Evaluation of developmental toxicity and teratogenicity of diclofenac using Xenopus embryos

Chemosphere 120 (2015) 52–58

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Evaluation of developmental toxicity and teratogenicity of diclofenac using Xenopus embryos Jeong-Pil Chae a,1, Mi Seon Park b,1, Yoo-Seok Hwang c, Byung-Hwa Min b, Sang-Hyun Kim d, Hyun-Shik Lee e,⇑, Mae-Ja Park a,⇑ a

Department of Anatomy, College of Medicine, Kyungpook National University, Daegu 700-422, South Korea Aquaculture Management Division, National Fisheries Research and Development Institute, Busan 619-705, South Korea Laboratory of Cell and Developmental Signaling, National Cancer Institute-Frederick, Frederick, MD 21702, USA d Department of Pharmacology, College of Medicine, Kyungpook National University, Daegu 700-422, South Korea e ABRC, School of Life Sciences, BK21 Plus KNU Creative BioResearch Group, Kyungpook National University, Daegu 702-701, South Korea b c

h i g h l i g h t s  Diclofenac is a developmental toxicant and teratogen in Xenopus embryos.  Embryos exposed to diclofenac develop various abnormalities.  Neural tissues are adversely affected by diclofenac.  Expression of tissue-specific markers is not regulated in RNA transcription level in embryos treated with diclofenac.

a r t i c l e

i n f o

Article history: Received 10 February 2014 Received in revised form 21 May 2014 Accepted 22 May 2014

Handling Editor: Tamara S. Galloway Keywords: Diclofenac Teratogenicity Embryotoxicity FETAX Xenopus laevis

a b s t r a c t Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) with analgesic and anti-pyretic properties. This compound is therefore used to treat pain, inflammatory disorders, and dysmenorrhea. Due to its multimodal mechanism of action and ability to penetrate placenta, diclofenac is known to have undesirable side effects including teratogenicity. However, limited data exist on its teratogenicity, and a detailed investigation regarding harmful effects of this drug during embryogenesis is warranted. Here, we analyzed the developmental toxic effects of diclofenac using Xenopus embryos according to the Frog Embryo Teratogenesis Assay-Xenopus (FETAX) protocol. Diclofenac treatment exerted a teratogenic effect on Xenopus embryos with a teratogenic index (TI) value of 2.64 TI; if this value is higher than 1.2, the cutoff value indicative of toxicity. In particular, mortality of embryos treated with diclofenac increased in a concentration-dependent manner and a broad spectrum of malformations such as shortening and kinking of the axis, abdominal bulging, and prominent blister formation, was observed. The shape and length of internal organs also differed compared to the control group embryos and show developmental retardation on histological label. However, the expression of major tissue-specific markers did not change when analyzed by reverse transcription–polymerase chain reaction (RT–PCR). In conclusion, diclofenac treatment can promote teratogenicity that results in morphological anomalies, but not disrupt the developmental tissue arrangement during Xenopus embryogenesis. Ó 2014 Published by Elsevier Ltd.

1. Introduction Diclofenac [2-(2,6-dichloranilo)phenyl acetic acid] is a phenylacetic acid derivative that is a non-steroidal anti-inflammatory drug ⇑ Corresponding authors. Address: School of Life Sciences, College of Natural Sciences, Kyungpook National University, Daegu 702-701, South Korea. Tel.: +82 53 950 7367; fax: +82 53 943 2762. (H.-S. Lee). Department of Anatomy, College of Medicine, Kyungpook National University, Daegu 700-422, South Korea. Tel.: +82 53 420 4802; fax: +82 53 426 9085. (M.-J. Park). E-mail addresses: [email protected] (H.-S. Lee), [email protected] (M.-J. Park). 1 These authors contributed equally to the study. http://dx.doi.org/10.1016/j.chemosphere.2014.05.063 0045-6535/Ó 2014 Published by Elsevier Ltd.

(NSAID; Fig. 1A). Like most NSAIDs, diclofenac possesses analgesic, anti-inflammatory, and antipyretic properties. The sodium salt of diclofenac was used to treat osteoarthritis, rheumatoid arthritis, ankylosing spondylitis, and mild to moderate pain in ancient times. Since then, diclofenac has been the most commonly used analgesic in the world and is commercially available in various formulations including ones for oral administration. Recent studies have shown that diclofenac inhibits the activity of cyclooxygenases and DNA synthesis through multiple mechanisms (Sallmann, 1986; Dastidar et al., 2000; Mastrangelo et al.,

J.-P. Chae et al. / Chemosphere 120 (2015) 52–58

53

Fig. 1. Dose-dependent effect of diclofenac exposure for 96 h. (A) Lewis structure of the diclofenac used in this study, (B) as the concentration of diclofenac increased, the malformation rate also rose while the survival rate decreased. The MC50 was 16 mg L1 and LC50 was approximately 32 mg L1 and (C) malformation in various organs was analyzed. Severity (percent with the indicated anomaly) of malformation increased as the diclofenac concentration increased.

2000; Elron-Gross et al., 2008). To regulate immune responses and neuronal function in the brain, diclofenac acts on voltage-gated K+ channels and acid-sensing ionic channels (Dorofeeva et al., 2008; Villalonga et al., 2010). In rat myoblasts, diclofenac prevents the influx of Na+ via the inhibition of voltage-gated Na+ channels (Fei et al., 2006), while promoting Ca2+ efflux from mitochondria (Li et al., 2009). These studies suggest that the multimodal mechanisms of diclofenac action make it potential compound that exerts a wide range of physiologic effects and known most commonly prescribed analgesic in the world. Conversely, the properties of diclofenac may require reevaluation to ensure patient safety although this drug is generally considered safe for human use at the recommended doses. Diclofenac has been proven as a pregnancy risk class C drug by the United States Food and Drug Administration (FDA). Even though the toxicity and teratogenicity of diclofenac were measured, conflicting data have been published for different animal model systems. Fetal neuronal cells apoptosis is significantly induced in diclofenac-treated pregnant rats (Gokcimen et al., 2007). Additionally, diclofenac-treated rodents deliver fetuses with severe morphological abnormalities such as defects of the palate, limbs, and ductus arteriosus (Montenegro and Palomino, 1990; Zenker et al., 1998; Rein et al., 1999; Chan et al., 2002). Diclofenac-treated medaka fish embryos also have decreased survival rates, shrunken yolks, and hemorrhage (Nassef et al., 2010). Furthermore, myofibril misalignment occurs in diclofenac-treated zebrafish embryos via disruption of actin organization (Chen et al., 2011) and alteration of mRNA expression (Felice et al., 2012). Deregulation of mitochondrial functions and abnormal apoptosis-related gene expression have been observed through differential mRNA and transcriptome analyses (Felice et al., 2012). These studies clearly suggest diclofenac toxicity during embryogenesis, although it seems to be safe for embryos at considerably low doses. As this compound is frequently prescribed to treat dysmenorrhea or menorrhagia in young women, adequate and

well-controlled studies should be conducted to evaluate potential teratogenic effects. Developmental toxicity and teratogenecity associated with diclofenac might or would have dramatic impacts on embryogenesis and detailed mechanisms of underlying these effects should be assessed. Here, we present data from molecular and pathological assays, which indicates that diclofenac is a developmental toxicant and teratogen. Diclofenac administration causes neural tissue underdeveloped in terms of size and shape as compared to normal developmental process. We determined that diclofenac is a developmental toxicant and teratogen in Xenopus embryos using a Frog Embryo Teratogenesis Assay-Xenopus (FETAX) assay. In addition, diclofenac-treated embryos had various developmental abnormalities and defects of various organs including neural tissues. 2. Materials and methods 2.1. Chemicals and FETAX solution All analytic-grade reagents, diclofenac sodium salt (C14H10 Cl2NNaO2), human chorionic gonadotropin (HCG), and 3-aminobenzoic acid ethyl ester (MS222) were purchased from Sigma– Aldrich (St. Louis, MO, USA). The FETAX control solution contained 10.7 mM NaCl, 1.14 mM NaHCO3, 0.4 mM KCl, 0.1 mM CaCl2, 0.35 mM CaSO42H2O, and 0.3 mM MgSO4 in deionized water; the pH was adjusted to 7.6–7.9. A diclofenac stock (10 mg mL1) was freshly made and diluted in FETAX solution. 2.2. Animals Adult Xenopus were purchased from Nasco (Nasco, Fort Atkinson, WI, USA) and housed in an aquarium with triple-filtered tap water at 18 ± 2 °C and an alternating 12-h light/dark cycle. The animals were fed a semi-synthetic diet (Nasco, Fort Atkinson, WI, USA).

54

J.-P. Chae et al. / Chemosphere 120 (2015) 52–58

2.3. In vitro fertilization Ovulation was induced by injecting the female Xenopus with 1000 IU HCG just under the skin in the evening. The next day, females were made to lay eggs in 60-mm plastic dishes. The eggs were immediately fertilized with minced testes in 0.1 modified Barth solution (MBS; 88 mM NaCl, 5 mM HEPES, 2.5 mM NaHCO3, 1 mM KCl, 1 mM MgSO4, and 0.7 mM CaCl2, pH 7.8) after washing three times with 0.1 MBS. Following successful fertilization, the jelly coat was removed by swirling the embryos in a 2% L-cysteine solution. The embryos were then transferred to 1x MBS containing 3% Ficoll 400 (GE Healthcare, Little Chalfont, UK). Unfertilized eggs and dead embryos were removed and the viable embryos were maintained at 22 ± 0.5 °C until blastulas (stage 8.5) were formed. 2.4. FETAX assay A FETAX assay was conducted to assess the developmental toxicity and teratogenic effects of diclofenac based on the American Society of Testing Material (ASTM) guide (ASTM E1439-98). Finely cleaved embryos in the blastula stage (stage 8.5) were selected and used to exclude the effects of spontaneous embryonic developmental problems. For the FETAX assay, 30 embryos were used. All embryos were exposed to different concentrations of diclofenac ranging from 1 mg L1 to 64 mg L1. Embryos treated with DMSO alone (0.1%) or FETAX medium alone were used as controls. The embryos were incubated at 22 °C until the end of the assay. The media were changed every day and dead embryos were removed. At the end of the experiments, embryo mortality was recorded and surviving embryos were fixed in 4% formaldehyde to check for malformations. Head–tail lengths and malformations were evaluated under a light microscope, and images were analyzed with Axiovision software version 4.8 (Carl Zeiss, Munich, Germany) to measure growth inhibition. Results of the FETAX assay are expressed according to TI values [TI = LC50 (concentration that is lethal to 50% of the embryos)/MC50 (concentration at which 50% of the embryos are malformed)] to determine whether a compound was toxic or not (Mouche et al., 2011b). If the tested substance is toxic, then TI will be greater than or equal to 1.2. 2.5. Histology analysis Diclofenac-treated and untreated embryos were randomly selected for histological evaluation. The embryos were fixed in MEMFA (4% paraformaldehyde, 0.1 M MOPS, 2 mM EGTA, and 1 mM MgSO4) and embedded in paraffin. The embedded embryos were transversely cut from eye to proctodeum into sections 10-lm thick. Serial sections were then mounted on glass slides and stained with hematoxylin and eosin (H&E). The sections were examined with a Leica DMI 3000B microscope (Leica Microsystems GmbH, Wetzlar, Germany). 2.6. Reverse transcription (RT)-PCR Total RNA was isolated from stage 34–46 embryos using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol and quantified with an OPTIZEN 320 UV spectrometer (Mecacys, Deajon, South Korea). A 1-lg aliquot of total RNA was reverse transcribed using a PrimeScript 1st Strand cDNA Synthesis kit (Takara, Shiga, Japan) according to the manufacturer’s instructions. Reactions containing template RNA without reverse transciptase were prepared as negative controls (no-RT). The cDNA templates were amplified with specific PCR primer sets (Table 2) using 2 EmeraldAmp PCR Master Mix (Takara, Shiga, Japan). The PCR products were separated in a 1–1.2% agarose gel and

visualized with a transilluminator (Vilber Lourmat, Marne-la-Vallée Cedex 1, France) following ethidium bromide staining. 2.7. Statistical analysis The teratogenic index (TI) value was calculated as the ratio of the 50% embryo-lethal concentration (LC50) versus the concentration that resulted in 50% of malformed larvae (MC50) among the surviving ones. Each LC50 or MC50 value was obtained with Graph-Pad PrismÒ software. When the TI value was greater than or equal to 1.2, the tested compound was regarded as toxic to embryos. 3. Results 3.1. Diclofenac is a developmental toxicant and teratogen in Xenopus embryos We first performed a FETAX assay to determine whether diclofenac exerts embryonic lethal and teratogenic effects (Table 1). We selected developing Xenopus embryos at stage 8.5 and treated them with diclofenac at five different concentrations (1, 4, 16, 32, and 64 mg L1). Each concentration was tested in triplicate with 10 embryos per Petri dish containing 10 mL of solution. Fresh FETAX media with diclofenac were replaced daily and the embryos were incubated at 22 °C for 96 h. Mortality, malformation development, stages of development, total body length, and snout vent length were evaluated every day. LC50 and MC50 values for each concentration of diclofenac were calculated after mortality and malformation rates were measured. Malformation rates and mortality increased abruptly with diclofenac concentrations 16 mg L1 and higher (Table 1). The highest tested concentration (64 mg L1) induced death of all exposed embryos within 24 h after incubation in the solution generated the highest incidence of mortality (100%; Table 1). The TI value for diclofenac was 2.64-times greater than 1.2 (Table 1), demonstrating that diclofenac has potential developmental toxic and teratogenic effects during Xenopus embryogenesis. 3.2. Embryos exposed to diclofenac develop various abnormalities To verify which tissues or organs were affected by diclofenac, we analyzed patterns of malformations following diclofenac treatment during stages 22 and 36. The survival rate abruptly decreased, the malformation rate greatly increased starting with a diclofenac concentration of 16 mg L1 (Table 1, Fig. 1B). This result indicates that the MC50 and LC50 values were around 16 mg L1 and 32 mg L1, respectively, and were very similar to those calculated with Graph-Pad PrismÒ software. Various malformations were observed in embryos treated with diclofenac. Axis, gut, heart, head, and eye abnormalities as well as blistering (edema) were the most common disorders observed after exposure to various concentrations of diclofenac (Fig. 1C). At higher concentration of diclofenac, tadpole length was decreased (Fig. 2A). Diclofenac exposure at higher concentrations resulted in large bulges around the ventral area and shortening of the truncal axis at stage 22 before organogenesis was initiated (Fig. 2B). At stage 36 after organogenesis had started, the gut and heart shape arrangement were disrupted, and a large blister surrounded the head and trunk was observed (Fig. 2B). The blood color changed in the control embryos but not in the ones treated with diclofenac (Fig. 2B). Rolling patterns of the gut were disrupted (Fig. 2B) and were unusually oriented in the other direction (i.e., rolled clockwise and appeared shorter than that found in control embryos throughout the whole length of the

55

J.-P. Chae et al. / Chemosphere 120 (2015) 52–58 Table 1 TI values for Xenopus embryos exposed to increasing doses of diclofenac. Dose

Number of embryos

Survive

Mortality

1

mg L

T + 96 h 0 1 4 16 32 64 EmLC50 EmMC50 Ratio(TI)

30 30 30 30 30 30 30.32 12.25 2.64

30 28 25 17 8 0

Number

%

Number

%

0 2 5 13 22 30

0.0 6.7 16.7 43.3 73.3 100.0

0 5 10 14 8 –

0.0 17.9 40.0 82.4 100 –

Table 2 Primer sequences used for RT–PCR. Gene Name

Primer Sequence(50 ? 30 )

Cycle

Insulin

F: ATGGCTCTATGGATGCAGTG R: AGAGAACATGTGCTGTGGCA F: GAGGACAATGGGAAAACGAC R: CAGGGGAGAATACAAAAGAG F: GACCATCACAAGCATATTGCTGAC R: GCTGAGAGAAGATCATCAGGGTGT F: GAACACGGCTCGCTATTGAGG R: GATCACTCTAGCTTGGTGCAC F: CAGATCTGCACTCTGGTGGC R: GTTCCTGTTCCAGAGAAAGC F: GGAATCCCCGCTGCCAATC R: ATGAGAAGGAGTAGGGGGTGA F: ATCACAGGAACCCCATCTTT R: CAGTTTGCTTTCAGTCTTCCTCTT F: GCGGGTACCTTCTAATAGTCAC R: GGCTTGGCTGTGGTTCTGAAGG F: CCGGCCCATCCTCAGACCCAGAAA R: CGCCACGCCGCTGTTGCCGAGTTC F: AGCAGAAAATGGCAAACACAC R: GGTCTTTTAATGGCAACAGGT F: CTGGTTCCTACAGGAC R: GTATGCCCAATGTGCC F: TCCCTGTACGCTTCTGGTCGTA R: TCTCAAAGTCCAAAGCCACATA F: TTGCTGTCTCACACCATCCAGG R: TCTGTACTTGGAGGTGAGGACG F: AATACCAATGCGACTGCACC R: CCATCCTGCCATATGTCTTG F: TATGAATGCGACTGCACGAG R: CTGGTGTGTGAAGTGTTGAG F: CCTGAACAACCCAGGCCAGATTGGTG R: GAGGGTAGTCAGAGAAGCTCTCCACG

32

SRBP Albumin Cyl104 Cyl18 TTR 3H12 N-cam Krox20 Edd IFABP Actin Globin Cox1 Cox2 Ef1a

Number of malformed embryos

32 32 32 30 32 32 25 25 28

control group were normal at stage 45. Embryos from experimental group, displayed empty spaces around each organ, the body, and head due to edema, and malformed or under-differentiated internal organs seemed to be scattered through the whole embryos. In particular, the developing intestine was loosely disposed in density and underdeveloped compared to the control group (i.e., the cross-sectioned specimens had fewer thickerwalled intestinal rings compared to those in the control group). This means that the gut wall was not well differentiated and recanalization of the gut tube was delayed. Lengthening of the gut tube also had not progressive or developed well. The heart was also small in size and not well partitioned inside. The pericardium was separated from heart itself by a large empty space. No blood cells were observed in the body (Fig. 3). The lateral edge of the neural plate was elevated to form the neural fold but it did not fuse at the mid-line, indicative of a neural tube closure defect and suggesting that the neural tissue was underdeveloped. 3.4. Expression of tissue-specific markers is not regulated in RNA transcription level in embryos treated with diclofenac

32 20 25 28 28 20

gut). The heart tube was located in the correct area but the wall and valve were thin and loosened (Fig. 2B). The heart was beating very weakly, and no red blood cells were detected inside or outside the organ (Fig. 2B). The pericardial sac was oversized and clearly seen. Red-colored blood cells were not observed (Fig. 2B). Blistering increased in size with high concentrations (Fig. 2B). These results indicate that embryos exposed to diclofenac developed complex and varied malformations, and the rates of malformations were increased in a dose-dependent manner. 3.3. Neural tissues are adversely affected by diclofenac To observe internal changes as well as external morphological abnormalities induced by diclofenac, we performed serial transverse 5-lm sectioning and H&E staining with embryos at stage 45 treated with diclofenac (16 mg L1) since diclofenac induced the development of various malformations rather than embryonic lethality at this concentration. As shown in Fig. 3, various organs including the brain, heart, liver, esophagus, and trachea in the

In order to monitor changes in tissue-specific gene expression at the transcription level, we performed RT–PCR after harvesting embryos at stage 22 before organogenesis had started and at stage 36 after organ formation became obvious. Expression of early germ layer-specific markers was observed in stage 22 embryos after treatment with 16 mg L1 diclofenac. As shown in Fig. 4A, the levels of general tissue-specific markers were unchanged compared to control groups; this included neural markers such as N-cam and Krox20, endodermal markers Edd (eomesodermin) and IFABP (intestinal fatty acid binding protein), and mesodermal markers actin and globin (Fig. 4A). We also analyzed stage 36 embryos to observe any tissue-specific markers were affected by diclofenac after organogenesis that could result in morphological malformations. The expression of insulin, SRBP (serum retinol binding protein), Cyl104, TTR (transthyretin), 3H12, and albumin significantly change although severe malformations were observed (Fig. 4B). We performed the experiment several times to ensure consistency of the results. It is well known that diclofenac inhibits prostaglandin synthesis through inhibition of COX-1 and -2 activities. However, transcription of the Cox-1 and -2 gene was not affected in the Xenopus embryos (Fig. 4C). These data suggest that the teratogenicity or toxicity of diclofenac may not be due to a mechanism at the transcription level but rather one at the protein level. 4. Discussion Toxicological tests using cells or mice are valuable for evaluating the toxicity and teratogenicity of drugs or chemicals (Chan et al., 2001, 2002; Hickey et al., 2001). However, these assays have

56

J.-P. Chae et al. / Chemosphere 120 (2015) 52–58

Fig. 2. Effects of diclofenac exposure on morphological features. (A) Axial length of the embryos became shorter and ventral bulging became prominent in stage 22 tadpoles as the diclofenac concentration was increased, (B) abnormal patterns of intestine coiling and more severe whole-body blistering were observed after organogenesis at stage 45 and (C) the severity of blistering (edema) increased and axial length was shortened at stage 45 with higher concentrations of diclofenac.

Fig. 3. Histological analysis of Xenopus larvae exposed to diclofenac. H&E staining of several transverse sections from the larvae (stage 45). In control larvae, all organs had a normal shape and appropriate localization (upper panel). On the other hand, larvae exposed to diclofenac (16 mg L1) had primitive organs with abnormal shapes, and amorphous edemas (lower panel). Cranial to Caudal levels’ order from left to right.

limitations. Cell-based systems are limited because they produce only in vitro results. Although mice are good animal models for various experiments, it is very difficult to directly observe teratogenic and toxic changes in utero during embryogenesis. Therefore, development of an alternative animal model system for toxicity and teratogenicity tests is required to overcome problems with current in vitro and animal models. The FETAX assay that uses amphibian Xenopus embryos is a powerful and flexible method for evaluating developmental toxicants. The assay is conducted with mid-blastula stage embryos (Mouche et al., 2011a; Mouche et al., 2011b). The toxic and teratogenic potentials of compounds are measured according to three

criteria (mortality, malformation, and growth inhibition); developmental toxicity is evaluated using these criteria. The FETAX assay is a well-designed system for identifying teratogens and developmental toxicants that are potentially hazardous to human health. Moreover, this technique should be suitable for ecological risk assessment based on the three analytical criteria and comparative evaluation of species traditionally used for toxicological research (Hoke and Ankley, 2005; Franchini et al., 2008; Sharma and Patino, 2008; Bacchetta et al., 2012). The FETAX assay can be modified in a variety of ways for using in numerous molecular biological experiments. Given that exposure to xenobiotics is known to alter gene expression (Mei et al., 2008), RT–PCR and histological

J.-P. Chae et al. / Chemosphere 120 (2015) 52–58

57

Fig. 4. Expression of tissue-specific marker genes in Xenopus embryo exposed to diclofenac. (A) The expression of neural (N-cam and Krox20), endodermal (Edd and IFABP), and mesodermal (actin and globin) markers did not show any changes in embryos exposed to diclofenac compared to the control embryos at stage 22. EF1a was used as a loading control, (B) The expression of organ-specific markers was also unchanged when comparing the diclofenac-treated embryos and controls at stage 36. EF1a was used as a loading control and (C) Expression levels of COX-1 and -2 mRNA were not different between the control and diclofenac-treated embryos at stage 22 and 36.

analysis were also used in our study to measure changes in mRNA expression and identify the underlying modes of diclofenac action in embryos treated with the drug. Here we showed that diclofenac exposure leads to severe malformation in a time- and dose–dependent manner. Additionally, we determined that diclofenac is a developmental toxicant and teratogen according to TI values. Each experimental group had gradually high TI values with increasing diclofenac concentrations and more various body malformations. Macrocephaly, microcardia with pericardial edema, abnormal gastrointestinal (GI) coiling, underdeveloped histological features of the GI wall, and abnormal developments were observed after exposure to diclofenac. Previous studies have shown that diclofenac seems to be a relatively safe drug during the first trimester of pregnancy. However, this compound crosses the human placenta (109 mg L1 d1, exposure for 3.8 weeks) and increases the rate of pregnancy termination, suggesting that diclofenac may have potential teratogenic effects (Siu et al., 2000; Cassina et al., 2010). Exposure to high levels of diclofenac also results in embryotoxicity in rat whole embryos (Chan et al., 2001). Additionally, diclofenac-treated rat embryos develop pronounced malformations in the caudal neural tube and hindlimb (Chan et al., 2001). Conversely, no developmental toxicity was observed with diclofenac treatment during the early-life stages of zebrafish (Hallare et al., 2004). Although these previous reports produced conflicting information about the potential developmental toxicity of diclofenac, our results demonstrated that diclofenac had definitive teratogenic and developmental toxic effects on developing Xenopus embryos. The teratogenic effects of diclofenac exposure are seemingly caused by various alterations in gene expression regulation. However, the expression of major tissue markers was unaffected in our study, suggesting that the teratogenicity and/or toxicity of diclofenac may not be mediated via transcriptional mechanism but involves one at the protein level. Albumin expression alone was reduced with low and high concentrations of diclofenac, which might be due to the reduced size of the liver of the experimental embryos. In conclusion, diclofenac-induced embryotoxicity could be easily observed in vivo during early Xenopus embryogenesis using a

FETAX assay. Our findings could serve as definitive evidence for the embryotoxicity of diclofenac, and provide an experimental basis for prohibiting diclofenac use prescription by pregnant women. Although results from our study performed in Xenopus embryos may not reflect the circumstances in humans, the data regarding adverse effects of diclofenac exposure during embryogenesis warrant further investigation and monitoring. Before more information in humans becomes available, the administration of diclofenac to women of childbearing age should proceed with a degree of caution. Acknowledgements This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2010-0005909, NRF-2012R1A1A2042334), a Grant from the NextGeneration BioGreen 21 Program (PJ009564), Rural Development Administration, South Korea, and the Kyungpook National University Research Fund (2012). References Bacchetta, R., Santo, N., Fascio, U., Moschini, E., Freddi, S., Chirico, G., Camatini, M., Mantecca, P., 2012. Nano-sized CuO, TiO(2) and ZnO affect Xenopus laevis development. Nanotoxicology 6, 381–398. Cassina, M., De Santis, M., Cesari, E., van Eijkeren, M., Berkovitch, M., Eleftheriou, G., Raffagnato, F., Di Gianantonio, E., Clementi, M., 2010. First trimester diclofenac exposure and pregnancy outcome. Reprod. Toxicol. 30, 401–404. Chan, L.Y., Chiu, P.Y., Siu, S.S.N., Lau, T.K., 2001. A study of diclofenac-induced teratogenicity during organogenesis using a whole rat embryo culture model. Hum. Reprod. 16, 2390–2393. Chan, L.Y.S., Chiu, P.Y., Siu, N.S.S., Wang, C.C., Lau, T.K., 2002. Diclofenac-induced embryotoxicity is associated with increased embryonic 8-isoprostaglandin F2 alpha level in rat whole embryo culture. Reprod. Toxicol. 16, 841–844. Chen, Y.H., Chang, C.Y., Wang, Y.H., Wen, C.C., Chen, Y.C., Hu, S.C., Yu, D.S., 2011. Embryonic exposure to diclofenac disturbs actin organization and leads to myofibril misalignment. Birth Defects Res., Part B 92, 139–147. Dastidar, S.G., Ganguly, K., Chaudhuri, K., Chakrabarty, A.N., 2000. The anti-bacterial action of diclofenac shown by inhibition of DNA synthesis. Int. J. Antimicrob. Agents 14, 249–251. Dorofeeva, N.A., Barygin, O.I., Staruschenko, A., Bolshakov, K.V., Magazanik, L.G., 2008. Mechanisms of non-steroid anti-inflammatory drugs action on ASICs expressed in hippocampal interneurons. J. Neurochem. 106, 429–441.

58

J.-P. Chae et al. / Chemosphere 120 (2015) 52–58

Elron-Gross, I., Glucksam, Y., Melikhov, D., Margalit, R., 2008. Cyclooxygenase inhibition by diclofenac formulated in bioadhesive carriers. Biochim. Biophys. Acta 1778, 931–936. Fei, X.W., Liu, L.Y., Xu, H.G., Zhang, Z.H., Mei, Y.A., 2006. The non-steroidal antiinflammatory drug, diclofenac, inhibits Na+ current in rat myoblasts. Biochem. Biophys. Res. Commun. 346, 1275–1283. Felice, D., O’Leary, O.F., Pizzo, R.C., Cryan, J.F., 2012. Blockade of the GABA(B) receptor increases neurogenesis in the ventral but not dorsal adult hippocampus: relevance to antidepressant action. Neuropharmacology 63, 1380–1388. Franchini, A., Casarini, L., Ottaviani, E., 2008. Toxicological effects of marine palytoxin evaluated by FETAX assay. Chemosphere 73, 267–271. Gokcimen, A., Ragbetli, M.C., Bas, O., Tunc, A.T., Aslan, H., Yazici, A.C., Kaplan, S., 2007. Effect of prenatal exposure to an anti-inflammatory drug on neuron number in cornu ammonis and dentate gyrus of the rat hippocampus: a stereological study. Brain Res. 1127, 185–192. Hallare, A.V., Kohler, H.R., Triebskorn, R., 2004. Developmental toxicity and stress protein responses in zebrafish embryos after exposure to diclofenac and its solvent, DMSO. Chemosphere 56, 659–666. Hickey, E.J., Raje, R.R., Redd, V.E., Gross, S.M., Ray, S.D., 2001. Diclofenac induced in vivo nephrotoxicity may involve oxidative stress-mediated massive genomic DNA fragmentation and apoptotic cell death. Free Radical Biol. Med. 31, 139– 152. Hoke, R.A., Ankley, G.T., 2005. Application of frog embryo teratogenesis assay– Xenopus to ecological risk assessment. Environ. Toxicol. Chem./SETAC 24, 2677–2690. Li, Y., Qi, X.M., Xue, X., Wu, X.F., Wu, Y.F., Chen, M., Xing, G.Z., Luan, Y., Ren, J., 2009. The relationship between diphenylamine structure and NSAIDs-induced hepatocytes injury. Toxicol. Lett. 186, 111–114. Mastrangelo, D., Wisard, M., Rohner, S., Leisinger, H., Iselin, C.E., 2000. Diclofenac and NS-398, a selective cyclooxygenase-2 inhibitor, decrease agonist-induced contractions of the pig isolated ureter. Urol. Res. 28, 376–382.

Mei, N., Guo, L., Tseng, J., Dial, S.L., Liao, W., Manjanatha, M.G., 2008. Gene expression changes associated with xenobiotic metabolism pathways in mice exposed to acrylamide. Environ. Mol. Mutagen. 49, 741–745. Montenegro, M.A., Palomino, H., 1990. Induction of cleft palate in mice by inhibitors of prostaglandin synthesis. J. Craniofac. Genetics Device Biol. 10, 83–94. Mouche, I., Leconte, I., Malesic, L., Kerbrat, M., Brunet, G., Chevalier, F., Gillardeaux, O., 2011a. Fetax correlation with in vivo embryotoxicity studies and comparison to danio rerio teratogenesis assay (DarT). Toxicol. Lett. 205. S168–S168. Mouche, I., Malesic, L., Gillardeaux, O., 2011b. FETAX assay for evaluation of developmental toxicity. Methods Mol. Biol. 691, 257–269. Nassef, M., Kim, S.G., Seki, M., Kang, I.J., Hano, T., Shimasaki, Y., Oshima, Y., 2010. In ovo nanoinjection of triclosan, diclofenac and carbamazepine affects embryonic development of medaka fish (Oryzias latipes). Chemosphere 79, 966–973. Rein, A.J., Nadjari, M., Elchalal, U., Nir, A., 1999. Contraction of the fetal ductus arteriosus induced by diclofenac. Case report. Fetal Diagnosis Ther. 14, 24–25. Sallmann, A.R., 1986. The history of diclofenac. Am. J. Med. 80, 29–33. Sharma, B., Patino, R., 2008. Exposure of Xenopus laevis tadpoles to cadmium reveals concentration-dependent bimodal effects on growth and monotonic effects on development and thyroid gland activity. Toxicol. Sci.: Official J. Soc. Toxicol. 105, 51–58. Siu, S.S., Yeung, J.H., Lau, T.K., 2000. A study on placental transfer of diclofenac in first trimester of human pregnancy. Hum. Reprod. 15, 2423–2425. Villalonga, N., David, M., Bielanska, J., Vicente, R., Comes, N., Valenzuela, C., Felipe, A., 2010. Immunomodulation of voltage-dependent K+ channels in macrophages: molecular and biophysical consequences. J. Gen. Physiol. 135, 135–147. Zenker, M., Klinge, J., Kruger, C., Singer, H., Scharf, J., 1998. Severe pulmonary hypertension in a neonate caused by premature closure of the ductus arteriosus following maternal treatment with diclofenac: a case report. J. Perinat. Med. 26, 231–234.