Evaluation of ABC efflux transporters genes expression in kidney of rainbow trout (Oncorhynchus mykiss) fed with melamine and cyanuric acid diets

Chemosphere 84 (2011) 727–730

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Short Communication

Evaluation of ABC efflux transporters genes expression in kidney of rainbow trout (Oncorhynchus mykiss) fed with melamine and cyanuric acid diets Alessandro Benedetto a,⇑, Stefania Squadrone a, Marino Prearo b, Antonia Concetta Elia c, Ilaria Giorgi b, Maria Cesarina Abete a a b c

C.Re.A.A. – National Reference Center for the Surveillance and Monitoring of Animal feed, Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle D’Aosta, 10154 Turin, Italy Fish Diseases Laboratory, Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle D’Aosta, 10154 Turin, Italy Ecotoxicology Laboratory, Department of Cellular and Environmental Biology, University of Perugia, 06123 Perugia, Italy

a r t i c l e

i n f o

Article history: Received 20 December 2010 Received in revised form 31 March 2011 Accepted 7 April 2011 Available online 5 May 2011 Keywords: Melamine Cyanuric acid ABC efflux transporters Rainbow trout mRNA expression DDCT method

a b s t r a c t Gene expression experiments were targeted in order to monitor the ABC efflux transporters, which is potentially involved in cellular detoxification/defense. Changes in expression levels of different ABC genes in kidney of Oncorhynchus mykiss fed with melamine and melamine + cyanuric acid enriched diets were recorded in both treated groups by mRNA DDCT relative quantification method. Expression profiles of eight different ABC genes basically showed low alterations in melamine group and more consistent changes in melamine + cyanuric acid treated fish, compared with own control. In the last group ABCC2 gene over expression was the more evident alteration. These results suggest that ABC efflux system could be involved in mobilization of hydrophilic molecules in the forcing condition of chronic exposure. Ó 2011 Elsevier Ltd. All rights reserved.

1. Introduction European Food Safety Authority (EFSA) Scientific Opinion on Melamine in Food and Feed, has recently highlighted the effects of melamine exposure in humans, pets, and several other species, including fish. Melamine is not metabolized in liver and is normally rapidly eliminated in the urine. In particular, co-exposure to melamine and cyanuric acid of fish showed higher toxicity compared with melamine or cyanuric acid alone. These effects are caused by crystal formation distributed throughout the renal tubules and collecting duct system (Reimschuessel et al., 2008; Chen et al., 2009). The toxic mechanism seems similar to acute uric acid nephropathy in humans (Reimschuessel et al., 2010). The active efflux of organic compounds, such as melamine and cyanuric acid, could play a primary role in the cellular resistance mechanism. In particular, ABC transporters are described as being involved in many xenobiotic effluxes and their roles in cellular detoxification/defense are well known. The characterization of ABC efflux genes in rainbow trout (Oncorhynchus mykiss) was de-

⇑ Corresponding author. Tel./fax: +39 011 2686228. E-mail addresses: [email protected], [email protected] (A. Benedetto), [email protected] (M. Prearo), [email protected] (A.C. Elia) . 0045-6535/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.chemosphere.2011.04.028

scribed by Zaja et al. (2008) and recently quantified in trout tissues by Loncar et al. (2010). Since works are scanty on melamine and cyanuric acid toxicity in fish (EFSA, 2010), a relative RNA quantification approach on kidney of trout fed for ten weeks with melamine (ME, 1000 mg kg1) and melamine and cyanuric acid (ME + CA, 1000 mg kg1) enriched diets, was chosen to detect possible changes in ABC efflux transporters expression. The aim was to investigate if ABC active efflux system could be involved in the development of toxic effects of melamine and melamine associated to cyanuric acid. To verify this hypothesis a gene expression experiment targeted to quantified alteration in mRNA levels of different ABC transporters was performed on rainbow trout fed with melamine and coadministration of 1:1 ratio of melamine and cyanuric acid diets. 2. Materials and methods Rainbow trout (mean weight 180 g and mean length 25 cm), were acclimatized for two weeks in 10 000 L tanks prior to treatment. The study was carried out on three groups (five fish for each group) for ten weeks: one was fed with melamine diet (1000 mg kg1), the other was fed with co-exposure of melamine (1000 mg kg1) and cyanuric acid (1000 mg kg1) diet and trout fed with uncontaminated feedstuff were used as control. Diets

728

A. Benedetto et al. / Chemosphere 84 (2011) 727–730

Table 1 Primer sequences, their optimal concentrations and amplicon lengths used in the gene expression quantification using qRT-PCR. Target

Sense (50 –30 )

Antisense (50 –30 )

Optimal conc. (nM)

Amplicon length (bp)

GAPDH EF 1A B2M HPRT ATUB G6PD BACT

ATGACCACTCCATCTCCGTATTC TCTGCCCCTCCAGGATGTC AAGAGTGTTGGATTCACACCAGC GGCTACACACCAGACTTCATAGGA GAACCAACTGTTGTTGATGAGGTTC CCCTATATGAAGGTGGCAGACTCT CTCCTTCCTCGGTATGGAGTCTT

ACGACGTAATCGGCACCG TGGTGACATTAGCGGGGG GCTCCAGATCCTTACATATCTGCC GAAGTACTCGTTGTAGTCTAGCGCATAT GTGCACTGGTCCGACAGCTT GGCGTACTTCCCACTGACATAAG ACAGCACCGTGTTGGCGT

250/300 200/200 200/250 250/250 200/200 300/350 300/300

78 bp 123 bp 110 bp 61 bp 178 bp 84 bp 106 bp

offered to trout was 1.5% body weight day1. The experimental diets had the same composition: fish meal, barley and soybeans meal corn gluten meal, cod liver oil vitamin supplement, mineral supplement and binder. After 10 weeks exposure all fish of either treated and control groups were caught and euthanized with a lethal overdose of MS 222 (250 mg/L) (Sigma–Aldrich, St.Louis, MO, USA). The experiments were conducted in accordance with the European and national guidelines (European Commission, Directive 86/ 609//EC and Italian Directive 116/1992, respectively). Total RNA was isolated from kidney samples of all groups previously stored in RNA-Later solution (Ambion, Austin, TX, USA). RNA extraction was performed using Qiagen RNeasy Plus MiniKit (Qiagen, Basel, Switzerland) according to the manufacturer’s protocol. Extracted RNA was treated with Turbo DNAse kit (Ambion) to avoid any traces of genomic DNA. Extracted RNA in all samples was quantified by fluorimetric analyses using Q-bit HS-RNA assay (Invitrogen, Carlsbad, CA, USA). One lg of RNA from each sample was transcribed to cDNA using High Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Foster City, CA, USA). For a proper relative quantification of target genes using DDCT method (Livak and Schmittgen, 2001) it is recommended to take into consideration multiple reference genes when determining expression levels. A preliminary experiment based on a panel of specific housekeeping genes was performed to define the most stable gene or the best combination of reference genes allowing a robust normalization of ABC expression levels. All primers were designed using Primer express 3.0 software (Applied Biosystems). Primer concentrations for housekeeping genes were optimized for each assay analyzing fluorescence signals on positive and negative control samples with serial primer dilutions, choosing concentrations resulting in the highest fluorescence signal at the lowest Ct number with the expected melting curve profile. Primer sequences, optimal concentrations and amplicon lengths are reported in Table 1. Primer concentrations for ABC efflux genes were adopted according to Loncar et al. (2010). Real time PCR amplification (qRT-PCR) was performed on an Applied Biosystems Step One Plus analyzer with Fast SYBR Green PCR master mix (Applied Biosystems). The reaction mix was based on 10 lL of SYBR Green 2X reaction mix, a final concentration of each ABC efflux targets primer as described by Loncar et al. (2010), or 200 nM of each primer for EF target, 2 lL of cDNA template and nuclease free water needed to reach 20 ll final reaction volume. The run method was set with a starting holding stage at 95 °C for 20 s, 40 cycles of amplification carried out with denaturation at 95 °C for 3 s, annealing and elongation at 60 °C for 30 s, followed by a melting curve analysis. A relative standard curve experiment on seven different housekeeping genes (five serial tenfold dilutions of kidney cDNA) was performed to estimate PCR efficiency (Fig. 1). The reaction specificity on different housekeeping genes was verified by melting curve profile analysis (Fig. 2).

Fig. 1. Housekeeping genes standard curve experiment on tenfold serial dilution of kidney cDNA samples: Ct values were plotted versus the DNA concentration, maintaining linearity (3.468 < slope < 3.281) and good amplification efficiency in the range of dilution samples.

3. Results and discussion Analysis with different VBA applets like GeNorm (Vandesompele et al., 2002) and BestKeeper (Pfaffl et al., 2004) on treated (melamine and melamine + cyanuric acid samples) and control samples defined the EF target as the most stable endogenous control in our samples data set (data not shown). As previously reported in other salmonid related species (Olsvik et al., 2005), EF-1A and EF-1B were ranked as the most stable housekeeping genes. In order to contain confounding variance, caused by both inter subject variance (different responses to treatment, different baseline expressions of genetic targets) and the processing variance caused by sampling procedures, RT step and qPCR amplification, we adopted a larger number of biological and technical replicates for both treated and untreated groups as suggested by Tichopad et al. (2009).

A. Benedetto et al. / Chemosphere 84 (2011) 727–730

729

Fig. 3. Relative ABC transporters expression profiles on melamine group (1000 mg kg1), melamine plus cyanuric acid (ME + CA, 1000 mg kg1 each) group and control. Expression level for each target in untreated group was arbitrarily set to value 1 and then compared with both treated groups.

Fig. 2. Housekeeping genes melt curves: the melting profile and temperature for each assay showed assays specificity.

Ct values from amplification plots and relative quantification results with the application of DDCT method were obtained with Step One Software 2.1 (Applied Biosystems). Expression profiles of eight different ABC genes (Fig. 3) basically showed low alterations in ME group and more consistent changes in ME + CA group, compared with own control. As shown in Fig. 3 the major upregulation event was the alteration of the ABCC2 gene confirmed in both treated groups, with higher expression levels in the ME + CA (more than double RQ values). ABCG2 and ABCC4 showed lower upregulation in the treated ME and ME + CA groups. ABCC5 was slightly down expressed in the ME and ME + CA groups. Other ABC targets such as ABCC1 showed a down-regulation in the ME group in contrast with a lower increase of expression in the ME + CA group. ABCB11 expression, which is known to be a characteristic liver transporter, related to the efflux of bile salts from hepatocytes into bile (Loncar et al., 2010), was detected at very low expression in kidney of all three experimental groups. However, among all ABC transporters analyzed, ABCB11 expression evidenced the highest standard deviation values of all treated and untreated groups (Fig. 3). The detoxification mechanism mediated by ABC efflux transporters is usually activated in order to reduce the compounds accumulation and their toxic effects in cytosol of exposed cell. Therefore, this mechanism could also happen for melamine and combination of melamine and cyanuric acid. On the other hand, the active efflux could contribute to the accumulation of melamine–cyanuric acid complexes in tubular ducts. The alteration in ABC efflux genes tested (the most evident is the ABCC2 upregulation) also suggests that the active efflux systems could be involved in detoxification of melamine and cyanuric

acid complexes. This process could eventually lead to crystal precipitation/accumulation in tubular ducts. Intratubular melamine-cyanurate crystal spherulite formation causes obstruction and subsequent acute renal failure, through a mechanism similar to the uric acid nephropathy (Reimschuessel et al., 2010). The evaluation of intratubular melamine-cyanurate crystal formation, causing obstruction and subsequent nephropathy, was performed by ‘‘wet-mount’’ microscopy analysis on kidney samples according to Reimschuessel et al. (2008). Melamine-cyanurate crystals were observed only in kidney of trout fed with melamine + cyanuric acid (ME + CA) diet (data not shown). Most likely, melamine + cyanuric acid co-exposure tends to form complexes in kidney, less soluble than melamine or cyanuric acid alone. Therefore, the observed disturbance on efflux system, such as ABC transporters, in fish treated with coadministration of melamine and cyanuric acid, could play an important role in the development of toxic effects, thus leading to selective accumulation of crystal complexes in renal ducts, together with an expected passive/gradient efflux of more soluble separated compounds. In conclusion, unreported novel changes in mRNA transcription of ABC transporters related to melamine and melamine + cyanuric acid exposure have been demonstrated, mainly for ABCC2 gene. Significative upregulation of ABCC2 expression was recently found in kidney of zebrafish exposed to sodium arsenate, cadmium, mercury, lead and different hydrophilic compounds, thus evidencing the importance of ABCC2 expression also in heavy metal detoxification process (Long et al., 2011). Therefore the results of the present study indicate that ABC efflux system could be involved in mobilization of hydrophilic molecules in the forcing condition of chronic exposure. Among the observed alterations in mRNA transcription of different ABC transporters, ABCC2 upregulation could be considered as valid tool in kidney of rainbow trout for melamine and cyanuric acid chronic exposure studies. References Chen, K.C., Liao, C.W., Cheng, F.P., Chou, C.C., Chang, S.C., Wu, J.H., Zen, J.M., Chen, Y.T., Liao, J.W., 2009. Evaluation of subchronic toxicity of pet food contaminated with melamine and cyanuric acid in rats. Toxicol. Pathol. 37, 959–968.

730

A. Benedetto et al. / Chemosphere 84 (2011) 727–730

EFSA, 2010. Scientific Opinion on Melamine in Food and Feed. EFSA Journal 2010 8 (4):1573 8, 145. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Loncar, J., Popovic, M., Zaja, R., Smital, T., 2010. Gene expression analysis of the ABC efflux transporters in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. C 151, 209–215. Long, Y., Li, Q., Zhong, S., Wang, Y., Cui, Z., 2011. Molecular characterization and functions of zebrafish ABCC2 in cellular efflux of heavy metals. Comp. Biochem. Physiol. C: 153, 381–391. Olsvik, P.A., Lie, K.K., Jordal, A.E., Nilsen, T.O., Hordvik, I., 2005. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon. BMC Mol. Biol. 6, 21. Pfaffl, M.W., Tichopad, A., Prgomet, C., Neuvians, T.P., 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper – excel-based tool using pair-wise correlations. Biotechnol. Lett. 26, 509–515. Reimschuessel, R., Gieseker, C.M., Miller, R.A., Ward, J., Boehmer, J., Rummel, N., Heller, D.N., Nochetto, C., de Alwis, G.K., Bataller, N., Andersen, W.C., Turnipseed,

S.B., Karbiwnyk, C.M., Satzger, R.D., Crowe, J.B., Wilber, N.R., Reinhard, M.K., Roberts, J.F., Witkowski, M.R., 2008. Evaluation of the renal effects of experimental feeding of melamine and cyanuric acid to fish and pigs. Am. J. Vet. Res. 69, 1217–1228. Reimschuessel, R., Evans, E., Andersen, W.C., Turnipseed, S.B., Karbiwnyk, C.M., Mayer, T.D., Nochetto, C., Rummel, N.G., Gieseker, C.M., 2010. Residue depletion of melamine and cyanuric acid in catfish and rainbow trout following oral administration. J. Vet. Pharmacol. Ther. 33, 172–182. Tichopad, A., Kitchen, R., Riedmaier, I., Becker, C., Stahlberg, A., Kubista, M., 2009. Design and optimization of reverse-transcription quantitative PCR experiments. Clin. Chem. 55, 1816–1823. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3, 7, research 0034.1-0034.12. Zaja, R., Munic, V., Klobucar, R.S., Ambriovic-Ristov, A., Smital, T., 2008. Cloning and molecular characterization of apical efflux transporters (ABCB1, ABCB11 and ABCC2) in rainbow trout (Oncorhynchus mykiss) hepatocytes. Aquat. Toxicol. 90, 322–332.