 2007). The concomitant decrease in in sacco ruminal degradation of the hay (Table 4) with increased concentrate feeding could have resulted from a depression in the fibrolytic density and/or activity due to the lower ruminal pH (Table 5). With no effect on Prevotella spp., feeding the HC diet increased the number of S. ruminantium. This was expected and agrees with the fermentation patterns reported in Table 5 as S. ruminantium utilizes fermentable substrates and lactic acid produced within the rumen to produce propionate (Nisbet et al., 2009). In our study, the experimental diets were maintained isoenergetic by adding a rumen inert fat (Megalac® ) in the LC diets (Table 1). The predominant FA in Megalac® are 16:0 and c9 18:1, which both increased in milk fat when cows ate the LC diet compared with the HC diet. Feeding higher levels of legume/grass silage in LC treatments increased the content of c9, c12, c15 18:3 in the diets, while higher proportions of cereal grains and by products in HC diets increased the supply of c9, c12 18:2 (Table 1). As a consequence, feeding LC diets increased milk fat content of c9, c12, c15 18:3 and other FA (c6, c9, c12, c15 18:4, c8, c11, c14, c17 20:4, c5, c8, c11, c14, c17 20:5) from the n-3 group, whereas feeding HC diets increased milk fat content of c9, c12 18:2, and other FA (c11, c14 20:2, c8, c11, c14 20:3, c5, c8, c11, c14 20:4, c7, c10, c13, c16 22:4) from the n-6 group. 5. Conclusions Increasing the proportion of the concentrate of the diet resulted in predictable changes (i.e., lower ruminal pH and acetate:propionate ratio; reduced fiber degradation; decreased milk fat content) typical of those observed when cows are fed high versus low concentrate diets. No interactions between level of the concentrate of the diet and eugenol supplementation occurred, suggesting that effects of eugenol is neither pH nor diet dependant. Supplementation of high or low concentrate diets with eugenol had no effect on DM intake, ruminal parameters (fermentation, bacteria, protozoa) or milk performance, indicating that at the dosage rate (i.e., 50 mg/kg of dietary DM) evaluated, the potential to use eugenol as feed additive in dairy cows to modulate rumen fermentation and improve feed efficiency is low. Acknowledgments The authors are grateful to the Dairy and Swine Research Centre (Dairy and Swine Research and Development Centre, Sherbrooke, QC, Canada) staff including, L. Croteau (technical support), S. Méthot (help with the statistical analyses), and the barn crew (care of the cows). Technical support by P. Lussier (Lethbridge Research Centre, AB, Canada) for DNA analysis is

C. Benchaar et al. / Animal Feed Science and Technology 178 (2012) 139–150

149

appreciated. The authors also thank M. Gingras (Université Laval, Québec, QC, Canada) for FA analyses. Donation of eugenol by Phodé (Albi, France) was much appreciated. A. Lettat and F. Hassanat were recipients of post-doctoral fellowships from the National Science and Engineering Research Council of Canada (Ottawa, ON, Canada). Funding for the study was from Agriculture and Agri-Food Canada (Ottawa, ON, Canada).

References Association of Official Analytical Chemists, 1990. Official Methods of Analysis, 15th ed. AOAC, Arlington, VA, USA. Benchaar, C., Chouinard, P.Y., 2009. Fatty acid composition of milk of dairy cows fed cinnamaldehyde, quebracho condensed tannins or Yucca schidigera saponins. J. Dairy Sci. 92, 3392–3396. Benchaar, C., Greathead, H., 2011. Essential oils and opportunities to mitigate enteric methane emissions from ruminants. Anim. Feed Sci. Technol. 166–167, 338–355. Benchaar, C., Chaves, A.V., Fraser, G.R., Wang, Y., Beauchemin, K.A., McAllister, T.A., 2007a. Effects of essential oils and their components on in vitro rumen microbial fermentation. Can. J. Anim. Sci. 87, 413–419. Benchaar, C., Duynisveld, J.L., Charmley, E., 2006a. Effects of monensin and increasing dose levels of a mixture of essential oil compounds on intake, digestion and growth performance of beef cattle. Can. J. Anim. Sci. 86, 91–96. Benchaar, C., Hristov, A.N., Greathead, H., 2009. Essential oils as feed additives in ruminant nutrition. In: Steiner, T. (Ed.), Phytogenics in Animal Nutrition. Natural Concepts to Optimize Gut Health and Performance. Nottingham University Press, Nottingham, UK, pp. 111–146. Benchaar, C., Calsamiglia, S., Chaves, A.V., Fraser, G.R., Colombatto, D., McAllister, T.A., Beauchemin, K.A., 2008. A review of plant-derived essential oils in ruminant nutrition and production. Anim. Feed Sci. Technol. 145, 209–228. Benchaar, C., Petit, H.V., Berthiaume, R., Ouellet, R.R., Chiquette, J., Chouinard, P.Y., 2007b. Effects of essential oils on digestion, ruminal fermentation, rumen microbial populations, milk production, and milk composition in dairy cows fed alfalfa silage or corn silage. J. Dairy Sci. 90, 886–897. Benchaar, C., Petit, H.V., Berthiaume, R., Whyte, T.D., Chouinard, P.Y., 2006b. Effects of addition of essential oils and monensin premix on digestion, ruminal fermentation, milk production, and milk composition in dairy cows. J. Dairy Sci. 89, 4352–4364. Burt, S., 2004. Essential oils: their antibacterial properties and potential applications in foods—a review. Int. J. Food Microbiol. 94, 223–253. Busquet, M., Calsamiglia, S., Ferret, A., Kamel, C., 2005. Screening for the effects of natural plant extracts and secondary plant metabolites on rumen microbial fermentation in continuous culture. Anim. Feed Sci. Technol. 123, 597–613. Busquet, M., Calsamiglia, S., Ferret, A., Kamel, C., 2006. Plant extracts affect in vitro rumen microbial fermentation. J. Dairy Sci. 89, 761–771. Calsamiglia, S., Busquet, M., Cardozo, P.W., Castillejos, L., Ferret, A., 2007. Essential oils as modifiers of rumen microbial fermentation. J. Dairy Sci. 90, 2580–2595. Cardozo, P.W., Calsamiglia, S., Ferret, A., Kamel, C., 2004. Effects of natural plant extracts on ruminal protein degradation and fermentation profiles in continuous culture. J. Anim. Sci. 82, 3230–3236. Cardozo, P.W., Calsamiglia, S., Ferret, A., Kamel, C., 2005. Screening for the effects of natural plant extracts at different pH on in vitro rumen microbial fermentation of a high-concentrate diet for beef cattle. J. Anim. Sci. 83, 2572–2579. Cardozo, P.W., Calsamiglia, S., Ferret, A., Kamel, C., 2006. Effects of alfalfa extract, anise, capsicum, and a mixture of cinnamaldehyde and eugenol on ruminal fermentation and protein degradation in beef heifers fed a high-concentrate diet. J. Anim. Sci. 84, 2801–2808. Castillejos, L., Calsamiglia, S., Ferret, A., 2006. Effect of essential oils active compounds on rumen microbial fermentation and nutrient flow in in vitro systems. J. Dairy Sci. 89, 2649–2658. Canadian Council on Animal Care (CCAC), 1993. Guide to the care and use of experimental animals. Ottawa, ON, Canada. Chouinard, P.Y., Lévesque, J., Girard, V., Brisson, G.J., 1997. Dietary soybeans extruded at different temperatures, milk composition and in situ fatty acid reactions. J. Dairy Sci. 80, 2913–2924. Cochran, W.G., Cox, G.M., 1957. Experimental Designs, 2nd ed. John Wiley & Sons, Inc., New York, NY, USA. Farnworth, E., Chouinard, P.Y., Jacques, H., Venkatramanan, S., Maf, A., Defnoun, S., Jones, P., 2007. The effect of drinking milk containing conjugated linoleic acid on fecal microbiological profile, enzymatic activity, and fecal characteristics in humans. Nutr. J. 6, 1–15. Fernando, S.C., Purvis, H.T., Najar, F.Z., Sukharnikov, L.O., Krehbiel, C.R., Nagaraja, T.G., Roe, B.A., Desilva, U., 2010. Rumen microbial population dynamics during adaptation to a high-grain diet. Appl. Environ. Microbiol. 76, 7482–7490. Franzolin, R., Dehority, B.A., 1996. Effect of prolonged high-concentrate feeding on ruminal protozoa concentrations. J. Anim. Sci. 74, 2803–2809. Fraser, G.R., Chaves, A.V., Wang, Y., McAllister, T.A., Beauchemin, K.A., Benchaar, C., 2007. Assessment of the effects of cinnamon leaf oil on rumen microbial fermentation using two continuous culture systems. J. Dairy Sci. 90, 2315–2328. Hall, M.B., 2000. Neutral Detergent-Soluble Carbohydrates Nutritional Relevance and Analysis. Gainesville, USA, Extension Institute of Agricultural Sciences. University of Florida, Gainesville, FL, USA. Hook, S.E., Steele, M.A., Northwood, K.S., Wright, A.D., McBride, B.W., 2011. Impact of high-concentrate feeding and low ruminal pH on methanogens and protozoa in the rumen of dairy cows. Microb. Ecol. 62, 94–105. Hristov, A.N., Ivan, M., Rode, L.M., McAllister, T.A., 2001. Fermentation characteristics and ruminal ciliate protozoal populations in cattle fed medium- or high-concentrate barley-based diets. J. Anim. Sci. 79, 515–524. Klieve, A.V., O’Leary, M.N., McMillen, L., Owerkerk, D., 2007. Ruminococcus bromii, identification and isolation as a dominant community member in the rumen of cattle fed a barley diet. J. Appl. Microbiol. 103, 2065–2073. Kong, Y., Teather, R., Forster, R., 2010. Composition, spatial distribution, and diversity of the bacterial communities in the rumen of cows fed different forages. FEMS Microbiol. Ecol. 74, 612–622. Li, M., Penner, G.B., Hernandez-Sanabria, E., Oba, M., Guan, L.L., 2009. Effects of sampling location and time, and host animal on assessment of bacterial diversity and fermentation parameters in the bovine rumen. J. Appl. Microbiol. 107, 1924–1934. Lourenc¸o, M., Cardozo, P.W., Calsamiglia, S., Fievez, V., 2008. Effects of saponins, quercetin, eugenol, and cinnamaldehyde on fatty acid biohydrogenation of forage polyunsaturated fatty acids in dual-flow continuous culture fermenters. J. Anim. Sci. 86, 3045–3053. Màthé, A., 2009. Essential oils – biochemistry, production and utilisation. In: Steiner, T. (Ed.), Phytogenics in Animal Nutrition. Natural Concepts to Optimize Gut Health and Performance. Nottingham University Press, Nottingham, UK, pp. 1–18. Morsy, T.A., Kholif, S.M., Matloup, O.H., Abdo, M.M., El-Shafie, M.H., 2012. Impact of anise, clove and juniper oils as feed additives on the productive performance of lactating goats. Int. J. Dairy Sci. 7, 20–28. Nisbet, D.J., Callaway, T.R., Edrington, T.S., Anderson, R.C., Krueger, N., 2009. Effects of the dicarboxylic acids malate and fumarate on E. coli O157, H7 and Salmonella enterica typhimurium populations in pure culture and in mixed ruminal microorganism fermentations. Curr. Microbiol. 58, 488–492. Nocek, J.E., 1992. Feeding sequence and strategy effects on ruminal environment and production performance in first lactation cows. J. Dairy Sci. 75, 3100–3108. Ogimoto, K., Imai, S., 1981. Page 158 in Atlas of Rumen Microbiology. Japan Sci. Soc. Press, Tokyo, Japan. Ohene-Adjei, S., Teather, R.M., Ivan, M., Forster, R.J., 2007. Postinoculation protozoan establishment and association patterns of methanogenic archaea in the ovine rumen. Appl. Environ. Microbiol. 73, 4609–4618. OJEU, 2003. Regulation (EC) No 1831/2003 of the European Parliament and the Council of 22 September 2003 on additives for use in animal nutrition. Official J. Eur. Union. Page L268/36 in OJEU of 10/18/2003. Brussels, Belgium.

150

C. Benchaar et al. / Animal Feed Science and Technology 178 (2012) 139–150

Petri, R.M., Forster, R.J., Yang, W., McKinnon, J.J., McAllister, T.A., 2012. Characterization of rumen bacterial diversity and fermentation parameters in concentrate fed cattle with and without forage. J. Appl. Microbiol. 112, 1152–1162. SAS Institute, 2008. SAS/STAT User’s Guide, Version 9. 2. SAS Institute Inc., Cary, NC, USA. Stevenson, D.M., Weimer, P.J., 2007. Dominance of Prevotella and low abundance of classical ruminal bacterial species in the bovine rumen revealed by relative quantification real-time PCR. Appl. Microbiol. Biotechnol. 75, 165–174. Sukhija, P.S., Palmquist, D.L., 1988. Rapid method for determination of total fatty acid content and composition of feedstuffs and feces. J. Agric. Food. Chem. 36, 1202–1206. Van Soest, P.J., Robertson, J.B., Lewis, B.A., 1991. Methods for dietary fiber, neutral detergent diber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 74, 3583–3597. Walsh, S.E., Maillard, J.Y., Russell, A.D., Catrenich, C.E., Charbonneau, D.L., Bartolo, R.G., 2003. Activity and mechanisms of action of selected biocidal agents on gram-positive and -negative bacteria. J. Appl. Microbiol. 94, 240–427. Weatherburn, M.W., 1967. Phenol-hypochlorite reaction for determination of ammonia. Anal. Chem. 39, 971–974. Weimer, P., Stevenson, D., Mertens, D., Thomas, E., 2008. Effect of monensin feeding and withdrawal on populations of individual bacterial species in the rumen of lactating dairy cows fed high-starch rations. Appl. Microbiol. Biotechnol. 80, 135–145. Yang, W.Z., Benchaar, C., Ametaj, B.N., Beauchemin, K.A., 2010. Dose response to eugenol supplementation in growing beef cattle, Ruminal fermentation and intestinal digestion. Anim. Feed Sci. Technol. 158, 57–64.