Evaluation of a rapid lateral flow immunoassay for Staphylococcus aureus detection in respiratory samples

Diagnostic Microbiology and Infectious Disease 75 (2013) 28–36

Contents lists available at SciVerse ScienceDirect

Diagnostic Microbiology and Infectious Disease j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d i a g m i c r o b i o

Evaluation of a rapid lateral flow immunoassay for Staphylococcus aureus detection in respiratory samples☆ Surasa Wiriyachaiporn a, Peter H. Howarth b, Kenneth D. Bruce a, Lea Ann Dailey a,⁎ a b

Institute of Pharmaceutical Science, King's College London, London SE1 9NH, United Kingdom Clinical and Experimental Sciences, Faculty of Medicine, University of Southampton, Southampton General Hospital, Southampton, SO16 6YD, United Kingdom

a r t i c l e

i n f o

Article history: Received 14 June 2012 Received in revised form 12 September 2012 Accepted 20 September 2012 Available online 25 October 2012 Keywords: Point-of-care diagnostics Lateral flow immunoassay Staphylococcus aureus Asthma

a b s t r a c t Rapid point-of-care pathogen detection remains a challenge in routine diagnostics. A Staphylococcus aureus– specific lateral flow immunochromatography (LFI) test has been developed using a specific monoclonal antibody to the S. aureus cell-wall peptidoglycan. The LFI test was shown to be specific for S. aureus with no signal development for other Staphylococcal species or common respiratory pathogens. Evaluation of S. aureus isolates spiked into induced sputum and bronchoalveolar lavage samples derived from severe asthmatic patients showed a detection limit of 10 6 CFU/mL for the LFI. The test was also shown to successfully detect S. aureus in 1 sample independently determined to be S. aureus positive by quantitative polymerase chain reaction. The ability of the LFI test to rapidly detect S. aureus in clinical respiratory samples suggests that it might be a useful platform for further development of point-of-care diagnostic applications. © 2013 Elsevier Inc. All rights reserved.

1. Introduction According to the World Health Organisation's Global Burden of Disease 2004 Update (WHO, 2008), lower respiratory tract infections comprise the third leading cause of mortality amongst the world population for all age groups. This category includes all bacterial and viral infections of the lower respiratory tract, but omits tuberculosis, which, on its own, represents the seventh leading cause of death worldwide. Amongst low-income countries, lower respiratory tract infections are the primary cause of death. Respiratory infections, especially those of bacterial origin, are currently treated with a range of antimicrobial therapies. However, the emergence of multidrug-resistant bacteria, especially in Streptococcus pneumoniae, Staphylococcus aureus, and Gram-negative bacteria, has severely restricted treatment options. Many experts have stated that an immediate and concerted global-wide effort is now the only way to contain the spread of drug-resistant bacteria before current therapeutics become widely ineffective (Song and Chung, 2010). Significant improvements in the treatment of at-risk patients suffering from respiratory tract infections may be achieved by decreasing the time to diagnosis of the pathogen responsible for the infection. Traditional culture-based techniques are not only time consuming in that they can require several days for diagnosis, but they also have the drawback of selectively representing only a small

☆ The Wessex Severe Asthma Cohort is funded by the MRC. ⁎ Corresponding author. Tel.: +44(0)207-848-4780. E-mail address: [email protected] (L.A. Dailey). 0732-8893/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.diagmicrobio.2012.09.011

fraction of the bacteria in a given community depending on the culture conditions selected (Amann et al., 1995). Advances in molecular diagnostic approaches, whilst improving detection sensitivity and selectivity, remain laborious and time consuming. Furthermore, they require lengthy validation procedures and highly trained operating personnel, which increases their costliness (Murphy and Bustin, 2009; Ranjard et al., 2000; Speers, 2006). Point-of-care prescreening of clinical specimens is emerging as a useful complementary tool to detect or rule out common pathogens and guide subsequent diagnostic and therapeutic decisions. The advantages of rapid point-of-care assays for early pathogen screening include the possibility of immediate initiation of a specific antibiotic therapy, a reduction in unnecessary antibiotic consumption, a reduction in false diagnoses due to selection pressure, the opportunity to identify infection chains, no preanalytical interference due to sample handling, and a better compliance with patients who are difficult to reach (Sturenburg and Junker, 2008). For example, Cals et al. (2010) recently published the results of a randomised, controlled study in which a point-of-care analysis of C-reactive protein was performed in the primary care setting (general practice) for patients with symptoms of lower respiratory tract infections and rhinosinusitis. They demonstrated that antibiotic prescriptions were significantly lower in the group with point-ofcare screening, while recovery rates were similar and patient satisfaction was significantly higher. It should be noted that the C-reactive protein test does not evaluate microbial burdens, but rather is a biomarker of acute inflammatory processes. However, the example provided illustrates how point-of-care testing may be implemented in the clinical setting.

S. Wiriyachaiporn et al. / Diagnostic Microbiology and Infectious Disease 75 (2013) 28–36

Several rapid detection systems have been developed with pointof-care screening in mind. These include latex agglutination tests and species-specific tests such as the coagulase test for Staphylococcus aureus (HPA, 2010; Kateete et al., 2010). However, these techniques often require prior isolation of pathogen to be identified, special storage conditions or a number of processing steps. In contrast, lateral flow immunochromatography (LFI) assays are rapid, 1-step, inexpensive tests which can be used at point of care by untrained staff and patients themselves (Posthuma-Trumpie et al., 2009). In this study, an LFI test strip designed for rapid and specific detection of S. aureus was evaluated for functionality in bronchoalveolar lavage (BAL) fluid and induced sputum (IS) specimens collected from severely asthmatic patients. It was hypothesised that the LFI test strip would be functional in the presence of the complex clinical sample matrix. It was furthermore expected that respiratory samples derived from asthmatic patients would carry a low S. aureus burden, thus providing a suitable model to assess nonspecific signal generation from clinical sample components. 2. Materials and methods 2.1. Bacterial strains Bacterial type strains and clinical isolates used in this study (Table 1) were obtained from the National Collection of Type Culture (London, UK) and Diagnostic Laboratories of Southampton University Hospital. These comprised methicillin-sensitive S. aureus (MSSA), methicillin-resistant S. aureus (MRSA), as well as 5 other staphylococcal species. These included S. equorums, S. vitulus, S. haemolyticus, S. saprolyticus, and S. pasteuri. Six other bacterial species used as outgroup species were also included: Strenotrophomonas maltophilia, Burkholderia cepacia, Pseudomonas aeruginosa, Acinetobacter calcoaceticus, Streptococcus pneumoniae, and Escherichia coli. Bacterial strains were grown to the mid-exponential phase in nutrient broth (Oxoid, Basingstoke, UK) at 37 °C with agitation at 110 rpm. The cells were quickly chilled and harvested by centrifugation at 4000 × g, 4 °C for 20 min. The cell pellets were resuspended in phosphate buffered saline (PBS) buffer and adjusted to the required cell concentration. 2.2. Clinical samples Clinical samples used in this study were provided from The Wessex Severe Asthma Cohort and from the volunteer research database of the Clinical and Experimental Sciences academic unit of

Table 1 Bacterial type strains and clinical isolates used in this study. Bacterial strains

Source

Staphylococcus aureus

NCTC08532a Clinicalb Clinicalb Clinicalb Clinicalb Clinicalb Clinicalb Clinicalb NCTC10743a Clinicalb NCTC10332a NCTC10257a Clinicalb NCTC7250a NCTC9001a

Methicillin-resistant Staphylococcus aureus (MRSA) Staphylococcus equorum Staphylococcus vitulus Staphylococcus haemolyticus Staphylococcus saprolyticus Staphylococcus pasteuri Burkholderia cepacia Pseudomonas aeruginosa Stenotrophomonas maltophilia Streptococcus pneumoniae Acinetobacter calcoaceticus Escherichia coli a b

National Collection of Type Culture (London, UK). Diagnostic Laboratories of Southampton University Hospital.

29

the Faculty of Medicine in conjunction with the National Institute of Health Respiratory Bioscience Research Unit in Southampton, UK. The samples were collected with full ethical approval granted by the Joint Southampton Hospitals and University Ethics Committee and local R&D approval. All volunteers gave written informed consent. Three BAL and 3 IS samples were collected from 6 volunteers diagnosed with severe asthma, i.e., patients were at treatment Step 4 or 5 of the British Thoracic Society Scottish Intercollegiate Guidelines Network (2008). All subjects were nonsmokers at the time of study, were clinically stable, and had no symptoms of acute infection, exacerbation, or antibiotic treatment within 6 weeks of recruitment. BAL collection was performed by wedging the bronchoscope (Olympus BF Type P60 Bronchoscope, Olympus Evis CLV U20 light source video system; Olympus, South-End-on-Sea, UK) in the posterior segment of the right upper lobe. One hundred and twenty millilitres of 0.9% prewarmed sterile saline was instilled in aliquots of 20 mL. BAL fluids were then collected via gentle aspiration into a sterile trap and immediately stored at −80 °C until further use. For the evaluation of LFI test strip functionality, BAL samples were thawed and used without further processing steps. Prior to IS sample collection, patients were asked to brush their mouth, tongue, and gums. Sputum production was then induced by the inhalation of nebulised 4.5% saline for 20 min, and expectorated sputum was collected according to the guidelines put forth by Efthimiadis et al. (2002) and Pizzichini et al. (1996). Sputum plugs were extracted and immediately stored at −80 °C until further use. For the evaluation of LFI test strip functionality, IS samples were thawed and homogenised using Sputasol™ (Oxoid), according to the manufacturer's instructions. 2.3. LFI Test strip optimisation and design specifications The LFI test strip used in this study was based on a system developed by Huang (2006); however, the antigen target and capture/detection antibody were modified to achieve greater sensitivity and specificity. An affinity-purified mouse monoclonal anti–S. aureus antibody (MAbS), raised specifically against S. aureus cell-wall peptidoglycan (using UVinactivated S. aureus, ATCC 29740; Biogenesis, Poole, UK), was verified for sensitivity and specificity using dot blot and ELISA analysis before use as both the capture and detection antibody in the LFI test strip. The MAbS was specific to S. aureus, MSSA, and MRSA clinical isolates with a limit of detection at 108 and 10 7 CFU/mL in the dot blot and ELISA assays, respectively (data not shown). Gold colloid (diameter: 40 nm; British Biocell International, Cardiff, UK)–MAbS conjugates were prepared by mixing 100 μL MAbS (830 nmol/L in 2 mmol/L borax buffer, pH 9) with 1 mL colloidal gold (0.15 nmol/L in 2 mmol/L borax buffer, pH 9) for 2 min, followed by centrifugation at 6000 × g at 4 °C for 12 min and resuspension in 2 mmol/L borax buffer containing 1% (w/v) BSA and 0.05% (w/v) sodium azide. Conjugate pads (FUSION 5™, Whatman International, UK) were immersed in the gold colloid–MAbS conjugate suspension (final concentrations of ca. 700 nmol/L MAbS and 1.3 nmol/L gold colloid) and dried for 2 h at 37 °C prior to strip assembly. All further design specifications of the LFI test strips can be found in Fig. 1. 2.4. Sensitivity and specificity of LFI test strips One hundred microlitres of PBS (negative control) and an S. aureus isolate suspension (10 9 CFU/mL in PBS; positive control) were applied to the sample pad to evaluate preliminary LFI test functionality. Test signals developed within 3 min. The presence of a red signal at both T- and C lines indicated a valid positive test result for the positive control (P), while the negative control (N) was expected to develop a red signal at the C line only. Image analysis of the signal intensity (in arbitrary units [au]) at both T- and C lines was performed using

30

S. Wiriyachaiporn et al. / Diagnostic Microbiology and Infectious Disease 75 (2013) 28–36

Fig. 1. Design specifications of the LFI test strip.

ImageJ software (Rasband, 1997). A relative signal intensity (RSI%) value was determined from the peak intensity at the T line of test samples (S) minus the negative control T-line value (N) and expressed as a percentage of the signal intensity at the T line of the positive control (P): RSI ð% Þ ¼ ½ðS−NÞ=P  100: Test strip sensitivity was assessed by applying 100 μL of S. aureus isolates suspended in PBS at concentrations of 10 0–10 9 CFU/mL to the sample pad. Specificity was assessed by applying 100 μL of the species listed in Table 1 suspended in PBS at a concentration of 10 9 CFU/mL to the sample pad. Diagnostic sensitivity and specificity (Kateete et al., 2010) were calculated as: Diagnostic sensitivity ¼ ½true negatives=ðfalse positives þ true negativesÞ  100 Diagnostic sensitivity ¼ ½true positive=ðtrue positives þ false negativesÞ  100

2.5. Quantification of S. aureus in respiratory samples using quantitative polymerase chain reaction All 6 clinical samples were screened for S. aureus load using the S. aureus–specific femB gene quantitative polymerase chain reaction (qPCR) (Saeed et al., 2010). Bacterial DNA extraction from BAL and IS was performed as previously described by Rogers et al. (2004). The assays were carried out using the primer pairs femBF1 (5′-GACATTTGATAGTCAACGTAAACGTAATATT-3′) and femBR1 (5′GCTCTTCAGTTTCACGATATAAATCTAAGA-3′), and probes (5′-HEX TCATCACGTTCAAGGAATCTGACTTTAACACCATAGT TAMRA-3′) by the HPA Southampton General Hospital (UK). S. aureus cell counts in clinical samples were determined using standard curve of quantification cycle (Cq) generated from a series of 10-fold dilutions of control S. aureus cell ranging from 10 1 to 10 9 CFU/mL. 2.6. Clinical evaluation of LFI test strip functionality using respiratory samples Unprocessed BAL and processed IS samples were spiked with S. aureus isolate suspensions at various concentrations ranging from 10 0

S. Wiriyachaiporn et al. / Diagnostic Microbiology and Infectious Disease 75 (2013) 28–36

31

values of 0.01b P b 0.05 were considered as significant, and P b 0.01 were considered highly significant. 3. Results 3.1. Sensitivity and specificity of the LFI test strip

Fig. 2. Verification of basic LFI test strip function: (A) A representative image of a valid positive and negative test result is shown accompanied by corresponding signal intensity peaks generated by ImageJ software. (B) Mean signal intensities (in arbitrary units) ± SDs of n = 3 test strips as calculated using ImageJ software.

to 10 9 CFU/mL. One hundred microlitres of each spiked sample was applied to the sample pad of the IC test strip. T-line signals were assessed by visual means and image analysis (RSI%). All samples were also evaluated without the addition of S. aureus isolates.

2.7. Statistical analysis Statistical analysis (t test) was used to compare relative signal intensities obtained from either T line or C line of LFI test strips when tested with different bacterial suspension and clinical specimens. P

Visual assessment and image analysis confirmed that both the positive and negative controls provided valid and reproducible results (Fig. 2A). The mean signal intensity (in arbitrary units) of all C lines tested did not differ significantly from that of the T-line signals for the positive control (S. aureus at 10 9 CFU/mL) (P = 0.03). The background noise level of the negative control T line was approx. 5% of the maximal T-line value. However, this difference was found to be highly significant (P = 0.003). The LFI test strip detection limit was determined using suspensions of S. aureus isolates in PBS at concentrations ranging from 10 0 to 10 9 CFU/mL. Visual analysis of the strips showed the development of a positive T-line signal at 10 6 CFU/mL and greater (Fig. 3A). All test strips showed strong positive C-line signals, verifying that they were functioning correctly. RSI% values determined by image analysis confirmed a significant increase in signal intensity at 10 6 CFU/mL (P = 0.01) (Fig. 3B). It should be noted that the sensitivity of the test strip was 1 order of magnitude lower than the detection limit for the free MAbS assessed by ELISA and 2 orders of magnitude lower than that by the dot blot analysis (ELISA and dot blot data not shown). LFI test strips positively detected MSSA and MRSA isolates, but did not show signal development when any other species was tested, including other Staphylococci species tested (P N 0.05) (Fig. 4A). Again, the image analysis in the form of RSI% values confirmed this result (Fig. 4B). Calculation of diagnostic sensitivity and specificity showed that the LFI achieved 100% for both parameters (n = 21). However, it should be noted that a broader study of these 2 parameters to include

Fig. 3. Determination of the detection limit of LFI test strips. (A) The visual detection limit of the test was shown to be 106 CFU/mL (indicated by arrow). (B) Image analysis of the LFI test strip T-line regions showed that a significant increase in the T-line RSI (%) also occurred at S. aureus concentrations ≥106 CFU/mL (indicated by ‘*’). Both the images and the image analysis values are representative of n = 3 individual experiments.

32

S. Wiriyachaiporn et al. / Diagnostic Microbiology and Infectious Disease 75 (2013) 28–36

Fig. 4. Specificity of the LFI test strips. (A) The test strips positively detected MSSA and MRSA, but showed negative results for all other species tested including other staphylococcal species and out-group species listed in Table 1. (B) Image analysis confirmed the visual results, showing RSI (%) for clinical isolates of MSSA and MRSA comparable to S. aureus– positive controls, while the RSI (%) values of other species were not significantly higher than those of the negative controls. Both the images and the image analysis values are representative of n = 3 individual experiments.

a higher number of both in-group species and different strains of S. aureus should be performed in the future to further test the robustness of the assay. For comparison, Huang (2006) reported a 100% sensitivity and 94.7–100% specificity of S. aureus detection in a total of 130 S. aureus strains and 36 non–S. aureus strains for their LFI assay, which is very similar to the current system. Furthermore, a similar study by Nakasone et al. (2007) reported 96.9% sensitivity and 100% specificity of enteropathogenic and enterohemorrhagic E. coli detection in a total of 73 E. coli strains using an LFI test. It should be noted, however, that these studies were conducted using isolates suspended in saline and not with clinical specimens. 3.2. Evaluation of the LFI test strip performance with respiratory samples Three unprocessed BAL and 3 processed IS specimens obtained from severely asthmatic patients were spiked with 10 0–10 9 CFU/mL S. aureus isolates and applied to the LFI test strips. No signals were detectable in samples spiked with b10 6 CFU/mL S. aureus and therefore only data from the concentration range 10 6–10 8 CFU/mL are shown (Fig. 5). It is important to note that while BAL samples spiked with S. aureus at 10 6 CFU/mL or higher showed a clear positive T-line signal, similar to the S. aureus isolates suspended in PBS (see Fig. 3), the T-line signal development from IS samples was obviously disrupted (Fig. 5A). RSI (%) values for IS samples at 10 7 and 10 8 CFU/ mL were approx. 30–35% lower than those of the BAL samples and S. aureus isolates in PBS (Fig. 5B). Interestingly, all 3 IS samples showed a strong positive C-line signal (4941 ± 156 au) very similar to the

average C-line values for all other tests (4947 ± 136 au) (P = 0.4), indicating that binding of the IgG secondary antibody to MAbS at the C line was not impaired. It may be therefore inferred that IS sample components specifically disrupted 1) the initial antigen–MAbS binding in the conjugate pad, 2) the binding of the antigen–conjugate complex to the MAbS at the T line, or 3) both.

3.3. Evaluation of endogenous S. aureus in respiratory samples from severe asthmatic patients The same clinical samples were also evaluated for endogenous S. aureus by both LFI and qPCR. All samples tested positive for S. aureus as measured by qPCR and contained cell loads ranging from approximately 3.5 × 10 3 to 1.5 × 10 6 CFU/mL, with a mean load of 4.5 × 10 5 CFU/mL (Table 2). Only 1 IS sample from volunteer S17 showed an S. aureus burden just at the test strip detection limit (1.5 × 10 6 CFU/mL) as measured by qPCR. Encouragingly, LFI analysis of the samples matched the qPCR data (Fig. 6A and B) and a standard culture test for this sample showed only oral flora (data not shown). The IS sample S17 developed a weak signal at the T line with a similar (albeit slightly lower) RSI (%) value (33.6%) to that of IS samples spiked with S. aureus isolates at 10 6 CFU/mL (39.8 ± 2.1%). The average RSI (%) values of the 5 other samples with endogenous S. aureus burdens b10 6 CFU/mL (5.2 ± 0.5%) were slightly higher than the average of S. aureus isolates (10 0–10 5 CFU/mL in PBS; 3.6 ± 0.5%), indicating that the background noise of clinical samples may be elevated, but will not

S. Wiriyachaiporn et al. / Diagnostic Microbiology and Infectious Disease 75 (2013) 28–36

33

Fig. 5. (A) Visual assessment of the IC test strips after the application of unprocessed BAL and processed IS samples spiked with 106–108 CFU/mL S. aureus. (B) RSI (%) values confirmed the detection limit of IC test strips to be at 106 CFU/mL, but also showed significantly lower T-line signals in tests exposed to IS samples spiked with N107 CFU/mL S. aureus, indicating that IS sample components interfered with the signal development.

significantly affect test performance or contribute to false positives due to nonspecific signal development.

4. Discussion The LFI test system developed in the current study has been designed to include several advanced features compared to previous published systems. Whereas previous systems have targeted secreted bacterial proteins, such as protein A (Huang, 2006), the antigen chosen for the current LFI system is S. aureus–specific peptidoglycan. Peptidoglycans are the primary components of the murein sacculus, an exoskeleton-like structure of nearly all eubacteria, which provides structural stability against osmotic pressure (Vollmer and Höltje,

Table 2 Determination of S. aureus concentrations present in 6 respiratory samples obtained from severe asthmatic patients by qPCR. The mean values ± SD of n = 3 measurements are listed. Sample number

Sample type

Mean S. aureus load in CFU/mL ± SD

S39 S40 S45 S17 S20 S23

BAL BAL BAL IS IS IS

1.05 3.41 6.84 1.50 9.16 9.58

× × × × × ×

105 103 104 106 105 104

± ± ± ± ± ±

1.75 1.72 4.60 1.01 1.46 3.77

× 104 × 103 × 104 × 105 × 105 × 104

2004). Peptidoglycan is the most conserved component of the Grampositive wall, consisting of glycan strands of 2 alternating sugar derivatives, N-acetylglucosamine and N-acetylmuramic acid, which form a dissacharide subunit. The carboxyl group of N-acetylmuramic acid is linked to an S. aureus–specific peptide subunit (known as stem peptides or muropeptides) consisting of (l-Ala-d-iGln-l-Lys(Gly5)-dAla). Whereas the structure of the glycan chains is highly conserved, the composition of the stem peptide varies between bacterial species. Gram-positive cocci such as S. aureus have l-lysine in position 3 of the muropeptide, which is cross-linked with an interpeptide bridge consisting of pentaglycine (DeDent et al., 2007; Labischinski and Maidhof, 1994). Mutations leading to slight variations within the peptidoglycan structure (both crossbridge and muropeptide compositions) can occur in different strains of S. aureus, such as the MRSA strain, RUSA208, which contains variations to the muropeptide structure (Ornelas-Soares et al., 1993). Our studies show crossreactivity of the antibody between MSSA and MRSA strains tested, indicating that the antibody can robustly identify S. aureus despite the strain, although studies with a wider selection of strains would be required to confirm this. A further interesting idea would be to explore the possibility of generating monoclonal antibodies against MRSA-specific peptidoglycan mutants to create a rapid test system that may also distinguish between S. aureus and MRSA. An advantage of using a monoclonal antibody raised against the S. aureus peptidoglycan antigen lies in the capability of detecting whole cells within a clinical sample and thus enabling both a semiquantitative determination in colony-forming units per millilitre of bacterial burdens within a given clinical sample and also a direct

34

S. Wiriyachaiporn et al. / Diagnostic Microbiology and Infectious Disease 75 (2013) 28–36

Fig. 6. (A) Visual assessment of LFI test strips after the application of clinical samples from severe asthmatics. Only sputum sample S17 showed a weak signal at T line, while other samples showed no T-line signal. (B) RSI (%) values of clinical samples from severe asthmatics.

comparison with other standard culture-based or molecular diagnostic techniques. In comparison, systems that detect secreted proteins are limited to a semi-quantitative analysis of the antigen concentration (usually in nanograms per millilitre), which is then difficult to relate to clinically relevant bacterial burdens. The LFI strip was shown to be specific and sensitive to S. aureus isolates with visible signal development at 10 6 CFU/mL and higher. This information implies that the system in its current form may be used for the diagnosis of S. aureus infections with bacterial burdens ≥10 6 CFU/mL, provided that the sample matrix does not interfere with the assay functionality. Other studies developing similar LFI systems for detection of pathogens such as Vibrio harveyi, Streptococcus suis, and Mycobacterium tuberculosis complex (Sithigorngul et al., 2007; Ju et al., 2010; Park et al., 2009) have reported comparable detection limits ranging from 10 5 to 10 7 CFU/mL (using suspensions of clinical isolates). This study demonstrated that LFI signal development can be impaired in certain cases by sample matrix components or sample processing. The use of IS for identification of biomarkers of respiratory disease, especially those affecting the upper airways, is being increasingly investigated due to the noninvasive nature of sample collection. One major disadvantage of using IS samples for diagnostic purposes is the complex, viscous nature of the sample, which inevitably requires further processing. In this study, it could be shown that, although IS sample processing with Sputasol™ did not affect the actual test functionality (as shown by the development of a strong C-line signal), the T-line signal development was impaired. As previously mentioned, this may be due to IS matrix components which block the binding of the antigen to the capture and detection antibodies. To determine whether a detection limit of 10 6 CFU/mL is clinically relevant, the literature was evaluated for data on bacterial burdens in a variety of respiratory conditions. A number of studies have reported detectable levels of S. aureus infection in cystic fibrosis (CF), bronchitis, and pneumonia patients at both higher and lower than

10 6 CFU/mL. For example, Corne et al. (2005) reported 10 2–10 6 CFU/ mL S. aureus in BAL and 10 6–10 9 CFU/mL in tracheobronchial fluid samples from patients with pneumonia and bronchitis, respectively. Wong et al. (1984) detected S. aureus at 10 5–10 7 CFU/g sputum in specimens derived from CF children on regular visits to the CF clinic or admitted to hospital. An individual case report by Wellinghausen et al. (2005) also found S. aureus at 10 6 CFU/mL in sputum from a clinically well CF patient. It should be noted that, in nearly all cases, the bacterial burdens were quantified using standard culture techniques. However, where qPCR assay is accessible, similar levels of bacterial burdens were also reported. For example, Zemanick et al. (2010) reported the detection of S. aureus at 10 5–10 6 CFU/mL in CF airway specimens using qPCR. Looking beyond respiratory disease, Huggan et al. (2008) reported S. aureus levels of N10 5 CFU/mL in urine samples derived from S. aureus–associated bacteraemia patients. It has also been shown that food samples contaminated with S. aureus at loads N10 6–10 8 CFU/g are sufficient to cause food-borne outbreaks (Alarcon et al., 2006). Similarly, a report by Kumar et al. (2006) detected levels of 10 6–10 8 CFU/g staphylococcal species in fruit chat (a regional dish similar to fruit salad) collected in Patiala, India. Although the examples listed above cite bacterial burdens that are in the general range of the limit of detection for the current LFI test, it is recognised that the test sensitivity should be much lower (≥10 4 CFU/mL) for widespread clinical implementation (Choi et al., 2010; Posthuma-Trumpie et al., 2009). Improvements in the test sensitivity would allow physicians to make more informed decisions on antibiotic prescribing at the bedside, while the test in its current form can only confirm that S. aureus burdens are ≥10 6 CFU/mL. Several strategies can be explored to increase the sensitivity of the LFI assay. For example, Choi et al. (2010) recently reported the use of a dual-label LFI assay similar to the one developed in this study, but with 100-fold enhanced detection compared to a single-label system (as used here). In the dual-label system, small gold nanoparticles (10 nm) were labeled with both capture antibodies and bovine serum

S. Wiriyachaiporn et al. / Diagnostic Microbiology and Infectious Disease 75 (2013) 28–36

albumin (BSA). Upon interaction with the antigen, the antigen– capture antibody/BSA–gold nanoparticle complex travelled to the detection line (T line), where it was detained by the detection antibody. Simultaneously, the sample fluid carried a second label composed of 40-nm gold nanoparticles modified with anti-BSA antibodies. The second label was designed to bind to the immobilised antigen–capture antibody/BSA and intensify the signal at the T line. As stated above, this strategy achieved a 100-fold enhancement of the signal intensity. Other labeling strategies that use fluorescence or chemiluminescence for signal development have been shown to enhance test sensitivity sometimes by 3 orders of magnitude, although the requirement of specialised readout equipment may increase the cost and limit the usefulness of such systems (Gordon and Michel, 2008; Posthuma-Trumpie et al., 2009). A final point that merits further discussion is how LFI assays compare with standard culture techniques, alternative rapid detection assays, and molecular diagnostic techniques in development for clinical use. As stated previously, standard culture-based techniques are not only time consuming, but they also have the drawback of selectively representing only a small fraction of the bacteria in a given community depending on the culture conditions selected (Amann et al., 1995; Posthuma-Trumpie et al., 2009). Thus, in comparison to cultured-based methods, the LFI assay provides a significant advantage by enabling a direct, semi-quantitative determination of the actual S. aureus burden present within the clinical sample at the point of care. However, the LFI assay is limited in the number of pathogens that may be detected simultaneously using 1 test. A multifunctional LFI assay, which could diagnose the presence of 2 or more pathogens, would thus be more useful. Finally, in contrast to standard culture techniques, it is not possible to identify new strains of pathogens with an LFI assay, but only screen for targeted pathogens (PosthumaTrumpie et al., 2009). Molecular diagnostic techniques, such as qPCR, are ideal both for qualitative and for quantitative analysis of pathogens in clinical samples. Such methods have a very low limit of detection (e.g., ~10 3 CFU/g faeces and 10 1–10 2 CFU/mL blood; Matsuda et al., 2007) and can simultaneously detect a large number of species in a sample. However, as stated previously, molecular techniques require expensive equipment, highly skilled personnel, and extensive validation protocols for routine use in the clinic (Murphy and Bustin, 2009; Speers, 2006). Finally, species-specific tests such as the coagulase test for Staphylococcus aureus (HPA, 2007; Kateete et al., 2010) are more comparable to the LFI test described in this study with respect to the fact that they have been designed as rapid point-of-care diagnostic tools, are inexpensive, and are easy to use. However, Kateete et al. (2010)) have highlighted that no single version of the S. aureus coagulase test can provide reliable results for all clinical samples due to the variation in coagulase properties of plasma from different species, as well as the discovery that some species of Staphylococci may display atypical characteristics, which confound the test (e.g., production of a clumping factor by coagulase-negative Staphylococci or the presence of clumping factor–negative/tube coagulase–positive non-Staphylococci species, both of which result in false-positive outcomes). Thus, considering both the advantages and drawbacks of a variety of assays currently in development for rapid point-of-care diagnostics, LFI assays in general and more specifically LFI assays for S. aureus utilising anti-peptidoglycan–targeting principles for detection may be promising tools (following optimisation) to achieve sensitive and specific detection of S. aureus from clinical samples. 5. Conclusions The LFI assay developed in this study successfully provided specific, semi-quantitative point-of-care diagnosis of S. aureus bacterial burdens ≥10 6 CFU/mL present in BAL and IS samples taken from severe asthmatic patients. The LFI provided accurate and

35

reproducible results, not only when the sample fluids were spiked with clinical bacterial isolates, but also in 1 clinical sample that contained an endogenous S. aureus burden of 1.5 × 10 6 CFU/mL (as determined by qPCR). T-line signal detection was shown to be compromised in IS samples as a result of either sample viscosity or addition of Sputasol™, an issue that is currently being addressed by further optimisation. Literature research showed that an LFI detection limit of ≥10 6 CFU/mL may be sufficiently sensitive to screen for preliminary information in a number of applications, but LFI tests with lower detection limits (≥10 4 CFU/mL) would be more clinically relevant. Further studies are currently ongoing to lower the detection limits of the LFI test and evaluate the robustness of the assay for a number of different applications. Acknowledgments The authors thank Dr. Mary Carrol, Dr. Ben Green, and Dr. Valia Kehakia, Southampton University Hospital, UK, for provision of clinical samples, and Dr. Peter Marsh, Health Protection Agency, Southampton, UK, for qPCR work. References Alarcon B, Vicedo B, Aznar R. PCR-based procedures for detection and quantification of Staphylococcus aureus and their application in food. J Appl Microbiol 2006;100: 352–64. Amann RI, Ludwig W, Schleifer KH. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev 1995;59:143–69. British Thoracic Society Scottish Intercollegiate Guidelines Network. British guidelines on the management of asthma. Thorax 2008;63:iv1-iv121. Cals JW, Schot MJ, de Jong SA, Dinant GJ, Hopstaken RM. Point-of-care C-reactive protein testing and antibiotic prescribing for respiratory tract infections: a randomized controlled trial. Ann Fam Med 2010;8:124–33. Corne P, Marchandin H, Jonquet O, Campos J, Banuls A-L. Molecular evidence that nasal carriage of Staphylococcus aureus plays a role in respiratory tract infections of critically ill patients. J Clin Microbiol 2005;43:3491–3. Choi DH, Lee SK, Oh YK, Bae BW, Lee SD, Kim S, et al. A dual gold nanoparticle conjugatebased lateral flow assay (LFA) method for the analysis of troponin I. Biosens Bioelectron 2010;25:1999–2002. Efthimiadis A, Spanevello A, Hamid Q, Kelly MM, Linden M, Louis R, et al. Methods of sputum processing for cell counts, immunocytochemistry and in situ hybridization. Eur Respir J 2002;20:19s–23s. DeDent AC, McAdow M, Schneewind O. Distribution of protein A on the surface of Staphylococcus aureus. J Bacteriol 2007;189:4473–84. Gordon J, Michel G. Analytical sensitivity limits for lateral flow immunoassays. Clin Chem 2008;54:1250–1. Health Protection Agency. Coagulase test. National Standard Method BSOP TP 10 Issue 4.1. Available online: http://www.hpa.org.uk/webc/HPAwebFile/HPAweb_C/ 1309970088521. accessed 17 June 2012. Huang S-H. Gold nanoparticle-based immunochromatographic test for identification of Staphylococcus aureus from clinical sp ecimens. Clin Chim Acta 2006;373:139–43. Huggan PJ, Murdoch DR, Gallagher K, Chambers ST. Concomitant Staphylococcus aureus bacteriuria is associated with poor clinical outcome in adults with S. aureus bacteraemia. J Hosp Infect 2008;69:345–9. Ju Y, Hao H-J, Xiong G-H, Geng H-R, Zheng Y-L, Wang J, et al. Development of colloidal gold-based immunochromatographic assay for rapid detection of Streptococcus suis serotype 2. Vet Immunol Immunopathol 2010;133:207–11. Kumar M, Agarwal D, Ghosh M, Ganguli A. Microbiological safety of street vended fruit chats in Patiala city. Indian J Med Microbiol 2006;24:75–6. Kateete DP, Kimani CN, Katabazi FA, Okeng A, Okee MS, Nanteza A, et al. Identification of Staphylococcus aureus: DNase and mannitol. Ann Clin Microbiol Antimicrob 2010;9: 23. Labischinski H, Maidhof H. Bacterial peptidoglycan: overview and evolving concepts. In: Ghuysen J-M, Hakenbeck R, editors. Bacterial cell wall. The Netherlands: Elsevier, Amsterdam; 1994. p. 23–38. Matsuda K, Tsuji H, Asahara T, Kado Y, Nomoto K. Sensitive quantitative detection of commensal bacteria by rRNA-targeted reverse transcription-PCR. Annl Environ Microbiol 2007;73:32–9. Murphy J, Bustin SA. Reliability of real-time reverse-transcriptase PCR in clinical diagnostics: gold standard or substandard? Exp Rev Mol Diagn 2009;9:187–97. Nakasone N, Toma C, Lu Y, Iwanaga M. Development of a rapid immunochromatographic test to identify enteropathogenic and enterohemorrhagic Escherichia coli by detecting EspB. Diagn Micr Infect Dis 2007;57:21–5. Ornelas-Soares A, de Lencastre H, de Jonge B, Gage D, Chang YS, Tomasz A. The peptidoglycan composition of a Staphylococcus aureus mutant selected for reduced methicillin resistance. J Biol Chem 1993;268:26268–72. Park MY, Kim YJ, Hwang SH, Kim HH, Lee EY, Jeong SH, et al. Evaluation of an immunochromatographic assay kit for rapid identification of

36

S. Wiriyachaiporn et al. / Diagnostic Microbiology and Infectious Disease 75 (2013) 28–36

Mycobacterium tuberculosis complex in clinical isolates. J Clin Microbiol 2009;47:481–4. Pizzichini E, Pizzichini MMM, Efthimiadis A, Hargreave FE, Dolovich J. Measurement of inflammatory indices in induced sputum: effects of selection of sputum to minimize salivary contamination. Eur Respir J 1996;9:1174–80. Posthuma-Trumpie GA, Korf J, van Amerongen A. Lateral flow (immuno)assay: its strength, weaknesses, opportunities, and threats. A literature survey. Anal Bioanal Chem 2009;393:569–82. Ranjard L, Poly F, Nazaert S. Monitoring complex bacterial communities using cultureindependent molecular techniques: application to soil environment. Res Microbiol 2000;151:167–77. Rasband WS. ImageJ. Maryland: U.S. National Institutes of Health; 1997. http://rsb.info. nih.gov/ij/. Rogers GB, Carroll MP, Seriser DJ, Hockey PM, Jones G, Bruck KD. Characterization of Bacterial Community Diversity in Cystic Fibrosis Lung Infections by Use of 16S Ribosomal DNA Terminal Restriction Fragment Length Polymorphism Profiling. J Clin Microbiol 2004;42(11):5176–83. Saeed K, Ahmad N, Pallett A, Guiver M, Marsh P. Specific staphylococcal polymerase chain reaction can be a complementary tool for identifying causative organisms and guiding antibiotics management in orthopaedic infections. Curr Orthop Pract 2010;21:628–31.

Sithigorngul P, Rukpratanporn S, Pecharaburanin N, Suksawat P, Longyant S, Chaivisuthangkura P, et al. A simple rapid immunochromatographic test strip for detection of pathogenic isolates of Vibrio harveyi. J Microbiol Methods 2007;71:256–64. Song JH, Chung DR. Respiratory infections due to drug-resistant bacteria. Infect Dis Clin North Am 2010;24(3):639–53. Speers DJ. Clinical applications of molecular biology for infectious diseases. Clin Biochem Rev 2006;27:39–51. Sturenburg E, Junker R. Point-of-care testing in microbiology. Dtsch Arztebl Int 2008;106:48–54. Vollmer W, Höltje JV. The architecture of the murein (peptidoglycan) in Gram-negative bacteria: vertical scaffold or horizontal layer(s)? J Bacteriol 2004;186:5978–87. Wellinghausen N, Essig A, Sommerburg O. Inquilinus limosus in patients with cystic fibrosis, Germany. Emerg Infect Dis 2005;11:457–9. Wong K, Roberts MC, Owens L, Fife M, Smith AL. Selective media for the quantitation of bacteria in cystic fibrosis sputum. J Med Microbiol 1984;17:113–9. World Health Organization. The global burden of disease: 2004 update. Geneva, Switzerland: WHO; 2008. Accessed 01 June 2012. Available online: http://www. who.int/healthinfo/global_burden_disease/GBD_report_2004update_full.pdf. Zemanick ET, Wagner BD, Sagel SD, Stevens MJ, Accurso FJ, Harris JK. Reliability of quantitative real-time PCR for bacterial detection in cystic fibrosis airway specimens. PLoS One 2010;5:e15101. http://dx.doi.org/10.1371/journal.pone.0015101.