- Email: [email protected]
Evaluation of CoA biosynthesis proteins of Mycobacterium tuberculosis as potential drug targets
Tuberculosis 92 (2012) 521e528
Contents lists available at SciVerse ScienceDirect
Tuberculosis journal homepage: http://intl.elsevierhealth.com/journals/tube
DRUG DISCOVERY AND RESISTANCE
Evaluation of CoA biosynthesis proteins of Mycobacterium tuberculosis as potential drug targets Anisha Ambady a, Disha Awasthy a, Reena Yadav a, Santhoshi Basuthkar, Kothandaraman Seshadri, Umender Sharma* AstraZeneca R & D, Infection iMed, “Avishkar”, Bellary Road, Hebbal, Bangalore, India
a r t i c l e i n f o
s u m m a r y
Article history: Received 21 May 2012 Received in revised form 30 July 2012 Accepted 2 August 2012
Coenzyme A biosynthesis pathway proteins are potential targets for developing inhibitors against bacteria including Mycobacterium tuberculosis. We have evaluated two enzymes in this pathway: phosphopantetheine adenylyltransferase (CoaD) and dephospho CoA kinase (CoaE) for essentiality and selectivity. Based on the previous transposon mutagenesis studies, coaD had been predicted to be a nonessential gene in M. tuberculosis. Our bioinformatics analysis showed that there is no other functional homolog of this enzyme in M. tuberculosis, which suggests that coaD should be an essential gene. In order to get an unambiguous answer on the essentiality of coaD, we attempted inactivation of coaD in wild type and merodiploid backgrounds. It was found that coaD could only be inactivated in the presence of an additional gene copy, confirming it to be an essential gene. Using a similar approach we found that CoaE was also essential for the survival of M. tuberculosis. RT-PCR analysis showed that both coaD and coaE were transcribed in M. tuberculosis. Amino acids alignment and phylogenetic analysis showed CoaD to be distantly related to the human counterpart while CoaE was found to be relatively similar to the human enzyme. Analysis of CoaD and CoaE structures at molecular level allowed us to identify unique residues in the Mtb proteins, thus providing a selectivity handle. The essentiality and selectivity analysis combined with the published biochemical characterization of CoaD and CoaE makes them suitable targets for developing inhibitors against M. tuberculosis. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: Coenzyme A biosynthesis Essentiality Drug target Knockout Homology
1. Introduction As a result of spread of HIV, the prevalence of tuberculosis (TB) has grown all over the world especially in underdeveloped countries.1 The bacteria causing TB, Mycobacterium tuberculosis (Mtb), exists in a variety of lesions representing multiple physiological states inside the human body.2 This feature of Mtb probably makes it one of the most difficult infections to treat. The current complexity of TB treatment comprising a combination of drugs for at least six months often results in non-compliance on the part of the patients. As a result of this the bacteria could be exposed to suboptimal concentrations of the drugs leading to selection of drug resistant bacteria. The percentage of Mtb strains resistant to one or more drugs has been steadily growing over the past few decades.3
* Corresponding author. Present address: Gangagen Biotechnologies Pvt. Ltd., No. 12, 5th Cross, Raghavendra Layout, Tumkur Road, Yeshwantpur, Bangalore, India. Tel.: þ91 (0) 80 40621300; fax: þ91 (0) 80 40621329. E-mail address: [email protected] (U. Sharma). a The first three authors have contributed equally to this work. 1472-9792/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.tube.2012.08.001
As most of the current anti-TB drugs are slowly becoming ineffective on drug resistant strains, there is an urgent need for discovering new anti-TB drugs. Since the new drugs are expected to work on drug resistant strains of Mtb, new targets and pathways offer better chances of obtaining novel inhibitors being equally effective on sensitive and resistant strains of Mtb. Coenzyme A (CoA) is a universal co-factor required by prokaryotic and eukaryotic cells for various physiological processes. CoA biosynthesis in bacteria has been proposed to be an attractive pathway for developing inhibitors.4 CoA is synthesized from pantothenate in 5 enzymatic steps. These 5 steps as shown in Figure 1 are: 1. phosphorylation of pantothenate to 40 -phosphopantothenate by pantothenate kinase (PanK or CoaA), 2. addition of cysteine by phosphopantothenoylcysteine synthetase (PPCS or CoaB) to generate 40 -phospho-N-pantothenoylcysteine, 3. decarboxylation by phosphopantothenoylcysteine decarboxylase (PPCDC or CoaC) to 40 -phosphopantetheine, 4. adenylation by phosphopantetheine adenylyltransferase (PPAT or CoaD) to form dephosphoCoA, and 5. phosphorylation by dephosphocoenzyme A kinase (DPCK or CoaE) to generate CoA.5 In many bacteria, including Mtb,
522
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
2. Materials and methods
Pantothenate
CoaA 4’-phosphopantothenate
2.1. Mtb growth conditions The Mtb cultures were routinely grown in 7H9 medium (Difco) containing albumin dextrose complex (ADC). Hygromycin (50 mg/ml) or kanamycin (20 mg/ml) was added to the culture medium when required.
CoaBC 2.2. Plasmids and strains
4′ -phospho-N-pantothenoylcysteine The plasmids and strains used in this study are listed in Table 1.
CoaBC 2.3. Gene knockout (KO) plasmid constructs
4′ -phosphopantetheine
CoaD
dephospho-CoA
CoaE CoA Figure 1. Steps in CoA biosynthesis in M. tuberculosis showing various enzymes in shaded boxes. In Mtb CoaB and CoaC functions are present on a single protein, CoaBC.
CoaB and CoaC are fused together to form a bi-functional protein.6 Though, genes coding for enzymes of this pathway are known to be essential in various bacteria,4,7 prevalence of functional redundancy of proteins in Mtb might render some of them non-essential.8 In CoA biosynthesis pathway, out of the two type I and type III pantothenate kinases (CoaA and CoaX), only CoaA was found to be essential for the survival of Mtb.9 The CoaX was shown to be nonessential and biochemically inactive. This suggested that it will only be possible to inhibit the growth of Mtb with CoaA inhibitors and not with that of CoaX. Though both CoaD and CoaE are expected to be essential enzymes in this pathway, transposon mutagenesis data had indicated that CoaD was not essential in Mtb.10 The nonessentiality could either be attributed to the functional redundancy of phosphopantetheine adenylyltransferase in this organism or could result from inherent inaccuracy associated with essentiality determination using the technique of transposon mutagenesis. It is noteworthy that recombinant CoaD and CoaE of Mtb purified from Escherichia coli have been shown to be enzymatically active.11,12 Apart from essentiality and biochemical feasibility (availability of soluble active protein, kinetic and binding assays, structure etc.) selectivity forms important criteria for choosing a target to develop inhibitors. Since, CoA biosynthesis pathway is functional in humans,13,14 in order to discover specific inhibitors it is important that the Mtb enzymes are sufficiently different from the human counterparts. All the enzymes of the human CoA biosynthesis pathway have been identified; it was found that CoaD and CoaE components are fused together into a single protein, CoAsy.14 Structural characterization of Mtb CoaD has been reported,11,15 but no structures are available for Mtb CoaE. The protein structure of mouse CoAsy, a close homolog of human CoAsy, is available (PDB code: 2F6R, bi-functional coenzyme A synthase), which can be utilized for finding similarities and differences with CoaD and CoaE of Mtb.
The KO construct for coaD consisted of 607 bp upstream region of coaD, 335 bp of coaD, a deletion of 151 bp in coaD (starting from 182nd base of gene) followed by 679 bp of downstream region. The final construct was cloned into BglIIeNcoI sites of pAZI290 to obtain pAZI0286. Similarly the coaE KO construct consisted of 634 bp of region upstream of coaE, 173 bp of coaE gene, a deletion of 181 bp in coaE (starting from 173 bp) followed by 834 bp of remaining part of coaE. The construct was cloned into BglIIeNcoI sites of pAZI0290 to obtain pAZI0287. For making complementation constructs full length coaD and coaE genes were separately cloned behind hsp60 promoter of pAZI272 using EcoRIeHindIII sites to obtain pAZI0292 and pAZI0299 respectively. The sequences of the cloned DNA fragments were confirmed by sequencing (Microsynth). 2.4. Gene KO of coaD and coaE A two step method involving a single cross over (SCO) followed by a double cross over (DCO) described earlier9,16 was followed for KO of coaD and coaE genes. pAZI0286 and pAZI0287 were individually electroporated into Mtb and the colonies were selected in the presence of hygromycin. The SCO recombinants identified by PCR were allowed to undergo DCO recombination by growing the cultures in the absence of hygromycin and plating them in the presence of 2% sucrose. The colonies growing in sucrose containing
Table 1 Strains and plasmids used in this study. Strain/plasmid E. coli DH5a
Genotype/relevant features
endA1, hsdR17, supE44, recA1, relA1, (lacZYAeargF) M. tuberculosis H37Rv Virulent strain of Mtb (ATCC 27294) pAZI0290 E.coli ori, sacB, Hygr pAZI272 Integrating mycobacterial expression vector with hsp70 promoter pAZI0286 1.9 kb DNA fragment with DcoaD flanked by upstream and downstream sequences cloned into BglIIeNcoI sites of pAZI0290 pAZI0287 1.9 kb DNA fragment with DcoaE flanked by upstream and downstream sequences cloned into BglIIeNcoI sites of pAZI0290 pAZI0292 coaD gene of Mtb cloned into EcoRIeHindIII sites of pAZI0272 pAZI0299 coaE gene of Mtb cloned into EcoRIeHindIII sites of pAZI0272
Source/reference Lab stock Lab stock (Awasthy et al., 2010)9 (Awasthy et al., 2010)9
This study
This study
This study This study
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
plates were analyzed for the loss of the plasmid by PCR. The gene KOs were confirmed by a combination of PCRs (Figures 3 and 4). 2.5. DNA amplification by PCR The SCO and DCO recombinants of Mtb were screened by colony PCR as described earlier.9 Denaturation and extension reactions were performed at 94 C and 72 C respectively. The annealing temperature and extension time for each PCR were decided by taking into account the Tm of the primer pair and length of the PCR product respectively. The sequences of primers used for PCR amplifications are shown in Table 2.
RNA from Mtb culture was isolated and purified as described earlier.9 Purified RNA (1 mg) was used to synthesize cDNA by a reverse transcriptase (RT) reaction using reverse primers (434 or 431), 0.5 mM dNTP mix and Superscript II (Invitrogen) at 37 C for 60 min in a 30 ml reaction volume. An RT-minus reaction was set up as a negative control. An aliquot of 1.5 ml of the RT reaction mix was further used to set up the individual PCRs to amplify fragments of coaD and coaE using PCR conditions described above. 2.7. Bioinformatics analysis Bioinformatics analysis comprised multiple sequence alignments, residue mapping, phylogenetic analysis and structural analysis. Multiple sequence alignment and phylogenetic tree were generated using ClustalX2.1,17 residues were mapped using Genedoc version 2.6.00218 and the trees viewed using TreeView 1.6.6.19 Residue range of the Mtb CoaE domains was deciphered from base range20 and mapped on to the amino acid sequence using Artemis tool.21 Sub-domains of CoaE positions were mapped from the Haemophilus influenza CoaE protein structure.22 2.8. Homology modeling De-phospho kinase domain (residues 1e184) of Mtb CoaE was modeled using Prime 2.2 in Schrodinger suite of applications.23 Thermotoga maritima CoaE structure (PDB code: 2GRJ) was used as the template, as it is the only structural homolog of Mtb CoaE containing natively bound De-phospho CoA (DCoA). All default parameters in Prime 2.2 were used to build the model. The model was validated using standard protocols available within the Prime module. Very few residues fell outside Ramachandran allowed region and none of them belonged to the substrate binding site.
Table 2 Sequences of primers used for PCR amplification of coaD and coaE genes.
coaD 433(F) 434(F) 435(R) 436(R) 503(R) coaE 429(F) 430(F) 431(R) 432(R) 504(F)
2.9. Docking of DCoA into Mtb CoaE To study the interactions of the substrate, DCoA was docked into the modeled structure of Mtb CoaE. DCoA was prepared using Ligprep to add hydrogens, fix atom types and correct bond orders.23 The molecular grid was mapped on the DCoA binding site. Molecular docking was performed using Glide 5.6 of Maestro 9.1 in Schrodinger suite of applications. No constraints were applied during the grid generation or in the docking process. The docking score, GS-score thus obtained, ranged from 4 to 8.3 for different poses of DCoA. 3. Results 3.1. Is there a functional redundancy of phosphopantetheine adenylyltransferase and dephospho CoA kinase in Mtb?
2.6. RT-PCR
Primer no
523
Sequence (50 e30 ) ACTTGACCCGGATCATCGGCG GAGCGGATCGCGATGGTCAAG GACGACACGAACGAATACCGT CCGGTCAACGTGAACTGTCCG AGAGAGGTACCCAATGTTCAC ACGTCGACATGGACCGTGAGC CGCTGGTCGACGCGTTCGGTC GTAGCTCGACGTCGGCGTGCA ACGCCAGTGCACCGCATCCGC CAACGAATGGCTTGAGGGATT
Though only one gene coding for CoaD has been annotated in Mtb (KEGG database), transposon mutagenesis data indicated that coaD could be a non-essential gene.10 In the same study coaE gene was predicted to be essential. Since adenyltransferase is an essential reaction for the biosynthesis of CoA, it suggested that either some other protein could complement the function in the absence of CoaD or the transposon mutagenesis based essentiality information was incorrect. In order to resolve the issue of essentiality we performed detailed genetic analysis of coaD and coaE genes and also checked whether these genes were transcriptionally active in Mtb. 3.2. Both coaD and coaE genes are transcribed in Mtb Genetic organization of coaD (Rv2965c) showed that it was a single gene and was not part of any operon (Figure 2A). On the other hand coaE (Rv1631) is present immediately downstream to rpsA (Rv1630), an essential ribosomal protein coding gene. In order to ascertain that the coaD and coaE genes are transcribed in Mtb, we deployed RT-PCR for detecting the transcribed mRNA. As seen in Figure 2C, DNA bands of expected size were seen in amplified DNA samples obtained from cDNA of coaD and coaE transcripts (236 bp and 267 bp respectively). Genomic DNA of Mtb used a positive control showed DNA bands of same size as seen with cDNA samples, whereas no bands were observed in samples lacking cDNA or Taq polymerasae. This showed that the DNA bands seen in RTPCR reactions were specifically obtained from the coaD or coaE transcripts. Thus, both coaD and coaE genes are actively transcribed in Mtb and are likely to play a role in the physiology of this organism. 3.3. Gene inactivation strategy In order to avoid any polar effects on transcription of downstream genes as result of inserting an antibiotic resistance marker into coaD or coaE genes, we decided to introduce marker-less deletions in these genes. The method followed for gene knockout (KO) consisted of integrating a suicide plasmid into the gene locus by a single cross over (SCO) recombination event followed by resolution of the co-integrate and loss of the plasmid by a double cross over (DCO) recombination.16 The gene KO of coaD and coaE was attempted in wild type (WT) and merodiploid backgrounds in parallel. The ability to generate gene KOs only in merodiploid background was taken as an evidence of essentiality of the gene. 3.4. coaD can be inactivated only in a merodiploid background The Mtb SCO recombinant (coaD/SCO) was identified by PCR based screening using primers indicated in Figure 3A. The SCO
524
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
A coaD Rv2966
rpsA
B
pca
coaE
435
434
coaD 430
431
coaE
C
267 bp 236 bp
Figure 2. Organization and transcript analysis of coaD and coaE genes of M. tuberculosis. A. Genomic organization of coaD and coaE genes based on KEGG database. B. Position of primers used for RT-PCR of coaD and coaE genes. C. Transcript analysis of coaD (left panel) and coaE (right panel) genes by RT-PCR. Lanes: 1. Genomic DNA, 2. RT template, 3. RTminus template, 4. No template and 5. Molecular size marker (100 bp ladder).
recombinant, coaD/SCO, was allowed to undergo recombination as described in Materials and methods. Screening of 100 colonies for the loss of plasmid by monitoring the presence of hyg or sacB markers by PCR (data not shown), indicated that 70 colonies had lost the plasmid (Table 3; overall 70% recombination frequency). Analysis of these colonies by gene specific primers indicated in Figure 3A showed that all the colonies had retained the WT copy of coaD gene (Figure S1A). This suggested the introduction of a deletion in coaD gene leads to loss of viability and thus no colonies with a mutant copy of coaD gene could grow. In order to prove this point, the gene KO was attempted in the presence of two copies of coaD genes. Under these conditions it was expected that it should be possible to inactivate the coaD gene as the additional copy would now provide the CoaD protein for the cellular function. For this, a merodiploid strain of Mtb was constructed (coaD/mero) which carried coaD gene in att site under hsp60 promoter. The coaD/mero strain was allowed to undergo DCO recombination in a manner described earlier for the coaD/ SCO. PCR screening revealed that coaD/mero strain lost the plasmid at a frequency comparable to coaD/SCO (Table 3, overall 85% recombination frequency). Analysis of colonies by gene specific primers revealed that 50% had retained the wild type copy of the gene while the remaining 50% carried a deleted copy
Table 3 Summary of gene KO of coaD and coaE genes in Mtb. Mtb strain
No of colonies screened
% Recombination*
% of KO colonies
coaD/SCO coaD/mero coaE/SCO coaE/mero
100 20 146 51
70% 85% 85% 92%
Nil 50% Nil 66%
*
Based on the % of hyg, sacB colonies in sucrose containing plates.
of coaD (Figure S1B). The presence of deleted copy of coaD gene in two colonies was further confirmed by PCR using additional pairs of primers (Figure 3C). This clearly showed that frequency of recombination at coaD site was quite high and inability to inactivate coaD in the WT background was not because of poor recombination frequency at this locus. This proved that coaD is an essential gene in Mtb and at least one copy of this gene is needed for the survival of this organism. 3.5. CoaE is also essential for in vitro survival of Mtb Next we attempted inactivation of coaE gene in wild type and merodiploid backgrounds using a strategy similar to that described above for coaD. The SCO recombinant (coaE/SCO) was confirmed by PCR using primer pairs shown in Figure 4A. As seen in Table 3, in coaE/SCO background, in spite of a very high frequency of recombination (85%), all the 146 putative DCO colonies screened showed the presence of a wild type copy of coaE gene (Figure S2A), This suggested that recombinant cells receiving a deleted copy of coaE upon allele exchange were not viable. In order to substantiate this hypothesis, DCO colonies obtained in a merodiploid background (coaE/mero) were analyzed for the presence of deleted copy of coaE gene. As seen in Table 3, the DCO recombination frequency (92%) in merodiploid background was comparable to that obtained in WT background. Upon further analysis it was found that 34% of DCO colonies had retained the WT copy of the gene while the remaining 66% has acquired a deleted coaE upon allele exchange (Figure S2B). The presence of a deleted copy of coaE in two colonies was further confirmed with PCR using additional pairs of primers (Figure 4C). This proved that CoaE function is also critical for the survival of Mtb and at least one of copy of coaE must be present in the cell for maintaining the viability of the cell.
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
525
Figure 3. Gene KO of coaD. A. Diagram showing position of primers used for confirmation of SCO and DCO recombinants by PCR. B. Expected sizes of PCR products using various combinations of primers. C. Confirmation of SCO and DCO recombinants by PCR. Lanes: 1. Mtb genomic DNA, 2. coaD/KO (No 4), 3. CoaD/KO(No 15), 4. coaD/SCO, 5. 100 bp molecular size marker.
3.6. Selectivity analysis of CoaD and CoaE proteins of Mtb by sequence alignments and phylogenetic relatedness Since CoA biosynthesis pathway is present in humans as well, it is important to confirm that there are sufficient differences between the mycobacterial and the human enzymes to allow selective inhibition of Mtb enzymes. As shown in Figure 5, amongst the three domains, the N-terminal domain of human CoAsy does not align with either CoaD or CoaE of Mtb (Figures S3 and S4), while the central domain aligns with CoaD of Mtb and other bacteria though the overall identity was found to be low (14e20% identity). The C-terminal domain of the human CoAsy, has significantly
higher similarity (22e31% identity) with CoaE of Mtb and other bacteria (Figure S4). The HXXH motif found in the nucleotidyltransferase superfamily of the central domain of human CoAsy is not conserved in bacterial CoaD (Figure S3). Further the CoA binding site residues which are well conserved amongst the bacteria, exhibit only 60% conservation in the corresponding site of the human protein (Figure S3). The Mtb CoaE protein consisting of 407 amino acid residues is longer than most of the prokaryotic CoaE proteins (Figure 5). In addition to the dephospho-CoA kinase domain (residues 1e181), the Mtb CoaE carries an extra stretch of residues in the C-terminal end (residues 185e387 termed UPF0157) which are
Figure 4. Gene KO of coaE. A. Diagram showing position of primers used for confirmation of SCO and DCO recombinants by PCR. B. Expected sizes of PCR products using various combinations of primers. C. Confirmation of SCO and DCO recombinants by PCR. Lanes: 1. coaE/KO (No 3), 2. coaE/KO (No 4), 3. Mtb genomic DNA, 4. coaE/SCO, 5. coaE/mero, 6. 100 bp (middle panel) or 500 bp (left and right panels) molecular size marker.
526
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
Figure 5. Schematic representation of domain organization of Mtb CoaD, CoaE and human CoAsy. % Amino acid identities (% ID) of central and c-terminal domains of human CoAsy to Mtb CoaD and CoaE respectively have been shown. In addition the % identities of various sub-domains of Mtb CoaE to the central domain of human CoAsy have also been shown.
thought to be important for the folding of this protein.12 As shown in Figure 5, the dephospho-CoA kinase domain of Mtb CoaE consists of three sub-domains; the nucleotide-binding, the substratebinding and the lid domain. Amongst the sub-domains, the nucleotide binding domain shows highest identity (60%) to the corresponding domain in human CoAsy (Figure 5). The Walker motif present in this domain is well conserved between the human and the bacterial enzymes (Figure S4). Substrate binding domain and the lid domain have an identity of approximately 26% and 54% with the human CoAsy respectively (Figure 5). Phylogenetic analysis showed that CoaD of Mtb is closely related to Gram negative bacteria whereas the human CoAsy is close to the CoaD of Gram positive organisms (Figure S5). On the other hand Mtb CoaE was found to be more closely related to CoaE of Gram positives and to the CoaE domain of human CoAsy (Figure S6). These observations corroborate the findings made in the protein similarity analysis of CoaD and CoaE by multiple sequence alignment. 3.6.1. Homology between Mtb CoaD and human CoAsy: structure based selectivity There are several amino acid residues in the vicinity of the CoA binding site of Mtb CoaD which are different from the residues in human CoAsy (Figure 6A). Glu98, Ser9, Val73 and Ser128 show hydrogen bonding interactions with the substrate. Of these, the side chain interaction of Glu98 with CoA assumes significance as in human CoAsy it is replaced by a residue with different charge character (Lys330). Although the corresponding residues for the positions of Val73 and Ser128 are different in the human enzyme, there may not be a selectivity advantage as the interactions with the substrate are made only through backbone contacts. The presence of other selective residues lining the binding site (e.g., Lys131, Ser127, Tyr97, Asn105 and Val74), although not making direct interactions with the substrate, can make collective influence in terms of non-specific secondary interactions or in terms of subtle changes in the binding site geometry affecting size, shape and electrostatic nature of the pocket. Also, the catalytic Lys41 residue
present at the tip of the solvent channel24 (not seen in Figure 6A), is replaced by Leu231 in human CoAsy, thus offering a selectivity handle. 3.6.2. Homology between Mtb CoaE and human CoAsy: structure based selectivity There are no structures available for Mtb CoaE; the closest structural homologs in the PDB database are CoaE from organisms such as E. coli (PDB code: 1VHL), H. influenza (PDB code: 1JJV) and T. maritima (PDB code: 2GRJ) having an identity of 38%, 37% and 36% respectively with Mtb CoaE.22,25 In order to study the selectivity at the binding site, a homology model of Mtb CoaE was built based on T. maritima CoaE (PDB code: 2GRJ) as the template structure. DCoA was docked at the binding region detected by SiteMap. Residues lying within 5 A radius from DCoA and ATP were considered as the binding site region for the purpose of selectivity comparisons. As seen in Figure 6B, Gln159, Arg36, Arg66 and Arg145 participate in hydrogen bonding interactions with DCoA. Of these amino acid residues, a selectivity handle at the position of Arg145 arises owing to its replacement by Asp504 in human CoAsy. Further differentiation comes from the guanidium side chain of Arg36 replaced by imidazole ring of His393 in human CoAsy, offering possible differences in ionic and steric environment at the binding site. Although not very crucial, at the second sphere of the residues in the vicinity, Arg80, Ala158, Asp32 and Ile112 have different counter parts in human CoAsy. 4. Discussion In target based drug discovery of anti-TB compounds the following attributes play an important role: essentiality, biochemical feasibility (availability of soluble active protein, assays, structure etc) and selectivity versus human enzyme. Since biochemical feasibility of CoaD and CoaE had been established earlier,11,12 we decided to validate the other two important parameters, essentiality and selectivity of these two proteins. Bioinformatics analysis showed that, unlike pantothenate kinase (CoaA and CoaX), there is
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
527
Figure 6. Selectivity analysis of substrate binding amino acid residues of Mtb CoaD (PDB code: 3LCJ) and CoaE (homology model). The figures were generated using PyMol. Amino acid residues lying within 5 A distance of the substrate are shown. A. CoaD structure with bound CoA. B. Homology model of CoaE with bound DCoA and ADP. The following color codes have been followed to show homology or lack of it to the corresponding residues in the human CoAsy: Dark blue e identical with CoAsy, Cyan e similar to CoAsy, Red e different from CoAsy. Amino acid similarity definitions are same as in ClustalW2.17 H-bond interaction and hydrophobic interactions have been indicated by brown dotted lines and brown lines respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
no functional homologs of CoaD or CoaE in Mtb. Our essentiality analysis by targeted gene inactivation clearly demonstrated that both coaD and coaE genes are essential for the survival of Mtb. The possible reason for the non-essential nature of coaD reported in an earlier study,10 could be that the transposon insertion might have taken place in the extreme 30 region of gene coding the C-terminal amino acids of CoaD whose absence does not affect the CoaD activity. Thus in respect of CoaD essentiality, Mtb is similar to other bacteria (e.g., E. coli, Streptococcus mutans) in which coaD or coaE genes have been found to be essential.26,27 Active transcription of
coaD and coaE genes suggests that both the genes play a role in the physiology of Mtb. Our study rules out the possibility of existence of an alternate pathway for synthesis of CoA. Since bacteria are unable to acquire either dephospho CoA or CoA from the growth environment,28 inhibition of any of these enzymes in the pathway is expected to lead to suppression of bacterial growth. Since all essential proteins may not be vulnerable targets,29,30 protein depletion studies by knockdown of CoaD and CoaE will help in assessing the vulnerability of this pathway to chemical inhibition.
528
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
Successful isolation of potent inhibitors of CoaD of E. coli reported in an earlier study31 shows that small molecules are able to bind to this protein with reasonable affinity, i.e., the proteins is druggable. Owing to the structural similarity between CoaD of Mtb and E. coli, the Mtb protein can also be expected to be druggable. As a consequence of low similarity of CoaD of Mtb with the human enzyme observed at the level of amino acid sequence and by phylogenetic analysis, the inhibitors of this enzyme are likely to be selective for Mtb enzyme, thus lowering the chances of any toxicity issues. The presence of unique residues in CoA binding site of CoaD of Mtb (e.g., Glu98) provides a selective handle for designing specific inhibitors. Though overall similarity of Mtb CoaE to the human CoAsy is higher than seen with CoaD, analysis of molecular interactions in the substrate binding site showed the presence of unique residues which can potentially be exploited for selectivity. Based on the published data on biochemical characterization of Mtb CoaD and CoaE11,12 and our analysis on essentiality and selectivity it can be concluded that both these proteins are potential targets for discovery of novel anti-TB compounds. Acknowledgments We thank M. Prashanti and Manoranjan Panda for giving suggestions for improving the manuscript. We also thank the anonymous reviewers for providing critical inputs and suggestions. Ethical approval: Funding:
Not required.
None.
Competing interests:
None declared.
Appendix A. Supplementary material Supplementary data related to this article can be found online at http://dx.doi.org/10.1016/j.tube.2012.08.001. References 1. Wells CD, Cegielski JP, Nelson LJ, Laserson KF, Holtz TH, Finlay A, Castro KG, Weyer K. HIV infection and multidrug-resistant tuberculosis: the perfect storm. J Infect Dis 2007;196(Suppl.):S86e107. 2. Barry 3rd CE, Boshoff HI, Dartois V, Dick T, Ehrt S, Flynn J, Schnappinger D, Wilkinson RJ, Young D. The spectrum of latent tuberculosis: rethinking the biology and intervention strategies. Nat Rev Microbiol 2009;7:845e55. 3. Chan ED, Iseman MD. Multidrug-resistant and extensively drug-resistant tuberculosis: a review. Curr Opin Infect Dis 2008;21:587e95. 4. Gerdes S, Scholle MD, D’Souza M, Bernal A, Baev MV, Farrell M, Kurnasov OV, Daugherty MD, Mseeh F, Polanuyer BM, Campbell JW, Anantha S, Shatalin KY, Chowdhury SA, Fonstein MY, Osterman AL. From genetic footprinting to antimicrobial drug targets: examples in cofactor biosynthetic pathways. J Bacteriol 2002;184:4555e72. 5. Leonardi R, Zhang YM, Rock CO, Jackowski S. Coenzyme A: back in action. Prog Lipid Res 2005;44:125e53. 6. Strauss E, Kinsland C, Ge Y, McLafferty FW, Begley TP. Phosphopantothenoylcysteine synthetase from Escherichia coli. Identification and characterization of the last unidentified coenzyme A biosynthetic enzyme in bacteria. J Biol Chem 2001;276:13513e6. 7. Spry C, Kirk K, Saliba KJ. Coenzyme A biosynthesis: an antimicrobial drug target. FEMS Microbiol Rev 2008;32:56e106. 8. Sharma U. Current possibilities and unresolved issues of drug target validation in Mycobacterium tuberculosis. Expert Opin Drug Discov 2011;6:1171e86. 9. Awasthy D, Ambady A, Bhat J, Sheikh G, Ravishankar S, Subbulakshmi V, Mukherjee K, Sambandamurthy V, Sharma U. Essentiality and functional analysis of type I and type III pantothenate kinases of Mycobacterium tuberculosis. Microbiology 2010;156:2691e701.
10. Sassetti CM, Boyd DH, Rubin EJ. Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol 2003;48:77e84. 11. Wubben TJ, Mesecar AD. Kinetic, thermodynamic, and structural insight into the mechanism of phosphopantetheine adenylyltransferase from Mycobacterium tuberculosis. J Mol Biol 2010;404:202e19. 12. Walia G, Kumar P, Surolia A. The role of UPF0157 in the folding of M. tuberculosis dephosphocoenzyme A kinase and the regulation of the latter by CTP. PLoS One 2009;4:e7645. 13. Aghajanian S, Worrall DM. Identification and characterization of the gene encoding the human phosphopantetheine adenylyltransferase and dephosphoCoA kinase bifunctionalenzyme (CoA synthase). Biochem J 2002;365: 13e8. 14. Zhyvoloup A, Nemazanyy I, Babich A, Panasyuk G, Pobigailo N, Vudmaska M, Naidenov V, Kukharenko O, Palchevskii S, Savinska L, Ovcharenko G, Verdier F, Valovka T, Fenton T, Rebholz H, Wang ML, Shepherd P, Matsuka G, Filonenko V, Gout IT. Molecular cloning of CoA synthase. The missing link in CoA biosynthesis. J Biol Chem 2002;277:22107e10. 15. Timofeev VI, Smirnova EA, Chupova LA, Esipov RS, Kuranova IP. Preparation of the crystal complex of phosphopantetheine adenylyltransferase from Mycobacterium tuberculosis with coenzyme A and investigation of its threedimensional structure at 2.1-A frame resolution. Cryst Rep 2010;55:1050e9. 16. Parish T, Stoker NG. Use of a flexible cassette method to generate a double unmarked Mycobacterium tuberculosis tlyA plcABC mutant by gene replacement. Microbiology 2000;146:1969e75. 17. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. Clustal W and Clustal X version 2.0. Bioinformatics 2007;23:2947e8. 18. Nicholas KB, Nicholas Jr HB, Deerfield II DW. GeneDoc: analysis and visualization of genetic variation. EMBNEW News 1997;4:14. 19. Page RDM. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 1996;12:357e8. 20. Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE. The protein data bank. Nucleic Acids Res 2000;28: 235e42. 21. Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream MA, Barrell B. Artemis: sequence visualization and annotation. Bioinformatics 2000;16:944e5. 22. Obmolova G, Teplyakov A, Bonander N, Eisenstein E, Howard AJ, Gilliland G. Crystal structure of dephospho-Coenzyme A kinase from Haemophilus influenzae. J Struct Biol 2001;136:119e25. 23. Schrödinger Suite 2011. Protein preparation wizard; ligprep; prime version 2.2; glide 5.6. New York, NY: Schrödinger, LLC; 2011. 24. Morris VK, Izard T. Substrate-induced asymmetry and channel closure revealed by the apoenzyme structure of Mycobacterium tuberculosis phosphopantetheine adenylyltransferase. Protein Sci 2004;13:2547e52. 25. O’Toole N, Barbosa JA, Li Y, Hung LW, Matte A, Cygler M. Crystal structure of a trimeric form of dephosphocoenzyme A kinase from Escherichia coli. Protein Sci 2003;12:327e36. 26. Freiberg C, Wieland B, Spaltmann F, Ehlert K, Brötz H, Labischinski H. Identification of novel essential Escherichia coli genes conserved among pathogenic bacteria. J Mol Microbiol Biotechnol 2001;3:483e9. 27. Wang B, Kuramitsu HK. Inducible antisense RNA expression in the characterization of gene functions in Streptococcus mutans. Infect Immun 2005;73: 3568e76. 28. Balibar CJ, Hollis-Symynkywicz MF, Tao J. Pantethine rescues phosphopantothenoylcysteine synthetase and phosphopantothenoylcysteine decarboxylase deficiency in Escherichia coli but not in Pseudomonas aeruginosa. J Bacteriol 2011;193:3304e12. 29. Carroll P, Faray-Kele MC, Parish T. Identifying vulnerable pathways in Mycobacterium tuberculosis using a knock-down approach. Appl Environ Microbiol 2011;77:5040e3. 30. Wei JR, Krishnamoorthy V, Murphy K, Kim JH, Schnappinger D, Alber T, Sassetti CM, Rhee KY, Rubin EJ. Depletion of antibiotic targets has widely varying effects on growth. Proc Natl Acad Sci U S A 2011;108:4176e81. 31. Zhao L, Allanson NM, Thomson SP, Maclean JK, Barker JJ, Primrose WU, Tyler PD, Lewendon A. Inhibitors of phosphopantetheine adenylyltransferase. Eur J Med Chem 2003;38:345e9.
Websites 32. GeneDoc [%3ca href¼http://www.nrbsc.org/gfx/genedoc/] website. 33. TreeView [%3ca href¼http://taxonomy.zoology.gla.ac.uk/rod/treeview.html] website. 34. TB database [%3ca href¼http://www.tbdb.org/] website. 35. MATLAB version 2010a. Natick, Massachusetts: The MathWorks Inc.; 2010.
Contents lists available at SciVerse ScienceDirect
Tuberculosis journal homepage: http://intl.elsevierhealth.com/journals/tube
DRUG DISCOVERY AND RESISTANCE
Evaluation of CoA biosynthesis proteins of Mycobacterium tuberculosis as potential drug targets Anisha Ambady a, Disha Awasthy a, Reena Yadav a, Santhoshi Basuthkar, Kothandaraman Seshadri, Umender Sharma* AstraZeneca R & D, Infection iMed, “Avishkar”, Bellary Road, Hebbal, Bangalore, India
a r t i c l e i n f o
s u m m a r y
Article history: Received 21 May 2012 Received in revised form 30 July 2012 Accepted 2 August 2012
Coenzyme A biosynthesis pathway proteins are potential targets for developing inhibitors against bacteria including Mycobacterium tuberculosis. We have evaluated two enzymes in this pathway: phosphopantetheine adenylyltransferase (CoaD) and dephospho CoA kinase (CoaE) for essentiality and selectivity. Based on the previous transposon mutagenesis studies, coaD had been predicted to be a nonessential gene in M. tuberculosis. Our bioinformatics analysis showed that there is no other functional homolog of this enzyme in M. tuberculosis, which suggests that coaD should be an essential gene. In order to get an unambiguous answer on the essentiality of coaD, we attempted inactivation of coaD in wild type and merodiploid backgrounds. It was found that coaD could only be inactivated in the presence of an additional gene copy, confirming it to be an essential gene. Using a similar approach we found that CoaE was also essential for the survival of M. tuberculosis. RT-PCR analysis showed that both coaD and coaE were transcribed in M. tuberculosis. Amino acids alignment and phylogenetic analysis showed CoaD to be distantly related to the human counterpart while CoaE was found to be relatively similar to the human enzyme. Analysis of CoaD and CoaE structures at molecular level allowed us to identify unique residues in the Mtb proteins, thus providing a selectivity handle. The essentiality and selectivity analysis combined with the published biochemical characterization of CoaD and CoaE makes them suitable targets for developing inhibitors against M. tuberculosis. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: Coenzyme A biosynthesis Essentiality Drug target Knockout Homology
1. Introduction As a result of spread of HIV, the prevalence of tuberculosis (TB) has grown all over the world especially in underdeveloped countries.1 The bacteria causing TB, Mycobacterium tuberculosis (Mtb), exists in a variety of lesions representing multiple physiological states inside the human body.2 This feature of Mtb probably makes it one of the most difficult infections to treat. The current complexity of TB treatment comprising a combination of drugs for at least six months often results in non-compliance on the part of the patients. As a result of this the bacteria could be exposed to suboptimal concentrations of the drugs leading to selection of drug resistant bacteria. The percentage of Mtb strains resistant to one or more drugs has been steadily growing over the past few decades.3
* Corresponding author. Present address: Gangagen Biotechnologies Pvt. Ltd., No. 12, 5th Cross, Raghavendra Layout, Tumkur Road, Yeshwantpur, Bangalore, India. Tel.: þ91 (0) 80 40621300; fax: þ91 (0) 80 40621329. E-mail address: [email protected] (U. Sharma). a The first three authors have contributed equally to this work. 1472-9792/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.tube.2012.08.001
As most of the current anti-TB drugs are slowly becoming ineffective on drug resistant strains, there is an urgent need for discovering new anti-TB drugs. Since the new drugs are expected to work on drug resistant strains of Mtb, new targets and pathways offer better chances of obtaining novel inhibitors being equally effective on sensitive and resistant strains of Mtb. Coenzyme A (CoA) is a universal co-factor required by prokaryotic and eukaryotic cells for various physiological processes. CoA biosynthesis in bacteria has been proposed to be an attractive pathway for developing inhibitors.4 CoA is synthesized from pantothenate in 5 enzymatic steps. These 5 steps as shown in Figure 1 are: 1. phosphorylation of pantothenate to 40 -phosphopantothenate by pantothenate kinase (PanK or CoaA), 2. addition of cysteine by phosphopantothenoylcysteine synthetase (PPCS or CoaB) to generate 40 -phospho-N-pantothenoylcysteine, 3. decarboxylation by phosphopantothenoylcysteine decarboxylase (PPCDC or CoaC) to 40 -phosphopantetheine, 4. adenylation by phosphopantetheine adenylyltransferase (PPAT or CoaD) to form dephosphoCoA, and 5. phosphorylation by dephosphocoenzyme A kinase (DPCK or CoaE) to generate CoA.5 In many bacteria, including Mtb,
522
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
2. Materials and methods
Pantothenate
CoaA 4’-phosphopantothenate
2.1. Mtb growth conditions The Mtb cultures were routinely grown in 7H9 medium (Difco) containing albumin dextrose complex (ADC). Hygromycin (50 mg/ml) or kanamycin (20 mg/ml) was added to the culture medium when required.
CoaBC 2.2. Plasmids and strains
4′ -phospho-N-pantothenoylcysteine The plasmids and strains used in this study are listed in Table 1.
CoaBC 2.3. Gene knockout (KO) plasmid constructs
4′ -phosphopantetheine
CoaD
dephospho-CoA
CoaE CoA Figure 1. Steps in CoA biosynthesis in M. tuberculosis showing various enzymes in shaded boxes. In Mtb CoaB and CoaC functions are present on a single protein, CoaBC.
CoaB and CoaC are fused together to form a bi-functional protein.6 Though, genes coding for enzymes of this pathway are known to be essential in various bacteria,4,7 prevalence of functional redundancy of proteins in Mtb might render some of them non-essential.8 In CoA biosynthesis pathway, out of the two type I and type III pantothenate kinases (CoaA and CoaX), only CoaA was found to be essential for the survival of Mtb.9 The CoaX was shown to be nonessential and biochemically inactive. This suggested that it will only be possible to inhibit the growth of Mtb with CoaA inhibitors and not with that of CoaX. Though both CoaD and CoaE are expected to be essential enzymes in this pathway, transposon mutagenesis data had indicated that CoaD was not essential in Mtb.10 The nonessentiality could either be attributed to the functional redundancy of phosphopantetheine adenylyltransferase in this organism or could result from inherent inaccuracy associated with essentiality determination using the technique of transposon mutagenesis. It is noteworthy that recombinant CoaD and CoaE of Mtb purified from Escherichia coli have been shown to be enzymatically active.11,12 Apart from essentiality and biochemical feasibility (availability of soluble active protein, kinetic and binding assays, structure etc.) selectivity forms important criteria for choosing a target to develop inhibitors. Since, CoA biosynthesis pathway is functional in humans,13,14 in order to discover specific inhibitors it is important that the Mtb enzymes are sufficiently different from the human counterparts. All the enzymes of the human CoA biosynthesis pathway have been identified; it was found that CoaD and CoaE components are fused together into a single protein, CoAsy.14 Structural characterization of Mtb CoaD has been reported,11,15 but no structures are available for Mtb CoaE. The protein structure of mouse CoAsy, a close homolog of human CoAsy, is available (PDB code: 2F6R, bi-functional coenzyme A synthase), which can be utilized for finding similarities and differences with CoaD and CoaE of Mtb.
The KO construct for coaD consisted of 607 bp upstream region of coaD, 335 bp of coaD, a deletion of 151 bp in coaD (starting from 182nd base of gene) followed by 679 bp of downstream region. The final construct was cloned into BglIIeNcoI sites of pAZI290 to obtain pAZI0286. Similarly the coaE KO construct consisted of 634 bp of region upstream of coaE, 173 bp of coaE gene, a deletion of 181 bp in coaE (starting from 173 bp) followed by 834 bp of remaining part of coaE. The construct was cloned into BglIIeNcoI sites of pAZI0290 to obtain pAZI0287. For making complementation constructs full length coaD and coaE genes were separately cloned behind hsp60 promoter of pAZI272 using EcoRIeHindIII sites to obtain pAZI0292 and pAZI0299 respectively. The sequences of the cloned DNA fragments were confirmed by sequencing (Microsynth). 2.4. Gene KO of coaD and coaE A two step method involving a single cross over (SCO) followed by a double cross over (DCO) described earlier9,16 was followed for KO of coaD and coaE genes. pAZI0286 and pAZI0287 were individually electroporated into Mtb and the colonies were selected in the presence of hygromycin. The SCO recombinants identified by PCR were allowed to undergo DCO recombination by growing the cultures in the absence of hygromycin and plating them in the presence of 2% sucrose. The colonies growing in sucrose containing
Table 1 Strains and plasmids used in this study. Strain/plasmid E. coli DH5a
Genotype/relevant features
endA1, hsdR17, supE44, recA1, relA1, (lacZYAeargF) M. tuberculosis H37Rv Virulent strain of Mtb (ATCC 27294) pAZI0290 E.coli ori, sacB, Hygr pAZI272 Integrating mycobacterial expression vector with hsp70 promoter pAZI0286 1.9 kb DNA fragment with DcoaD flanked by upstream and downstream sequences cloned into BglIIeNcoI sites of pAZI0290 pAZI0287 1.9 kb DNA fragment with DcoaE flanked by upstream and downstream sequences cloned into BglIIeNcoI sites of pAZI0290 pAZI0292 coaD gene of Mtb cloned into EcoRIeHindIII sites of pAZI0272 pAZI0299 coaE gene of Mtb cloned into EcoRIeHindIII sites of pAZI0272
Source/reference Lab stock Lab stock (Awasthy et al., 2010)9 (Awasthy et al., 2010)9
This study
This study
This study This study
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
plates were analyzed for the loss of the plasmid by PCR. The gene KOs were confirmed by a combination of PCRs (Figures 3 and 4). 2.5. DNA amplification by PCR The SCO and DCO recombinants of Mtb were screened by colony PCR as described earlier.9 Denaturation and extension reactions were performed at 94 C and 72 C respectively. The annealing temperature and extension time for each PCR were decided by taking into account the Tm of the primer pair and length of the PCR product respectively. The sequences of primers used for PCR amplifications are shown in Table 2.
RNA from Mtb culture was isolated and purified as described earlier.9 Purified RNA (1 mg) was used to synthesize cDNA by a reverse transcriptase (RT) reaction using reverse primers (434 or 431), 0.5 mM dNTP mix and Superscript II (Invitrogen) at 37 C for 60 min in a 30 ml reaction volume. An RT-minus reaction was set up as a negative control. An aliquot of 1.5 ml of the RT reaction mix was further used to set up the individual PCRs to amplify fragments of coaD and coaE using PCR conditions described above. 2.7. Bioinformatics analysis Bioinformatics analysis comprised multiple sequence alignments, residue mapping, phylogenetic analysis and structural analysis. Multiple sequence alignment and phylogenetic tree were generated using ClustalX2.1,17 residues were mapped using Genedoc version 2.6.00218 and the trees viewed using TreeView 1.6.6.19 Residue range of the Mtb CoaE domains was deciphered from base range20 and mapped on to the amino acid sequence using Artemis tool.21 Sub-domains of CoaE positions were mapped from the Haemophilus influenza CoaE protein structure.22 2.8. Homology modeling De-phospho kinase domain (residues 1e184) of Mtb CoaE was modeled using Prime 2.2 in Schrodinger suite of applications.23 Thermotoga maritima CoaE structure (PDB code: 2GRJ) was used as the template, as it is the only structural homolog of Mtb CoaE containing natively bound De-phospho CoA (DCoA). All default parameters in Prime 2.2 were used to build the model. The model was validated using standard protocols available within the Prime module. Very few residues fell outside Ramachandran allowed region and none of them belonged to the substrate binding site.
Table 2 Sequences of primers used for PCR amplification of coaD and coaE genes.
coaD 433(F) 434(F) 435(R) 436(R) 503(R) coaE 429(F) 430(F) 431(R) 432(R) 504(F)
2.9. Docking of DCoA into Mtb CoaE To study the interactions of the substrate, DCoA was docked into the modeled structure of Mtb CoaE. DCoA was prepared using Ligprep to add hydrogens, fix atom types and correct bond orders.23 The molecular grid was mapped on the DCoA binding site. Molecular docking was performed using Glide 5.6 of Maestro 9.1 in Schrodinger suite of applications. No constraints were applied during the grid generation or in the docking process. The docking score, GS-score thus obtained, ranged from 4 to 8.3 for different poses of DCoA. 3. Results 3.1. Is there a functional redundancy of phosphopantetheine adenylyltransferase and dephospho CoA kinase in Mtb?
2.6. RT-PCR
Primer no
523
Sequence (50 e30 ) ACTTGACCCGGATCATCGGCG GAGCGGATCGCGATGGTCAAG GACGACACGAACGAATACCGT CCGGTCAACGTGAACTGTCCG AGAGAGGTACCCAATGTTCAC ACGTCGACATGGACCGTGAGC CGCTGGTCGACGCGTTCGGTC GTAGCTCGACGTCGGCGTGCA ACGCCAGTGCACCGCATCCGC CAACGAATGGCTTGAGGGATT
Though only one gene coding for CoaD has been annotated in Mtb (KEGG database), transposon mutagenesis data indicated that coaD could be a non-essential gene.10 In the same study coaE gene was predicted to be essential. Since adenyltransferase is an essential reaction for the biosynthesis of CoA, it suggested that either some other protein could complement the function in the absence of CoaD or the transposon mutagenesis based essentiality information was incorrect. In order to resolve the issue of essentiality we performed detailed genetic analysis of coaD and coaE genes and also checked whether these genes were transcriptionally active in Mtb. 3.2. Both coaD and coaE genes are transcribed in Mtb Genetic organization of coaD (Rv2965c) showed that it was a single gene and was not part of any operon (Figure 2A). On the other hand coaE (Rv1631) is present immediately downstream to rpsA (Rv1630), an essential ribosomal protein coding gene. In order to ascertain that the coaD and coaE genes are transcribed in Mtb, we deployed RT-PCR for detecting the transcribed mRNA. As seen in Figure 2C, DNA bands of expected size were seen in amplified DNA samples obtained from cDNA of coaD and coaE transcripts (236 bp and 267 bp respectively). Genomic DNA of Mtb used a positive control showed DNA bands of same size as seen with cDNA samples, whereas no bands were observed in samples lacking cDNA or Taq polymerasae. This showed that the DNA bands seen in RTPCR reactions were specifically obtained from the coaD or coaE transcripts. Thus, both coaD and coaE genes are actively transcribed in Mtb and are likely to play a role in the physiology of this organism. 3.3. Gene inactivation strategy In order to avoid any polar effects on transcription of downstream genes as result of inserting an antibiotic resistance marker into coaD or coaE genes, we decided to introduce marker-less deletions in these genes. The method followed for gene knockout (KO) consisted of integrating a suicide plasmid into the gene locus by a single cross over (SCO) recombination event followed by resolution of the co-integrate and loss of the plasmid by a double cross over (DCO) recombination.16 The gene KO of coaD and coaE was attempted in wild type (WT) and merodiploid backgrounds in parallel. The ability to generate gene KOs only in merodiploid background was taken as an evidence of essentiality of the gene. 3.4. coaD can be inactivated only in a merodiploid background The Mtb SCO recombinant (coaD/SCO) was identified by PCR based screening using primers indicated in Figure 3A. The SCO
524
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
A coaD Rv2966
rpsA
B
pca
coaE
435
434
coaD 430
431
coaE
C
267 bp 236 bp
Figure 2. Organization and transcript analysis of coaD and coaE genes of M. tuberculosis. A. Genomic organization of coaD and coaE genes based on KEGG database. B. Position of primers used for RT-PCR of coaD and coaE genes. C. Transcript analysis of coaD (left panel) and coaE (right panel) genes by RT-PCR. Lanes: 1. Genomic DNA, 2. RT template, 3. RTminus template, 4. No template and 5. Molecular size marker (100 bp ladder).
recombinant, coaD/SCO, was allowed to undergo recombination as described in Materials and methods. Screening of 100 colonies for the loss of plasmid by monitoring the presence of hyg or sacB markers by PCR (data not shown), indicated that 70 colonies had lost the plasmid (Table 3; overall 70% recombination frequency). Analysis of these colonies by gene specific primers indicated in Figure 3A showed that all the colonies had retained the WT copy of coaD gene (Figure S1A). This suggested the introduction of a deletion in coaD gene leads to loss of viability and thus no colonies with a mutant copy of coaD gene could grow. In order to prove this point, the gene KO was attempted in the presence of two copies of coaD genes. Under these conditions it was expected that it should be possible to inactivate the coaD gene as the additional copy would now provide the CoaD protein for the cellular function. For this, a merodiploid strain of Mtb was constructed (coaD/mero) which carried coaD gene in att site under hsp60 promoter. The coaD/mero strain was allowed to undergo DCO recombination in a manner described earlier for the coaD/ SCO. PCR screening revealed that coaD/mero strain lost the plasmid at a frequency comparable to coaD/SCO (Table 3, overall 85% recombination frequency). Analysis of colonies by gene specific primers revealed that 50% had retained the wild type copy of the gene while the remaining 50% carried a deleted copy
Table 3 Summary of gene KO of coaD and coaE genes in Mtb. Mtb strain
No of colonies screened
% Recombination*
% of KO colonies
coaD/SCO coaD/mero coaE/SCO coaE/mero
100 20 146 51
70% 85% 85% 92%
Nil 50% Nil 66%
*
Based on the % of hyg, sacB colonies in sucrose containing plates.
of coaD (Figure S1B). The presence of deleted copy of coaD gene in two colonies was further confirmed by PCR using additional pairs of primers (Figure 3C). This clearly showed that frequency of recombination at coaD site was quite high and inability to inactivate coaD in the WT background was not because of poor recombination frequency at this locus. This proved that coaD is an essential gene in Mtb and at least one copy of this gene is needed for the survival of this organism. 3.5. CoaE is also essential for in vitro survival of Mtb Next we attempted inactivation of coaE gene in wild type and merodiploid backgrounds using a strategy similar to that described above for coaD. The SCO recombinant (coaE/SCO) was confirmed by PCR using primer pairs shown in Figure 4A. As seen in Table 3, in coaE/SCO background, in spite of a very high frequency of recombination (85%), all the 146 putative DCO colonies screened showed the presence of a wild type copy of coaE gene (Figure S2A), This suggested that recombinant cells receiving a deleted copy of coaE upon allele exchange were not viable. In order to substantiate this hypothesis, DCO colonies obtained in a merodiploid background (coaE/mero) were analyzed for the presence of deleted copy of coaE gene. As seen in Table 3, the DCO recombination frequency (92%) in merodiploid background was comparable to that obtained in WT background. Upon further analysis it was found that 34% of DCO colonies had retained the WT copy of the gene while the remaining 66% has acquired a deleted coaE upon allele exchange (Figure S2B). The presence of a deleted copy of coaE in two colonies was further confirmed with PCR using additional pairs of primers (Figure 4C). This proved that CoaE function is also critical for the survival of Mtb and at least one of copy of coaE must be present in the cell for maintaining the viability of the cell.
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
525
Figure 3. Gene KO of coaD. A. Diagram showing position of primers used for confirmation of SCO and DCO recombinants by PCR. B. Expected sizes of PCR products using various combinations of primers. C. Confirmation of SCO and DCO recombinants by PCR. Lanes: 1. Mtb genomic DNA, 2. coaD/KO (No 4), 3. CoaD/KO(No 15), 4. coaD/SCO, 5. 100 bp molecular size marker.
3.6. Selectivity analysis of CoaD and CoaE proteins of Mtb by sequence alignments and phylogenetic relatedness Since CoA biosynthesis pathway is present in humans as well, it is important to confirm that there are sufficient differences between the mycobacterial and the human enzymes to allow selective inhibition of Mtb enzymes. As shown in Figure 5, amongst the three domains, the N-terminal domain of human CoAsy does not align with either CoaD or CoaE of Mtb (Figures S3 and S4), while the central domain aligns with CoaD of Mtb and other bacteria though the overall identity was found to be low (14e20% identity). The C-terminal domain of the human CoAsy, has significantly
higher similarity (22e31% identity) with CoaE of Mtb and other bacteria (Figure S4). The HXXH motif found in the nucleotidyltransferase superfamily of the central domain of human CoAsy is not conserved in bacterial CoaD (Figure S3). Further the CoA binding site residues which are well conserved amongst the bacteria, exhibit only 60% conservation in the corresponding site of the human protein (Figure S3). The Mtb CoaE protein consisting of 407 amino acid residues is longer than most of the prokaryotic CoaE proteins (Figure 5). In addition to the dephospho-CoA kinase domain (residues 1e181), the Mtb CoaE carries an extra stretch of residues in the C-terminal end (residues 185e387 termed UPF0157) which are
Figure 4. Gene KO of coaE. A. Diagram showing position of primers used for confirmation of SCO and DCO recombinants by PCR. B. Expected sizes of PCR products using various combinations of primers. C. Confirmation of SCO and DCO recombinants by PCR. Lanes: 1. coaE/KO (No 3), 2. coaE/KO (No 4), 3. Mtb genomic DNA, 4. coaE/SCO, 5. coaE/mero, 6. 100 bp (middle panel) or 500 bp (left and right panels) molecular size marker.
526
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
Figure 5. Schematic representation of domain organization of Mtb CoaD, CoaE and human CoAsy. % Amino acid identities (% ID) of central and c-terminal domains of human CoAsy to Mtb CoaD and CoaE respectively have been shown. In addition the % identities of various sub-domains of Mtb CoaE to the central domain of human CoAsy have also been shown.
thought to be important for the folding of this protein.12 As shown in Figure 5, the dephospho-CoA kinase domain of Mtb CoaE consists of three sub-domains; the nucleotide-binding, the substratebinding and the lid domain. Amongst the sub-domains, the nucleotide binding domain shows highest identity (60%) to the corresponding domain in human CoAsy (Figure 5). The Walker motif present in this domain is well conserved between the human and the bacterial enzymes (Figure S4). Substrate binding domain and the lid domain have an identity of approximately 26% and 54% with the human CoAsy respectively (Figure 5). Phylogenetic analysis showed that CoaD of Mtb is closely related to Gram negative bacteria whereas the human CoAsy is close to the CoaD of Gram positive organisms (Figure S5). On the other hand Mtb CoaE was found to be more closely related to CoaE of Gram positives and to the CoaE domain of human CoAsy (Figure S6). These observations corroborate the findings made in the protein similarity analysis of CoaD and CoaE by multiple sequence alignment. 3.6.1. Homology between Mtb CoaD and human CoAsy: structure based selectivity There are several amino acid residues in the vicinity of the CoA binding site of Mtb CoaD which are different from the residues in human CoAsy (Figure 6A). Glu98, Ser9, Val73 and Ser128 show hydrogen bonding interactions with the substrate. Of these, the side chain interaction of Glu98 with CoA assumes significance as in human CoAsy it is replaced by a residue with different charge character (Lys330). Although the corresponding residues for the positions of Val73 and Ser128 are different in the human enzyme, there may not be a selectivity advantage as the interactions with the substrate are made only through backbone contacts. The presence of other selective residues lining the binding site (e.g., Lys131, Ser127, Tyr97, Asn105 and Val74), although not making direct interactions with the substrate, can make collective influence in terms of non-specific secondary interactions or in terms of subtle changes in the binding site geometry affecting size, shape and electrostatic nature of the pocket. Also, the catalytic Lys41 residue
present at the tip of the solvent channel24 (not seen in Figure 6A), is replaced by Leu231 in human CoAsy, thus offering a selectivity handle. 3.6.2. Homology between Mtb CoaE and human CoAsy: structure based selectivity There are no structures available for Mtb CoaE; the closest structural homologs in the PDB database are CoaE from organisms such as E. coli (PDB code: 1VHL), H. influenza (PDB code: 1JJV) and T. maritima (PDB code: 2GRJ) having an identity of 38%, 37% and 36% respectively with Mtb CoaE.22,25 In order to study the selectivity at the binding site, a homology model of Mtb CoaE was built based on T. maritima CoaE (PDB code: 2GRJ) as the template structure. DCoA was docked at the binding region detected by SiteMap. Residues lying within 5 A radius from DCoA and ATP were considered as the binding site region for the purpose of selectivity comparisons. As seen in Figure 6B, Gln159, Arg36, Arg66 and Arg145 participate in hydrogen bonding interactions with DCoA. Of these amino acid residues, a selectivity handle at the position of Arg145 arises owing to its replacement by Asp504 in human CoAsy. Further differentiation comes from the guanidium side chain of Arg36 replaced by imidazole ring of His393 in human CoAsy, offering possible differences in ionic and steric environment at the binding site. Although not very crucial, at the second sphere of the residues in the vicinity, Arg80, Ala158, Asp32 and Ile112 have different counter parts in human CoAsy. 4. Discussion In target based drug discovery of anti-TB compounds the following attributes play an important role: essentiality, biochemical feasibility (availability of soluble active protein, assays, structure etc) and selectivity versus human enzyme. Since biochemical feasibility of CoaD and CoaE had been established earlier,11,12 we decided to validate the other two important parameters, essentiality and selectivity of these two proteins. Bioinformatics analysis showed that, unlike pantothenate kinase (CoaA and CoaX), there is
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
527
Figure 6. Selectivity analysis of substrate binding amino acid residues of Mtb CoaD (PDB code: 3LCJ) and CoaE (homology model). The figures were generated using PyMol. Amino acid residues lying within 5 A distance of the substrate are shown. A. CoaD structure with bound CoA. B. Homology model of CoaE with bound DCoA and ADP. The following color codes have been followed to show homology or lack of it to the corresponding residues in the human CoAsy: Dark blue e identical with CoAsy, Cyan e similar to CoAsy, Red e different from CoAsy. Amino acid similarity definitions are same as in ClustalW2.17 H-bond interaction and hydrophobic interactions have been indicated by brown dotted lines and brown lines respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
no functional homologs of CoaD or CoaE in Mtb. Our essentiality analysis by targeted gene inactivation clearly demonstrated that both coaD and coaE genes are essential for the survival of Mtb. The possible reason for the non-essential nature of coaD reported in an earlier study,10 could be that the transposon insertion might have taken place in the extreme 30 region of gene coding the C-terminal amino acids of CoaD whose absence does not affect the CoaD activity. Thus in respect of CoaD essentiality, Mtb is similar to other bacteria (e.g., E. coli, Streptococcus mutans) in which coaD or coaE genes have been found to be essential.26,27 Active transcription of
coaD and coaE genes suggests that both the genes play a role in the physiology of Mtb. Our study rules out the possibility of existence of an alternate pathway for synthesis of CoA. Since bacteria are unable to acquire either dephospho CoA or CoA from the growth environment,28 inhibition of any of these enzymes in the pathway is expected to lead to suppression of bacterial growth. Since all essential proteins may not be vulnerable targets,29,30 protein depletion studies by knockdown of CoaD and CoaE will help in assessing the vulnerability of this pathway to chemical inhibition.
528
A. Ambady et al. / Tuberculosis 92 (2012) 521e528
Successful isolation of potent inhibitors of CoaD of E. coli reported in an earlier study31 shows that small molecules are able to bind to this protein with reasonable affinity, i.e., the proteins is druggable. Owing to the structural similarity between CoaD of Mtb and E. coli, the Mtb protein can also be expected to be druggable. As a consequence of low similarity of CoaD of Mtb with the human enzyme observed at the level of amino acid sequence and by phylogenetic analysis, the inhibitors of this enzyme are likely to be selective for Mtb enzyme, thus lowering the chances of any toxicity issues. The presence of unique residues in CoA binding site of CoaD of Mtb (e.g., Glu98) provides a selective handle for designing specific inhibitors. Though overall similarity of Mtb CoaE to the human CoAsy is higher than seen with CoaD, analysis of molecular interactions in the substrate binding site showed the presence of unique residues which can potentially be exploited for selectivity. Based on the published data on biochemical characterization of Mtb CoaD and CoaE11,12 and our analysis on essentiality and selectivity it can be concluded that both these proteins are potential targets for discovery of novel anti-TB compounds. Acknowledgments We thank M. Prashanti and Manoranjan Panda for giving suggestions for improving the manuscript. We also thank the anonymous reviewers for providing critical inputs and suggestions. Ethical approval: Funding:
Not required.
None.
Competing interests:
None declared.
Appendix A. Supplementary material Supplementary data related to this article can be found online at http://dx.doi.org/10.1016/j.tube.2012.08.001. References 1. Wells CD, Cegielski JP, Nelson LJ, Laserson KF, Holtz TH, Finlay A, Castro KG, Weyer K. HIV infection and multidrug-resistant tuberculosis: the perfect storm. J Infect Dis 2007;196(Suppl.):S86e107. 2. Barry 3rd CE, Boshoff HI, Dartois V, Dick T, Ehrt S, Flynn J, Schnappinger D, Wilkinson RJ, Young D. The spectrum of latent tuberculosis: rethinking the biology and intervention strategies. Nat Rev Microbiol 2009;7:845e55. 3. Chan ED, Iseman MD. Multidrug-resistant and extensively drug-resistant tuberculosis: a review. Curr Opin Infect Dis 2008;21:587e95. 4. Gerdes S, Scholle MD, D’Souza M, Bernal A, Baev MV, Farrell M, Kurnasov OV, Daugherty MD, Mseeh F, Polanuyer BM, Campbell JW, Anantha S, Shatalin KY, Chowdhury SA, Fonstein MY, Osterman AL. From genetic footprinting to antimicrobial drug targets: examples in cofactor biosynthetic pathways. J Bacteriol 2002;184:4555e72. 5. Leonardi R, Zhang YM, Rock CO, Jackowski S. Coenzyme A: back in action. Prog Lipid Res 2005;44:125e53. 6. Strauss E, Kinsland C, Ge Y, McLafferty FW, Begley TP. Phosphopantothenoylcysteine synthetase from Escherichia coli. Identification and characterization of the last unidentified coenzyme A biosynthetic enzyme in bacteria. J Biol Chem 2001;276:13513e6. 7. Spry C, Kirk K, Saliba KJ. Coenzyme A biosynthesis: an antimicrobial drug target. FEMS Microbiol Rev 2008;32:56e106. 8. Sharma U. Current possibilities and unresolved issues of drug target validation in Mycobacterium tuberculosis. Expert Opin Drug Discov 2011;6:1171e86. 9. Awasthy D, Ambady A, Bhat J, Sheikh G, Ravishankar S, Subbulakshmi V, Mukherjee K, Sambandamurthy V, Sharma U. Essentiality and functional analysis of type I and type III pantothenate kinases of Mycobacterium tuberculosis. Microbiology 2010;156:2691e701.
10. Sassetti CM, Boyd DH, Rubin EJ. Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol 2003;48:77e84. 11. Wubben TJ, Mesecar AD. Kinetic, thermodynamic, and structural insight into the mechanism of phosphopantetheine adenylyltransferase from Mycobacterium tuberculosis. J Mol Biol 2010;404:202e19. 12. Walia G, Kumar P, Surolia A. The role of UPF0157 in the folding of M. tuberculosis dephosphocoenzyme A kinase and the regulation of the latter by CTP. PLoS One 2009;4:e7645. 13. Aghajanian S, Worrall DM. Identification and characterization of the gene encoding the human phosphopantetheine adenylyltransferase and dephosphoCoA kinase bifunctionalenzyme (CoA synthase). Biochem J 2002;365: 13e8. 14. Zhyvoloup A, Nemazanyy I, Babich A, Panasyuk G, Pobigailo N, Vudmaska M, Naidenov V, Kukharenko O, Palchevskii S, Savinska L, Ovcharenko G, Verdier F, Valovka T, Fenton T, Rebholz H, Wang ML, Shepherd P, Matsuka G, Filonenko V, Gout IT. Molecular cloning of CoA synthase. The missing link in CoA biosynthesis. J Biol Chem 2002;277:22107e10. 15. Timofeev VI, Smirnova EA, Chupova LA, Esipov RS, Kuranova IP. Preparation of the crystal complex of phosphopantetheine adenylyltransferase from Mycobacterium tuberculosis with coenzyme A and investigation of its threedimensional structure at 2.1-A frame resolution. Cryst Rep 2010;55:1050e9. 16. Parish T, Stoker NG. Use of a flexible cassette method to generate a double unmarked Mycobacterium tuberculosis tlyA plcABC mutant by gene replacement. Microbiology 2000;146:1969e75. 17. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. Clustal W and Clustal X version 2.0. Bioinformatics 2007;23:2947e8. 18. Nicholas KB, Nicholas Jr HB, Deerfield II DW. GeneDoc: analysis and visualization of genetic variation. EMBNEW News 1997;4:14. 19. Page RDM. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 1996;12:357e8. 20. Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE. The protein data bank. Nucleic Acids Res 2000;28: 235e42. 21. Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream MA, Barrell B. Artemis: sequence visualization and annotation. Bioinformatics 2000;16:944e5. 22. Obmolova G, Teplyakov A, Bonander N, Eisenstein E, Howard AJ, Gilliland G. Crystal structure of dephospho-Coenzyme A kinase from Haemophilus influenzae. J Struct Biol 2001;136:119e25. 23. Schrödinger Suite 2011. Protein preparation wizard; ligprep; prime version 2.2; glide 5.6. New York, NY: Schrödinger, LLC; 2011. 24. Morris VK, Izard T. Substrate-induced asymmetry and channel closure revealed by the apoenzyme structure of Mycobacterium tuberculosis phosphopantetheine adenylyltransferase. Protein Sci 2004;13:2547e52. 25. O’Toole N, Barbosa JA, Li Y, Hung LW, Matte A, Cygler M. Crystal structure of a trimeric form of dephosphocoenzyme A kinase from Escherichia coli. Protein Sci 2003;12:327e36. 26. Freiberg C, Wieland B, Spaltmann F, Ehlert K, Brötz H, Labischinski H. Identification of novel essential Escherichia coli genes conserved among pathogenic bacteria. J Mol Microbiol Biotechnol 2001;3:483e9. 27. Wang B, Kuramitsu HK. Inducible antisense RNA expression in the characterization of gene functions in Streptococcus mutans. Infect Immun 2005;73: 3568e76. 28. Balibar CJ, Hollis-Symynkywicz MF, Tao J. Pantethine rescues phosphopantothenoylcysteine synthetase and phosphopantothenoylcysteine decarboxylase deficiency in Escherichia coli but not in Pseudomonas aeruginosa. J Bacteriol 2011;193:3304e12. 29. Carroll P, Faray-Kele MC, Parish T. Identifying vulnerable pathways in Mycobacterium tuberculosis using a knock-down approach. Appl Environ Microbiol 2011;77:5040e3. 30. Wei JR, Krishnamoorthy V, Murphy K, Kim JH, Schnappinger D, Alber T, Sassetti CM, Rhee KY, Rubin EJ. Depletion of antibiotic targets has widely varying effects on growth. Proc Natl Acad Sci U S A 2011;108:4176e81. 31. Zhao L, Allanson NM, Thomson SP, Maclean JK, Barker JJ, Primrose WU, Tyler PD, Lewendon A. Inhibitors of phosphopantetheine adenylyltransferase. Eur J Med Chem 2003;38:345e9.
Websites 32. GeneDoc [%3ca href¼http://www.nrbsc.org/gfx/genedoc/] website. 33. TreeView [%3ca href¼http://taxonomy.zoology.gla.ac.uk/rod/treeview.html] website. 34. TB database [%3ca href¼http://www.tbdb.org/] website. 35. MATLAB version 2010a. Natick, Massachusetts: The MathWorks Inc.; 2010.