- Email: [email protected]
Evaluation of an in-house genotyping resistance test for HIV-1 drug resistance interpretation and genotyping
Journal of Clinical Virology 39 (2007) 125–131
Evaluation of an in-house genotyping resistance test for HIV-1 drug resistance interpretation and genotyping J.H.K. Chen a , K.H. Wong b , K. Chan b , H.Y. Lam a , S.S. Lee c , P. Li d , M.P. Lee d , D.N. Tsang e , B.J. Zheng a , K.Y. Yuen a , W.C. Yam a,∗ a Department of Microbiology, The University of Hong Kong, Hong Kong, SAR, China Integrated Treatment Centre, Special Preventive Programme, Centre of Health Protection, Department of Health, Hong Kong, SAR, China Centre of Emerging Infectious Diseases, The Chinese University of Hong Kong, Hong Kong, SAR, China d Department of Medicine, The Queen Elizabeth Hospital, Hong Kong, SAR, China e Department of Pathology, The Queen Elizabeth Hospital, Hong Kong, SAR, China b
c
Received 7 October 2006; received in revised form 22 February 2007; accepted 12 March 2007
Abstract Introduction: The human immunodeficiency virus type 1 (HIV-1) genotyping resistance test (GRT) has been considered essential for HIV-1 drug resistance monitoring. However, it is not commonly used in some developing countries in Asia and Africa due to its high running cost. Objective: This study aims to evaluate a new low-cost in-house GRT for both subtype B and non-B HIV-1. Study design: The in-house GRT sequenced the entire protease and 410 codons of reverse transcriptase (RT) in the pol gene. Its performance on drug resistance interpretation was evaluated against the FDA-approved ViroSeqTM HIV-1 Genotyping System. Particularly, a panel of 235 plasma samples from 205 HIV-1-infected patients in Hong Kong was investigated. The HIV-1 drug resistance-related mutations detected by the two systems were compared. The HIV-1 subtypes were analyzed through the REGA HIV-1 Genotyping Tool and env phylogenetic analysis. Results: Among the 235 samples, 229 (97.4%) were successfully amplified by both in-house and ViroSeqTM systems. All PCR-negative samples harbored viral RNA at <400 copies/mL. The in-house and ViroSeqTM system showed identical drug resistance-related mutation patterns in 216 out of 229 samples (94.3%). The REGA pol genotyping results showed 93.9% (215/229) concordance with the env phylogenetic results including HIV-1 subtype A1, B, C, D, G, CRF01 AE, CRF02 AG, CRF06 cpx, CRF07 BC, CRF08 BC, CRF15 01B and other recombinant strains. The cost of running the in-house GRT is only 25% of that for the commercial system, thus making it suitable for the developing countries in Asia and Africa. Conclusions: Overall, our in-house GRT provided comparable results to those of the commercial ViroSeqTM genotyping system on diversified HIV-1 subtypes at a more affordable price which make it suitable for HIV-1 monitoring in developing countries. © 2007 Elsevier B.V. All rights reserved. Keywords: Genotyping resistance test; HIV-1; In-house; Drug resistance; CRF01 AE
1. Introduction The human immunodeficiency virus type 1 (HIV-1) genotyping resistance test (GRT) has been widely used to monitor the antiretroviral treatment on HIV-1 patients (Hirsch et al., 2000; EuroGuidelines for HIV Resistance, ∗
Corresponding author. Tel.: +852 28194821; fax: +852 28551241. E-mail address: [email protected] (W.C. Yam).
1386-6532/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2007.03.008
2001). This assay could provide early diagnosis of drug resistance in patients adhered to antiretroviral therapy and prevent the cause of treatment failure (Carpenter et al., 2000). In addition, GRT results would be an important factor for Highly Active Antiretroviral Therapy (HAART) regimen selection (Hirsch et al., 2000). Notably, although GRT is essential for HIV treatment, its high running cost hinders its diagnostic application in developing countries.
126
J.H.K. Chen et al. / Journal of Clinical Virology 39 (2007) 125–131
Most of the current FDA-approved antiretroviral drugs target the protease (PR) and reverse transcriptase (RT) of HIV-1. The currently available commercial genotyping resistance systems, such as the ViroSeqTM Genotyping System and TrugeneTM HIV-1 Genotyping System are based on sequencing the PR and RT region in the pol gene from plasma virus (Eshleman et al., 2004; Grant et al., 2003). The sequencing covering regions of the commercial systems included the whole PR and partial RT region (up to codon 335) in the pol gene, where the well-defined protease inhibitor (PI) and reverse transcriptase inhibitor resistance-related mutations are positioned (Eshleman et al., 2004; Johnson et al., 2006). In 2000, a novel T386I mutation in the RT region positioned beyond the commercial GRT sequencing covering region was identified in a few HIV-1 strains in Brazil. This mutation was found to abrogate the M184V suppression of L210W and L210W/G333D/E (Caride et al., 2000). Among all commercially available HIV-1 drug resistance interpretation systems, T386I was recognized as a drug resistance-associated mutation only in VircoTYPE HIV-1 analysis version 4.0.00 (Virco, Belgium). It is well known that commercial GRTs are optimized for subtype B strains while non-B strains are causing the major global pandemic. Other than HIV-1 subtype B, the circulating recombinant form AE (CRF01 AE), and subtype C is the prevalent strain circulating in Hong Kong and other Asian countries (Ariyoshi et al., 2003; McCutchan, 2006; Yam et al., 2006). Recent studies showed that the ViroSeqTM and TruGeneTM HIV-1 Genotyping Systems (Eshleman et al., 2004; Jagodzinski et al., 2003) are applicable to various HIV-1 subtypes; however, problems with non-B strains have occasionally been reported (Beddows et al., 2003; Fontaine et al., 2001; Mracna et al., 2001). In this regard, different in-house GRTs with low running cost have been designed (Lindstrom and Albert, 2003; Steegen et al., 2006) and they were found to have a high successful rate (>85.3%) of amplifying and sequencing subtype B and non-B HIV-1 samples (Steegen et al., 2006). However, their performance was not validated against internationally approved reference systems. Therefore, the aim of this study is to evaluate a costeffective in-house GRT for routine drug resistance-related mutation detection on genetic diversified HIV-1. The genotyping results of the in-house system were compared with those of the FDA-approved ViroSeqTM Genotyping System. The frequencies of T386I development among patients in Hong Kong were also investigated. Moreover, HIV-1 genotyping using the pol sequences was further evaluated.
Hong Kong between July 1996 and May 2005. Among the 235 samples, 143 were pre-treatment and 92 were posttreatment samples. Patient plasma separated from EDTA blood samples was stored at −80 ◦ C. The HIV-1 plasma viral loads (400 to 2 × 106 copies/mL) of all samples were monitored by the COBAS Amplicor HIV-1 Monitor Test version 1.5 with lower quantitation limit at 400 copies/mL (Roche Diagnostic Systems, 1996). 2.2. RNA extraction, RT-PCR amplification Total RNA was extracted from 420 L patient plasma using three times the volume of lysis buffer in the QIAamp Viral RNA Mini kit (Qiagen, Hilden, Germany). Viral RNA was eluted in a 60 L elution buffer provided in the kit. The entire PR and 410 codons of the RT in the pol gene was reverse-transcribed and amplified by using C. therm Polymerase One-Step RT-PCR System (Roche Diagnostics, Germany) with primer HIVF04 and HIVR03 (Table 1). A 2200 bp fragment encompassing the PR and RT regions was further amplified with FastStart High Fidelity PCR System (Roche Diagnostics, Germany) by a nested PCR with the inner primers HIVF03 and HIVR04 (Table 1). Parallel amplification was performed on each RNA extract using the ViroSeq HIV-1 Genotyping System version 2.0 (Celera Diagnostics, CA, USA) following the manufacturer’s instructions. The 369 base pair env gp41 immunodominant region was amplified for HIV-1 genotyping as described previously (Swanson et al., 2003). Positive and negative controls were included in each run and all precautions to prevent cross-contamination were observed (Kwok and Higushi, 1989). 2.3. Sequencing and purification The nested PCR products were purified with QIAquick PCR purification kit (Qiagen, Hilden, Germany) and were direct sequenced in both directions with 1/4 dilution of the BigDye Terminator Cycle Sequencing Ready Reaction kit version 1.1 (AppliedBiosystems, CA, USA) with five specific primers (Table 1). These primers provided overlapping, bidirectional sequences covering the region where all defined PI and RT inhibitor resistance-related mutations positioned. For the ViroSeqTM system, PCR products were sequenced with the sequencing module according to the manufacturer’s instructions (Celera Diagnostics, CA, USA). Excess dye terminator after the cycle sequencing was removed by AutoSeq96 (Amersham Biosciences, USA) before loading into the Prism 3700 Genetic Analyzer (Applied Biosystems, CA, USA).
2. Materials and methods 2.4. Sequencing and phylogenetic analysis 2.1. Samples A panel of 235 EDTA whole blood or archived plasma samples was collected from 205 HIV-1-infected patients in
The individual sequence fragments of each sample were aligned and edited with Staden Package (version 2003.0.1) (Staden et al., 2000). Following the sequencing analy-
J.H.K. Chen et al. / Journal of Clinical Virology 39 (2007) 125–131
127
Table 1 Primers used for RT-PCR, nested PCR, and cycle sequencing Primer name
Sequence (5 > 3 )
HXB2 Position
First PCR HIVF04 HIVR03
GCAAGRGTTTTGGCBGARGCAATGAG GACATTTATCACAGYWGGCTACTATTT
1867 > 1892 4359 < 4333
Nested PCR HIVPRO-1 HIVR04
AAAAGGGCTGTTGGAAATGTG TTAGTYTCCCTRYTAGCTGCCCCATC
2018 > 2038 3901 < 3876
Sequencing SEQF01 SEQF02 SEQR01 SEQR02 SEQR03
GAAGGACAYCARRTGAAAGA GCCTGAAAAYCCATAYAATACTCCA GGAGGGGTATTRACAAAYTCCCA TCAGATCCTACATAYAARTCATCC GGTACAGTGTCAATAGGACTAATTGGGAA
2044 > 2063 2702 > 2726 3811 < 3789 3124 < 3101 2575 < 2547
sis guideline of the ViroSeqTM system, all the mutated bases with a sequencing electrogram height over 30% of the wild-type bases were confirmed as mutations. The pol sequences generated by the two methods were compared by phylogenetic analysis with Kimura two-parameter distance neighbor-joining method (Saitou and Nei, 1987) with 1000 bootstrap replicates in MEGA 3.1 software (Kumar et al., 2004). In-house and ViroSeqTM sequences from a single patient which did not cluster together in the phylogenetic tree indicated sample confusion or contamination, and thus they were excluded from this study. The pol sequences were then multiple aligned by BioEdit (version 7 [http://www.mbio.ncsu.edu/BioEdit/bioedit.html]) and were analyzed through the Stanford University HIV Drug Resistance Database HIVdb program (version 4.2.6 [http://hivdb.stanford.edu]) for genotypic resistance interpretation. Drug resistance-associated mutations in PR and RT were defined by the Stanford HIVdb version 4.2.6. The HIV1 subtypes of the pol sequences were identified by submitting the pol sequences to the REGA HIV-1 Genotyping Tool version 2.0 (deOliveira et al., 2005). The REGA genotyping results were further confirmed by the env phylogenetic analysis. The env phylogenetic tree was constructed with similar procedures described for the construction of the pol phylogenetic tree. The subtype reference env sequences provided in the Los Alamos HIV Database (Los Alamos National Laboratory [http://www.hiv-web.lanl.gov]) were included in the phylogenetic tree. 2.5. Sensitivity and specificity of in-house primers Since HIV-1 subtype B and CRF01 AE are predominant in Hong Kong, the sensitivity of in-house primers was tested in duplicate by using subtype B and CRF01 AE clinical samples with viral load determined by COBAS Amplicor HIV-1 Monitoring Kit version 1.5. The samples were serially diluted with normal human plasma at 5000, 2000, 1000, 800 and 400 copies/mL. Viral RNA was then extracted and the pol gene was amplified by the in-house primer sets as described above. To assess the specificity of the in-house primer sets for
HIV-1, all the pol gene sequences amplified were submitted to blastn algorithm of the National Center of Biotechnology Information (http://www.ncbi.nlm.nih.gov).
3. Results 3.1. Sensitivity and specificity of in-house genotyping system The sensitivity of the in-house GRT reached 400 copies/ml when testing on serially diluted subtype B and CRF01 AE samples. The in-house primer sets were identified to have 100% specificity to the HIV-1 pol gene among the sequences submitted to the NCBI blastn algorithm. Among the 235 samples included in this study, 229 (97.4%) were successfully amplified by both the ViroSeqTM and in-house systems. The other six PCR-negative samples harbored viral RNA at <400 copies/mL in the COBAS Amplicor HIV-1 version 1.5 viral load assay. 3.2. Drug resistance-related mutations detected by the two systems All the 229 PCR-positive samples were sequenced by both the ViroSeqTM and in-house genotyping systems. A total of 403 Stanford database-listed drug resistance-related mutations in the PR and RT regions were identified by the ViroSeqTM and in-house systems. The two systems showed identical drug resistance-related mutation patterns in 216 out of 229 samples (94.3%) with 108 PI-resistance-related mutations and 246 RTI-resistance-related mutations. Among the 13 samples (5.7%) showing discordant mutation patterns, the ViroSeqTM system detected six mutations (one in PR and five in RT) which were not detected by the in-house system. On the other hand, the in-house system detected seven mutations (four in PR and three in RT) which were not detected by the ViroSeqTM system (Table 2). Among the 13 discordant mutations, 7 could influence drug susceptibilities by the Stanford Drug Resistance HIVdb interpretation.
128
J.H.K. Chen et al. / Journal of Clinical Virology 39 (2007) 125–131
Table 2 Concordance of drug resistance mutations detected by the ViroSeq GRT and In-house GRT Gene
PR RT Overall
Total mutations
122 281 403
No. of concordant mutations
117 (95.9%) 273 (97.2%) 390 (96.8%)
No. of discordant mutations Mutations identified by ViroSeqTM only
Mutations identified by in-house only
1 (0.8%) 5 (1.8%) 6 (1.5%)
4 (3.3%) 3 (1.1%) 7 (1.7%)
Through the in-house GRT, T386I mutations in the RT were identified in 15 samples (6.6%) with HIV-1 subtypes B, C, G or CRF01 AE. The ViroSeqTM system could not detect this mutation since T386I was positioned beyond the ViroSeqTM sequencing region. Thus, 10 out of the 15 samples were from treatment na¨ıve, while 5 were zidovudine experienced.
3.3. HIV genotyping results The HIV-1 subtypes were determined through REGA HIV-1 Genotyping Tool version 2.0 in this study. Among the 229 PCR-positive samples collected in Hong Kong, CRF01 AE (90/229, 39.3%), subtype B (86/229, 37.6%), and subtype C (19/229, 8.2%) were predominant. Other subtypes and recombinants included subtype A1 (7), subtype G (1), CRF02 AG (3), CRF06 cpx (2), CRF07 BC (10), CRF08 BC (2) and nine undefined subtypes. The subtypes generated by the REGA pol genotyping showed 93.9% (215/229) concordance to those generated by env phylogenetic analysis. Among the 14 discordant cases between REGA pol genotyping and env phylogenetic analysis, 8 failed in REGA genotyping but with subtypes defined by the env phylogenetic tree. The other seven discordant cases generated different subtypes in REGA pol genotyping and env phylogenetic analysis (Fig. 1 and Table 3).
Table 3 Subtypes of the HIV-1 samples with discordant genotyping results in different subtype analysis methods Sample no.
REGA pol Genotyping Tool PR and RT
env phylogenetic analysis
1 2 3 4 5 6
Not available Not available Not available Not available Not available C
7 8 9 10 11 12 13 14
B CRF01 AE Not available Not available CRF01 AE Not available B A1
D D B B B CRF07 CRF08 CRF01 CRF15 C B CRF07 B CRF01 CRF01
BC or BC AE 01B
BC AE AE
4. Discussion HIV-1 non-B viruses, especially CRF01 AE, are predominant in Hong Kong and other South-East Asian developing countries (Ariyoshi et al., 2003; Tovanabutra et al., 2004; Laeyendecker et al., 2005; Yam et al., 2006). Recognizing the growing demand for a cost-effective GRT on patients with HAART in our region, this study evaluated a novel HIV-1 inhouse GRT in terms of its ability of drug resistance-related mutation detection in different HIV-1 subtypes by comparing with results of the commercial ViroSeqTM genotyping system. Also, the possibility of using the pol sequences for HIV-1 genotyping was studied. The sensitivity of the in-house PCR primer sets was demonstrated to reach 400 copies/mL on serially diluted subtype B and CRF01 AE HIV-1 samples. The in-house and ViroSeqTM PCR primer sets both demonstrated an overall 97.4% success rate on the PCR amplification of HIV-1 samples with various viral load and subtypes. All the 229 clinical samples with viral load ≥400 copies/mL were successfully amplified and sequenced by both systems. From the ViroSeqTM HIV-1 Genotyping system working protocol, those plasma samples with 2000 copies/mL or greater HIV-1 viral load were highly recommended. As both GRTs could consistently detect low viral load (400–1000 copies/mL) HIV-1 samples in this study, we proposed to extend the detection limit of both ViroSeqTM and in-house GRT to 400 copies/mL. Other than comparing the experimental setup of the genotyping systems, the inspection and compilation of the sequence fragments should also be considered. One advantage with the ViroSeqTM system is that it comes with a software that is designed specifically for the analysis of HIV-1 genotypic drug resistance to PIs and RTIs. For the in-house GRT, a relatively simple software Staden Package was used, which allows simple compilation of all sequence fragments from one sample into one contig, inspection of the sequence traces, and translation and check for frame shifts. The high concordance of mutations (>95%) detected by the in-house GRT using Staden Package and the ViroSeqTM system showed that the two systems had similar performance on genotyping resistance interpretation. The mixed viral populations of wild-type and resistant HIV-1 strains caused all the discordance in mutation detections. In the sequence electrograms, mixed peaks were identified at all positions with discordant mutations. Through this study, we demonstrated that the in-house GRT and ViroSeqTM system had similar
J.H.K. Chen et al. / Journal of Clinical Virology 39 (2007) 125–131
129
Fig. 1. Phylogenetic analysis of HIV-1 gp41 env sequences showing subtype discordance between REGA pol genotyping and env phylogenetic analysis (Sample #1–14). A neighbor-joining phylogenetic tree was built from isolates and env subtype reference sequences from the Los Alamos HIV database (http://hivweb.lanl.gov). The Kimura two-parameter method for estimating genetic distance was used. Bootstrap values (1000 replicates) >50 are shown next to the nodes of the tree.
130
J.H.K. Chen et al. / Journal of Clinical Virology 39 (2007) 125–131
performance on minor viral population detection, with the probability of missing only 2% of the mutations. The novel mutation T386I in the RT region had been reported previously in four Brazilian treatment-experienced patients in 2000 and it could abrogate the M184V-suppressing effect of L210W or L210W plus G333D/E (Caride et al., 2000). Since T386I was identified both in treatment-na¨ıve as well as treatment-experienced patients, further investigation is necessary to identify the relationship between the presence of T386I and NRTI or NNRTI selective pressure. The ability to detect mutations on diversified HIV-1 subtypes is necessary for a well-established genotyping system. Similar to other genotyping systems reported recently, our study demonstrated that both in-house and ViroSeqTM primer sets could target the gag-pol region of various HIV-1 subtypes including subtype A1, B, C, D, G, CRF01 AE, CRF02 AG, CRF06 cpx, CRF07 BC, CRF08 BC, CRF15 01B and other recombinant strains which circulate in South-East Asia. The subtypes defined by pol and env sequences showed high concordance (>93.9%) in subtype B and non-B HIV-1. Although the appropriateness of using HIV-1 pol sequences for genotyping has been debated for a certain time (Pasquier et al., 2001; Njouom et al., 2003; Sturmer et al., 2004; Hue et al., 2004), our data supported that the pol gene could be used for HIV-1 genotyping. In this study, the REGA HIV-1 Genotyping Tool which was recommended in recent publications (deOliveira et al., 2005; Gifford et al., 2006) showed potential genotyping of most non-B HIV-1 strains which are predominant in Asia. Interestingly, we found that some env phylogenetically defined subtype B sequences could not be genotyped by the REGA genotyping system using the pol sequences. For these samples, full viral genome sequencing is recommended since these samples may carry new recombinant HIV-1 strains which could not be defined solely by pol gene sequencing. Given the comparable performance of both in-house GRT and the commercial ViroSeqTM system, it is also interesting to consider their running cost. As the two systems required similar manpower and turnaround time, the reagent expenses per test incurred for in-house GRT (US$ 30) was only 25% of that for the ViroSeqTM system (US$ 120). The high cost of commercial HIV GRT thwarted the setting up of an HIV drug resistance monitoring service in developing countries. Through the establishment of this cost-effective in-house GRT, our findings verified that its performance is comparable to that of the commercial ViroSeqTM HIV-1 Genotyping System and it is suitable for the detection of low-level plasma HIV-1 with diversified subtypes. The pol sequences generated by the GRTs could serve a dual purpose on drug resistance interpretation and HIV-1 genotyping by using the Stanford HIV-1 Drug Resistance database and REGA HIV-1 Genotyping Tool. In addition to simultaneous genotyping and drug resistance-related mutation detection, our in-house GRT has the advantage of identifying novel mutations located beyond the detectable regions of the commercial assay. Moreover, the wide applications of low-cost GRT will facilitate and
improve decision making for HAART, and thus reduce the risk of further drug resistance-related mutations. Acknowledgements This work was supported by the Hong Kong Special Administrative Region Government through the AIDS Trust Fund grant number MSS-099R. References Ariyoshi K, Matsuda M, Miura H, Tateishi S, Yamada K, Sugiura W. Patterns of point mutations associated with antiretroviral drug treatment failure in CRF01 AE (subtype E) infection differ from subtype B infection. J Acquir Immune Defic Syndr 2003;33:336–42. Beddows S, Galpin S, Kazmi SH, Ashraf A, Johargy A, Frater AJ, et al. Performance of two commercially available sequence-based HIV1 genotyping systems for the detection of drug resistance against HIV type1 group M subtypes. J Med Virol 2003;70:337–42. Caride E, Brindeiro R, Hertogs K, Larder B, Dehertogh P, Machado E, et al. Drug-resistant reverse transcriptase genotyping and phenotyping of B and non-B subtypes (F and A) of human immunodeficiency virus type 1 found in Brazilian patients failing HAART. Virology 2000;275:107–15. Carpenter CC, Cooper DA, Fischl MA, Gatell JM, Gazzard DA, Hammer SM, et al. Antiretroviral therapy in adults: updated recommendations of the International AIDS Society, USA Panel. J Am Med Assoc 2000;283:381–90. deOliveira T, Deforche K, Cassol S, Salminen M, Paraskevis D, Seebregts C, et al. An automated genotyping system for analysis of HIV-1 and other microbial sequences. Bioinformatics 2005;21:3797–800. Eshleman SH, Hackett Jr J, Swanson P, Cunningham SP, Drews B, Brennan C, et al. Performance of the Celera Diagnostics ViroSeq HIV-1 Genotyping System for sequence-based analysis of diverse human immunodeficiency virus type 1 strains. J Clin Microbiol 2004;42:2711–7. The EuroGuidelines Group for HIV resistanceEuroGuidelines Group for HIV Resistance. Clinical and laboratory guidelines for the use of HIV-1 drug resistance testing as part of treatment management: recommendations for the European setting. AIDS 2001;15:309–20. Fontaine E, Riva C, Peeters M, Schmit JC, Delaporte E, Van Laethem K, et al. Evaluation of two commercial kits for the detection of genotypic drug resistance on a panel of HIV type1 subtypes A through J. J Acquir Immune Defic Syndr 2001;28:254–8. Gifford R, deOliveira T, Rambaut A, Myers RE, Gale CV, Dunn D, et al. Assessment of automated genotyping protocols as tools for surveillance of HIV-1 genetic diversity. AIDS 2006;20:1521–9. Grant RM, Kuritzkes DR, Johnson VA, Mellors JW, Sullivan JL, Swanstrom R, et al. Accuracy of the TRUGENE HIV-1 genotyping kit. J Clin Microbiol 2003;41:1586–93. Hirsch MS, Brun-Vezinet F, D’Aquila RT, Hammer SM, Johnson VA, Kuritzkes DR, et al. Antiretroviral drug resistance testing in adult HIV1 infection: recommendations of an International AIDS Society-USA Panel. JAMA 2000;283:2417–26. Jagodzinski LL, Cooley JD, Weber M, Michael NL. Performance characteristics of human immunodeficiency virus type 1 (HIV-1) genotyping systems in sequence-based analysis of subtypes other than HIV-1 subtype B. J Clin Microbiol 2003;41:998–1003. Johnson VA, Brun-Vezinet F, Clotet B, Kuritzkes DR, Pillay D, Schapiro JM, et al. Update of the drug resistance mutations in HIV-1: Fall 2006. Top HIV Med 2006;14:125–30. Kumar S, Tamura K, Nei M. MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform 2004;5:150–63.
J.H.K. Chen et al. / Journal of Clinical Virology 39 (2007) 125–131 Kwok S, Higushi R. Avoiding false positives with PCR. Nature 1989;339:227–38. Laeyendecker O, Zhang GW, Quinn TC, Garten R, Ray SC, Lai S, et al. Molecular epidemiology of HIV-1 subtypes in southern China. J Acquir Immune Defic Syndr 2005;38:356–62. Lindstrom A, Albert J. A simple and sensitive ‘in-house’ method for determining genotypic drug resistance of HIV-1. J Virol Methods 2003;107:45–51. McCutchan FE. Global epidemiology of HIV. J Med Virol 2006;78:S7– 12. Mracna M, Becker-Pergola G, Dileanis J, Guay LA, Cunningham S, Jackson JB, et al. Performance of Applied Biosystems ViroSeq HIV1 Genotyping System for sequence-based analysis of non-subtype B human immunodeficiency virus type 1 from Uganda. J Clin Microbiol 2001;39:4323–7. Njouom R, Pasquier C, Sandres-Saune K, Harter A, Souyris C, Izopet J. Assessment of HIV-1 subtyping for Cameroon strains using phylogenetic analysis of pol gene sequences. J Virol Methods 2003;110:1–8. Pasquier C, Millot N, Njouom R, Sandres K, Cazabat M, Puel J, et al. HIV-1 subtyping using phylogenetic analysis of pol gene sequences. J Virol Methods 2001;94:45–54. Roche Diagnostic Systems. AMPLICOR HIV-1 MONITOR Test Package Insert. Roche Diagnostic Systems, Branchburg, NJ, 1996;8–9.
131
Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406–25. Staden R, Beal KF, Bonfield JK. The Staden package, 1998. Methods Mol Biol 2000;132:115–30. Steegen K, Demecheleer E, De Cabooter N, Nges D, Temmerman M, Ndumbe P, et al. A sensitive in-house RT-PCR genotyping system for combined detection of plasma HIV-1 and assessment of drug resistance. J Virol Methods 2006;133:137–45. Sturmer M, Preiser W, Gute P, Nisius G, Doerr HW. Phylogenetic analysis of HIV-1 transmission: pol gene sequences are sufficient to clarify true relationships between patient isolates. AIDS 2004;18:2109–13. Swanson P, Devare SG, Hackett Jr J. Molecular characterization of 39 HIV isolates representing group M (subtypes A-G) and group O: sequence analysis of gag p24, pol integrase, and env gp41. AIDS Res Hum Retroviruses 2003;19:625–9. Tovanabutra S, Beyrer C, Sakkhachornphop S, Razak MH, Ramos GL, Vongchak T, et al. The changing molecular epidemiology of HIV type 1 among northern Thai drug users, 1999–2002. AIDS Res Hum Retroviruses 2004;20:465–75. Yam WC, Chen JHK, Wong KH, Chan K, Cheng VCC, Lam HY, et al. Clinical utility of genotyping resistance test on determining the mutation patterns in HIV-1 CRF01 AE and subtype B patients receiving antiretroviral therapy in Hong Kong. J Clin Virol 2006;35:454–7.
Evaluation of an in-house genotyping resistance test for HIV-1 drug resistance interpretation and genotyping J.H.K. Chen a , K.H. Wong b , K. Chan b , H.Y. Lam a , S.S. Lee c , P. Li d , M.P. Lee d , D.N. Tsang e , B.J. Zheng a , K.Y. Yuen a , W.C. Yam a,∗ a Department of Microbiology, The University of Hong Kong, Hong Kong, SAR, China Integrated Treatment Centre, Special Preventive Programme, Centre of Health Protection, Department of Health, Hong Kong, SAR, China Centre of Emerging Infectious Diseases, The Chinese University of Hong Kong, Hong Kong, SAR, China d Department of Medicine, The Queen Elizabeth Hospital, Hong Kong, SAR, China e Department of Pathology, The Queen Elizabeth Hospital, Hong Kong, SAR, China b
c
Received 7 October 2006; received in revised form 22 February 2007; accepted 12 March 2007
Abstract Introduction: The human immunodeficiency virus type 1 (HIV-1) genotyping resistance test (GRT) has been considered essential for HIV-1 drug resistance monitoring. However, it is not commonly used in some developing countries in Asia and Africa due to its high running cost. Objective: This study aims to evaluate a new low-cost in-house GRT for both subtype B and non-B HIV-1. Study design: The in-house GRT sequenced the entire protease and 410 codons of reverse transcriptase (RT) in the pol gene. Its performance on drug resistance interpretation was evaluated against the FDA-approved ViroSeqTM HIV-1 Genotyping System. Particularly, a panel of 235 plasma samples from 205 HIV-1-infected patients in Hong Kong was investigated. The HIV-1 drug resistance-related mutations detected by the two systems were compared. The HIV-1 subtypes were analyzed through the REGA HIV-1 Genotyping Tool and env phylogenetic analysis. Results: Among the 235 samples, 229 (97.4%) were successfully amplified by both in-house and ViroSeqTM systems. All PCR-negative samples harbored viral RNA at <400 copies/mL. The in-house and ViroSeqTM system showed identical drug resistance-related mutation patterns in 216 out of 229 samples (94.3%). The REGA pol genotyping results showed 93.9% (215/229) concordance with the env phylogenetic results including HIV-1 subtype A1, B, C, D, G, CRF01 AE, CRF02 AG, CRF06 cpx, CRF07 BC, CRF08 BC, CRF15 01B and other recombinant strains. The cost of running the in-house GRT is only 25% of that for the commercial system, thus making it suitable for the developing countries in Asia and Africa. Conclusions: Overall, our in-house GRT provided comparable results to those of the commercial ViroSeqTM genotyping system on diversified HIV-1 subtypes at a more affordable price which make it suitable for HIV-1 monitoring in developing countries. © 2007 Elsevier B.V. All rights reserved. Keywords: Genotyping resistance test; HIV-1; In-house; Drug resistance; CRF01 AE
1. Introduction The human immunodeficiency virus type 1 (HIV-1) genotyping resistance test (GRT) has been widely used to monitor the antiretroviral treatment on HIV-1 patients (Hirsch et al., 2000; EuroGuidelines for HIV Resistance, ∗
Corresponding author. Tel.: +852 28194821; fax: +852 28551241. E-mail address: [email protected] (W.C. Yam).
1386-6532/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2007.03.008
2001). This assay could provide early diagnosis of drug resistance in patients adhered to antiretroviral therapy and prevent the cause of treatment failure (Carpenter et al., 2000). In addition, GRT results would be an important factor for Highly Active Antiretroviral Therapy (HAART) regimen selection (Hirsch et al., 2000). Notably, although GRT is essential for HIV treatment, its high running cost hinders its diagnostic application in developing countries.
126
J.H.K. Chen et al. / Journal of Clinical Virology 39 (2007) 125–131
Most of the current FDA-approved antiretroviral drugs target the protease (PR) and reverse transcriptase (RT) of HIV-1. The currently available commercial genotyping resistance systems, such as the ViroSeqTM Genotyping System and TrugeneTM HIV-1 Genotyping System are based on sequencing the PR and RT region in the pol gene from plasma virus (Eshleman et al., 2004; Grant et al., 2003). The sequencing covering regions of the commercial systems included the whole PR and partial RT region (up to codon 335) in the pol gene, where the well-defined protease inhibitor (PI) and reverse transcriptase inhibitor resistance-related mutations are positioned (Eshleman et al., 2004; Johnson et al., 2006). In 2000, a novel T386I mutation in the RT region positioned beyond the commercial GRT sequencing covering region was identified in a few HIV-1 strains in Brazil. This mutation was found to abrogate the M184V suppression of L210W and L210W/G333D/E (Caride et al., 2000). Among all commercially available HIV-1 drug resistance interpretation systems, T386I was recognized as a drug resistance-associated mutation only in VircoTYPE HIV-1 analysis version 4.0.00 (Virco, Belgium). It is well known that commercial GRTs are optimized for subtype B strains while non-B strains are causing the major global pandemic. Other than HIV-1 subtype B, the circulating recombinant form AE (CRF01 AE), and subtype C is the prevalent strain circulating in Hong Kong and other Asian countries (Ariyoshi et al., 2003; McCutchan, 2006; Yam et al., 2006). Recent studies showed that the ViroSeqTM and TruGeneTM HIV-1 Genotyping Systems (Eshleman et al., 2004; Jagodzinski et al., 2003) are applicable to various HIV-1 subtypes; however, problems with non-B strains have occasionally been reported (Beddows et al., 2003; Fontaine et al., 2001; Mracna et al., 2001). In this regard, different in-house GRTs with low running cost have been designed (Lindstrom and Albert, 2003; Steegen et al., 2006) and they were found to have a high successful rate (>85.3%) of amplifying and sequencing subtype B and non-B HIV-1 samples (Steegen et al., 2006). However, their performance was not validated against internationally approved reference systems. Therefore, the aim of this study is to evaluate a costeffective in-house GRT for routine drug resistance-related mutation detection on genetic diversified HIV-1. The genotyping results of the in-house system were compared with those of the FDA-approved ViroSeqTM Genotyping System. The frequencies of T386I development among patients in Hong Kong were also investigated. Moreover, HIV-1 genotyping using the pol sequences was further evaluated.
Hong Kong between July 1996 and May 2005. Among the 235 samples, 143 were pre-treatment and 92 were posttreatment samples. Patient plasma separated from EDTA blood samples was stored at −80 ◦ C. The HIV-1 plasma viral loads (400 to 2 × 106 copies/mL) of all samples were monitored by the COBAS Amplicor HIV-1 Monitor Test version 1.5 with lower quantitation limit at 400 copies/mL (Roche Diagnostic Systems, 1996). 2.2. RNA extraction, RT-PCR amplification Total RNA was extracted from 420 L patient plasma using three times the volume of lysis buffer in the QIAamp Viral RNA Mini kit (Qiagen, Hilden, Germany). Viral RNA was eluted in a 60 L elution buffer provided in the kit. The entire PR and 410 codons of the RT in the pol gene was reverse-transcribed and amplified by using C. therm Polymerase One-Step RT-PCR System (Roche Diagnostics, Germany) with primer HIVF04 and HIVR03 (Table 1). A 2200 bp fragment encompassing the PR and RT regions was further amplified with FastStart High Fidelity PCR System (Roche Diagnostics, Germany) by a nested PCR with the inner primers HIVF03 and HIVR04 (Table 1). Parallel amplification was performed on each RNA extract using the ViroSeq HIV-1 Genotyping System version 2.0 (Celera Diagnostics, CA, USA) following the manufacturer’s instructions. The 369 base pair env gp41 immunodominant region was amplified for HIV-1 genotyping as described previously (Swanson et al., 2003). Positive and negative controls were included in each run and all precautions to prevent cross-contamination were observed (Kwok and Higushi, 1989). 2.3. Sequencing and purification The nested PCR products were purified with QIAquick PCR purification kit (Qiagen, Hilden, Germany) and were direct sequenced in both directions with 1/4 dilution of the BigDye Terminator Cycle Sequencing Ready Reaction kit version 1.1 (AppliedBiosystems, CA, USA) with five specific primers (Table 1). These primers provided overlapping, bidirectional sequences covering the region where all defined PI and RT inhibitor resistance-related mutations positioned. For the ViroSeqTM system, PCR products were sequenced with the sequencing module according to the manufacturer’s instructions (Celera Diagnostics, CA, USA). Excess dye terminator after the cycle sequencing was removed by AutoSeq96 (Amersham Biosciences, USA) before loading into the Prism 3700 Genetic Analyzer (Applied Biosystems, CA, USA).
2. Materials and methods 2.4. Sequencing and phylogenetic analysis 2.1. Samples A panel of 235 EDTA whole blood or archived plasma samples was collected from 205 HIV-1-infected patients in
The individual sequence fragments of each sample were aligned and edited with Staden Package (version 2003.0.1) (Staden et al., 2000). Following the sequencing analy-
J.H.K. Chen et al. / Journal of Clinical Virology 39 (2007) 125–131
127
Table 1 Primers used for RT-PCR, nested PCR, and cycle sequencing Primer name
Sequence (5 > 3 )
HXB2 Position
First PCR HIVF04 HIVR03
GCAAGRGTTTTGGCBGARGCAATGAG GACATTTATCACAGYWGGCTACTATTT
1867 > 1892 4359 < 4333
Nested PCR HIVPRO-1 HIVR04
AAAAGGGCTGTTGGAAATGTG TTAGTYTCCCTRYTAGCTGCCCCATC
2018 > 2038 3901 < 3876
Sequencing SEQF01 SEQF02 SEQR01 SEQR02 SEQR03
GAAGGACAYCARRTGAAAGA GCCTGAAAAYCCATAYAATACTCCA GGAGGGGTATTRACAAAYTCCCA TCAGATCCTACATAYAARTCATCC GGTACAGTGTCAATAGGACTAATTGGGAA
2044 > 2063 2702 > 2726 3811 < 3789 3124 < 3101 2575 < 2547
sis guideline of the ViroSeqTM system, all the mutated bases with a sequencing electrogram height over 30% of the wild-type bases were confirmed as mutations. The pol sequences generated by the two methods were compared by phylogenetic analysis with Kimura two-parameter distance neighbor-joining method (Saitou and Nei, 1987) with 1000 bootstrap replicates in MEGA 3.1 software (Kumar et al., 2004). In-house and ViroSeqTM sequences from a single patient which did not cluster together in the phylogenetic tree indicated sample confusion or contamination, and thus they were excluded from this study. The pol sequences were then multiple aligned by BioEdit (version 7 [http://www.mbio.ncsu.edu/BioEdit/bioedit.html]) and were analyzed through the Stanford University HIV Drug Resistance Database HIVdb program (version 4.2.6 [http://hivdb.stanford.edu]) for genotypic resistance interpretation. Drug resistance-associated mutations in PR and RT were defined by the Stanford HIVdb version 4.2.6. The HIV1 subtypes of the pol sequences were identified by submitting the pol sequences to the REGA HIV-1 Genotyping Tool version 2.0 (deOliveira et al., 2005). The REGA genotyping results were further confirmed by the env phylogenetic analysis. The env phylogenetic tree was constructed with similar procedures described for the construction of the pol phylogenetic tree. The subtype reference env sequences provided in the Los Alamos HIV Database (Los Alamos National Laboratory [http://www.hiv-web.lanl.gov]) were included in the phylogenetic tree. 2.5. Sensitivity and specificity of in-house primers Since HIV-1 subtype B and CRF01 AE are predominant in Hong Kong, the sensitivity of in-house primers was tested in duplicate by using subtype B and CRF01 AE clinical samples with viral load determined by COBAS Amplicor HIV-1 Monitoring Kit version 1.5. The samples were serially diluted with normal human plasma at 5000, 2000, 1000, 800 and 400 copies/mL. Viral RNA was then extracted and the pol gene was amplified by the in-house primer sets as described above. To assess the specificity of the in-house primer sets for
HIV-1, all the pol gene sequences amplified were submitted to blastn algorithm of the National Center of Biotechnology Information (http://www.ncbi.nlm.nih.gov).
3. Results 3.1. Sensitivity and specificity of in-house genotyping system The sensitivity of the in-house GRT reached 400 copies/ml when testing on serially diluted subtype B and CRF01 AE samples. The in-house primer sets were identified to have 100% specificity to the HIV-1 pol gene among the sequences submitted to the NCBI blastn algorithm. Among the 235 samples included in this study, 229 (97.4%) were successfully amplified by both the ViroSeqTM and in-house systems. The other six PCR-negative samples harbored viral RNA at <400 copies/mL in the COBAS Amplicor HIV-1 version 1.5 viral load assay. 3.2. Drug resistance-related mutations detected by the two systems All the 229 PCR-positive samples were sequenced by both the ViroSeqTM and in-house genotyping systems. A total of 403 Stanford database-listed drug resistance-related mutations in the PR and RT regions were identified by the ViroSeqTM and in-house systems. The two systems showed identical drug resistance-related mutation patterns in 216 out of 229 samples (94.3%) with 108 PI-resistance-related mutations and 246 RTI-resistance-related mutations. Among the 13 samples (5.7%) showing discordant mutation patterns, the ViroSeqTM system detected six mutations (one in PR and five in RT) which were not detected by the in-house system. On the other hand, the in-house system detected seven mutations (four in PR and three in RT) which were not detected by the ViroSeqTM system (Table 2). Among the 13 discordant mutations, 7 could influence drug susceptibilities by the Stanford Drug Resistance HIVdb interpretation.
128
J.H.K. Chen et al. / Journal of Clinical Virology 39 (2007) 125–131
Table 2 Concordance of drug resistance mutations detected by the ViroSeq GRT and In-house GRT Gene
PR RT Overall
Total mutations
122 281 403
No. of concordant mutations
117 (95.9%) 273 (97.2%) 390 (96.8%)
No. of discordant mutations Mutations identified by ViroSeqTM only
Mutations identified by in-house only
1 (0.8%) 5 (1.8%) 6 (1.5%)
4 (3.3%) 3 (1.1%) 7 (1.7%)
Through the in-house GRT, T386I mutations in the RT were identified in 15 samples (6.6%) with HIV-1 subtypes B, C, G or CRF01 AE. The ViroSeqTM system could not detect this mutation since T386I was positioned beyond the ViroSeqTM sequencing region. Thus, 10 out of the 15 samples were from treatment na¨ıve, while 5 were zidovudine experienced.
3.3. HIV genotyping results The HIV-1 subtypes were determined through REGA HIV-1 Genotyping Tool version 2.0 in this study. Among the 229 PCR-positive samples collected in Hong Kong, CRF01 AE (90/229, 39.3%), subtype B (86/229, 37.6%), and subtype C (19/229, 8.2%) were predominant. Other subtypes and recombinants included subtype A1 (7), subtype G (1), CRF02 AG (3), CRF06 cpx (2), CRF07 BC (10), CRF08 BC (2) and nine undefined subtypes. The subtypes generated by the REGA pol genotyping showed 93.9% (215/229) concordance to those generated by env phylogenetic analysis. Among the 14 discordant cases between REGA pol genotyping and env phylogenetic analysis, 8 failed in REGA genotyping but with subtypes defined by the env phylogenetic tree. The other seven discordant cases generated different subtypes in REGA pol genotyping and env phylogenetic analysis (Fig. 1 and Table 3).
Table 3 Subtypes of the HIV-1 samples with discordant genotyping results in different subtype analysis methods Sample no.
REGA pol Genotyping Tool PR and RT
env phylogenetic analysis
1 2 3 4 5 6
Not available Not available Not available Not available Not available C
7 8 9 10 11 12 13 14
B CRF01 AE Not available Not available CRF01 AE Not available B A1
D D B B B CRF07 CRF08 CRF01 CRF15 C B CRF07 B CRF01 CRF01
BC or BC AE 01B
BC AE AE
4. Discussion HIV-1 non-B viruses, especially CRF01 AE, are predominant in Hong Kong and other South-East Asian developing countries (Ariyoshi et al., 2003; Tovanabutra et al., 2004; Laeyendecker et al., 2005; Yam et al., 2006). Recognizing the growing demand for a cost-effective GRT on patients with HAART in our region, this study evaluated a novel HIV-1 inhouse GRT in terms of its ability of drug resistance-related mutation detection in different HIV-1 subtypes by comparing with results of the commercial ViroSeqTM genotyping system. Also, the possibility of using the pol sequences for HIV-1 genotyping was studied. The sensitivity of the in-house PCR primer sets was demonstrated to reach 400 copies/mL on serially diluted subtype B and CRF01 AE HIV-1 samples. The in-house and ViroSeqTM PCR primer sets both demonstrated an overall 97.4% success rate on the PCR amplification of HIV-1 samples with various viral load and subtypes. All the 229 clinical samples with viral load ≥400 copies/mL were successfully amplified and sequenced by both systems. From the ViroSeqTM HIV-1 Genotyping system working protocol, those plasma samples with 2000 copies/mL or greater HIV-1 viral load were highly recommended. As both GRTs could consistently detect low viral load (400–1000 copies/mL) HIV-1 samples in this study, we proposed to extend the detection limit of both ViroSeqTM and in-house GRT to 400 copies/mL. Other than comparing the experimental setup of the genotyping systems, the inspection and compilation of the sequence fragments should also be considered. One advantage with the ViroSeqTM system is that it comes with a software that is designed specifically for the analysis of HIV-1 genotypic drug resistance to PIs and RTIs. For the in-house GRT, a relatively simple software Staden Package was used, which allows simple compilation of all sequence fragments from one sample into one contig, inspection of the sequence traces, and translation and check for frame shifts. The high concordance of mutations (>95%) detected by the in-house GRT using Staden Package and the ViroSeqTM system showed that the two systems had similar performance on genotyping resistance interpretation. The mixed viral populations of wild-type and resistant HIV-1 strains caused all the discordance in mutation detections. In the sequence electrograms, mixed peaks were identified at all positions with discordant mutations. Through this study, we demonstrated that the in-house GRT and ViroSeqTM system had similar
J.H.K. Chen et al. / Journal of Clinical Virology 39 (2007) 125–131
129
Fig. 1. Phylogenetic analysis of HIV-1 gp41 env sequences showing subtype discordance between REGA pol genotyping and env phylogenetic analysis (Sample #1–14). A neighbor-joining phylogenetic tree was built from isolates and env subtype reference sequences from the Los Alamos HIV database (http://hivweb.lanl.gov). The Kimura two-parameter method for estimating genetic distance was used. Bootstrap values (1000 replicates) >50 are shown next to the nodes of the tree.
130
J.H.K. Chen et al. / Journal of Clinical Virology 39 (2007) 125–131
performance on minor viral population detection, with the probability of missing only 2% of the mutations. The novel mutation T386I in the RT region had been reported previously in four Brazilian treatment-experienced patients in 2000 and it could abrogate the M184V-suppressing effect of L210W or L210W plus G333D/E (Caride et al., 2000). Since T386I was identified both in treatment-na¨ıve as well as treatment-experienced patients, further investigation is necessary to identify the relationship between the presence of T386I and NRTI or NNRTI selective pressure. The ability to detect mutations on diversified HIV-1 subtypes is necessary for a well-established genotyping system. Similar to other genotyping systems reported recently, our study demonstrated that both in-house and ViroSeqTM primer sets could target the gag-pol region of various HIV-1 subtypes including subtype A1, B, C, D, G, CRF01 AE, CRF02 AG, CRF06 cpx, CRF07 BC, CRF08 BC, CRF15 01B and other recombinant strains which circulate in South-East Asia. The subtypes defined by pol and env sequences showed high concordance (>93.9%) in subtype B and non-B HIV-1. Although the appropriateness of using HIV-1 pol sequences for genotyping has been debated for a certain time (Pasquier et al., 2001; Njouom et al., 2003; Sturmer et al., 2004; Hue et al., 2004), our data supported that the pol gene could be used for HIV-1 genotyping. In this study, the REGA HIV-1 Genotyping Tool which was recommended in recent publications (deOliveira et al., 2005; Gifford et al., 2006) showed potential genotyping of most non-B HIV-1 strains which are predominant in Asia. Interestingly, we found that some env phylogenetically defined subtype B sequences could not be genotyped by the REGA genotyping system using the pol sequences. For these samples, full viral genome sequencing is recommended since these samples may carry new recombinant HIV-1 strains which could not be defined solely by pol gene sequencing. Given the comparable performance of both in-house GRT and the commercial ViroSeqTM system, it is also interesting to consider their running cost. As the two systems required similar manpower and turnaround time, the reagent expenses per test incurred for in-house GRT (US$ 30) was only 25% of that for the ViroSeqTM system (US$ 120). The high cost of commercial HIV GRT thwarted the setting up of an HIV drug resistance monitoring service in developing countries. Through the establishment of this cost-effective in-house GRT, our findings verified that its performance is comparable to that of the commercial ViroSeqTM HIV-1 Genotyping System and it is suitable for the detection of low-level plasma HIV-1 with diversified subtypes. The pol sequences generated by the GRTs could serve a dual purpose on drug resistance interpretation and HIV-1 genotyping by using the Stanford HIV-1 Drug Resistance database and REGA HIV-1 Genotyping Tool. In addition to simultaneous genotyping and drug resistance-related mutation detection, our in-house GRT has the advantage of identifying novel mutations located beyond the detectable regions of the commercial assay. Moreover, the wide applications of low-cost GRT will facilitate and
improve decision making for HAART, and thus reduce the risk of further drug resistance-related mutations. Acknowledgements This work was supported by the Hong Kong Special Administrative Region Government through the AIDS Trust Fund grant number MSS-099R. References Ariyoshi K, Matsuda M, Miura H, Tateishi S, Yamada K, Sugiura W. Patterns of point mutations associated with antiretroviral drug treatment failure in CRF01 AE (subtype E) infection differ from subtype B infection. J Acquir Immune Defic Syndr 2003;33:336–42. Beddows S, Galpin S, Kazmi SH, Ashraf A, Johargy A, Frater AJ, et al. Performance of two commercially available sequence-based HIV1 genotyping systems for the detection of drug resistance against HIV type1 group M subtypes. J Med Virol 2003;70:337–42. Caride E, Brindeiro R, Hertogs K, Larder B, Dehertogh P, Machado E, et al. Drug-resistant reverse transcriptase genotyping and phenotyping of B and non-B subtypes (F and A) of human immunodeficiency virus type 1 found in Brazilian patients failing HAART. Virology 2000;275:107–15. Carpenter CC, Cooper DA, Fischl MA, Gatell JM, Gazzard DA, Hammer SM, et al. Antiretroviral therapy in adults: updated recommendations of the International AIDS Society, USA Panel. J Am Med Assoc 2000;283:381–90. deOliveira T, Deforche K, Cassol S, Salminen M, Paraskevis D, Seebregts C, et al. An automated genotyping system for analysis of HIV-1 and other microbial sequences. Bioinformatics 2005;21:3797–800. Eshleman SH, Hackett Jr J, Swanson P, Cunningham SP, Drews B, Brennan C, et al. Performance of the Celera Diagnostics ViroSeq HIV-1 Genotyping System for sequence-based analysis of diverse human immunodeficiency virus type 1 strains. J Clin Microbiol 2004;42:2711–7. The EuroGuidelines Group for HIV resistanceEuroGuidelines Group for HIV Resistance. Clinical and laboratory guidelines for the use of HIV-1 drug resistance testing as part of treatment management: recommendations for the European setting. AIDS 2001;15:309–20. Fontaine E, Riva C, Peeters M, Schmit JC, Delaporte E, Van Laethem K, et al. Evaluation of two commercial kits for the detection of genotypic drug resistance on a panel of HIV type1 subtypes A through J. J Acquir Immune Defic Syndr 2001;28:254–8. Gifford R, deOliveira T, Rambaut A, Myers RE, Gale CV, Dunn D, et al. Assessment of automated genotyping protocols as tools for surveillance of HIV-1 genetic diversity. AIDS 2006;20:1521–9. Grant RM, Kuritzkes DR, Johnson VA, Mellors JW, Sullivan JL, Swanstrom R, et al. Accuracy of the TRUGENE HIV-1 genotyping kit. J Clin Microbiol 2003;41:1586–93. Hirsch MS, Brun-Vezinet F, D’Aquila RT, Hammer SM, Johnson VA, Kuritzkes DR, et al. Antiretroviral drug resistance testing in adult HIV1 infection: recommendations of an International AIDS Society-USA Panel. JAMA 2000;283:2417–26. Jagodzinski LL, Cooley JD, Weber M, Michael NL. Performance characteristics of human immunodeficiency virus type 1 (HIV-1) genotyping systems in sequence-based analysis of subtypes other than HIV-1 subtype B. J Clin Microbiol 2003;41:998–1003. Johnson VA, Brun-Vezinet F, Clotet B, Kuritzkes DR, Pillay D, Schapiro JM, et al. Update of the drug resistance mutations in HIV-1: Fall 2006. Top HIV Med 2006;14:125–30. Kumar S, Tamura K, Nei M. MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform 2004;5:150–63.
J.H.K. Chen et al. / Journal of Clinical Virology 39 (2007) 125–131 Kwok S, Higushi R. Avoiding false positives with PCR. Nature 1989;339:227–38. Laeyendecker O, Zhang GW, Quinn TC, Garten R, Ray SC, Lai S, et al. Molecular epidemiology of HIV-1 subtypes in southern China. J Acquir Immune Defic Syndr 2005;38:356–62. Lindstrom A, Albert J. A simple and sensitive ‘in-house’ method for determining genotypic drug resistance of HIV-1. J Virol Methods 2003;107:45–51. McCutchan FE. Global epidemiology of HIV. J Med Virol 2006;78:S7– 12. Mracna M, Becker-Pergola G, Dileanis J, Guay LA, Cunningham S, Jackson JB, et al. Performance of Applied Biosystems ViroSeq HIV1 Genotyping System for sequence-based analysis of non-subtype B human immunodeficiency virus type 1 from Uganda. J Clin Microbiol 2001;39:4323–7. Njouom R, Pasquier C, Sandres-Saune K, Harter A, Souyris C, Izopet J. Assessment of HIV-1 subtyping for Cameroon strains using phylogenetic analysis of pol gene sequences. J Virol Methods 2003;110:1–8. Pasquier C, Millot N, Njouom R, Sandres K, Cazabat M, Puel J, et al. HIV-1 subtyping using phylogenetic analysis of pol gene sequences. J Virol Methods 2001;94:45–54. Roche Diagnostic Systems. AMPLICOR HIV-1 MONITOR Test Package Insert. Roche Diagnostic Systems, Branchburg, NJ, 1996;8–9.
131
Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406–25. Staden R, Beal KF, Bonfield JK. The Staden package, 1998. Methods Mol Biol 2000;132:115–30. Steegen K, Demecheleer E, De Cabooter N, Nges D, Temmerman M, Ndumbe P, et al. A sensitive in-house RT-PCR genotyping system for combined detection of plasma HIV-1 and assessment of drug resistance. J Virol Methods 2006;133:137–45. Sturmer M, Preiser W, Gute P, Nisius G, Doerr HW. Phylogenetic analysis of HIV-1 transmission: pol gene sequences are sufficient to clarify true relationships between patient isolates. AIDS 2004;18:2109–13. Swanson P, Devare SG, Hackett Jr J. Molecular characterization of 39 HIV isolates representing group M (subtypes A-G) and group O: sequence analysis of gag p24, pol integrase, and env gp41. AIDS Res Hum Retroviruses 2003;19:625–9. Tovanabutra S, Beyrer C, Sakkhachornphop S, Razak MH, Ramos GL, Vongchak T, et al. The changing molecular epidemiology of HIV type 1 among northern Thai drug users, 1999–2002. AIDS Res Hum Retroviruses 2004;20:465–75. Yam WC, Chen JHK, Wong KH, Chan K, Cheng VCC, Lam HY, et al. Clinical utility of genotyping resistance test on determining the mutation patterns in HIV-1 CRF01 AE and subtype B patients receiving antiretroviral therapy in Hong Kong. J Clin Virol 2006;35:454–7.