- Email: [email protected]
Evaluation of dried blood spot samples for hepatitis C virus detection and quantification
Accepted Manuscript Title: EVALUATION OF DRIED BLOOD SPOT SAMPLES FOR HEPATITIS C VIRUS DETECTION AND QUANTIFICATION Author: Brunna Lemos Crespo Marques M´arcia Paschoal do Esp´ırito-Santo Vanessa Alves Marques Juliana Cust´odio Miguel Elisangela Ferreira da Silva Cristiane Alves Villela-Nogueira Lia Laura Lewis-Ximenez Elisabeth Lampe Livia Melo Villar PII: DOI: Reference:
S1386-6532(16)30179-2 http://dx.doi.org/doi:10.1016/j.jcv.2016.07.009 JCV 3664
To appear in:
Journal of Clinical Virology
Received date: Revised date: Accepted date:
8-2-2016 18-7-2016 19-7-2016
Please cite this article as: Marques Brunna Lemos Crespo, do Esp´ırito-Santo M´arcia Paschoal, Marques Vanessa Alves, Miguel Juliana Cust´odio, da Silva Elisangela Ferreira, Villela-Nogueira Cristiane Alves, Lewis-Ximenez Lia Laura, Lampe Elisabeth, Villar Livia Melo.EVALUATION OF DRIED BLOOD SPOT SAMPLES FOR HEPATITIS C VIRUS DETECTION AND QUANTIFICATION.Journal of Clinical Virology http://dx.doi.org/10.1016/j.jcv.2016.07.009 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
EVALUATION OF DRIED BLOOD SPOT SAMPLES FOR HEPATITIS C VIRUS DETECTION AND QUANTIFICATION
Brunna Lemos Crespo Marques1, Márcia Paschoal do Espírito-Santo1, Vanessa Alves Marques1, Juliana Custódio Miguel1, Elisangela Ferreira da Silva1, Cristiane Alves Villela-Nogueira2, Lia Laura Lewis-Ximenez1, Elisabeth Lampe1, Livia Melo Villar1. 1Laboratory
of Viral Hepatitis, Oswaldo Cruz Institute, FIOCRUZ, Rio de Janeiro,
Brazil. 2Hepatology
Division, Clementino Fraga Filho University Hospital, Federal
University of Rio de Janeiro, Rio de Janeiro, Brazil.
*Correspondence to: Livia Melo Villar, Viral Hepatitis Laboratory, Helio and Peggy Pereira Pavillion - Ground Floor - Room B09, FIOCRUZ Av. Brasil, 4365 - Manguinhos - Rio de Janeiro, RJ, Brazil. Postal Code: 210360-040. Tel: +55 21 2562 1918 E-mail: lvillar@ioc.fiocruz.br
WORD COUNT ABSTRACT: 250 WORD COUNT ARTICLE: 2,776
1
Highlights
Optimization of qualitative and quantitative methods for HCV RNA in serum and DBS.
In house qPCR for HCV in serum showed good correlation to commercial assay.
Detection limit of qPCR for HCV in DBS is 58.5 copies/ml.
Our method enabled HCV genotyping in DBS samples.
ABSTRACT Background: Dried blood spots (DBS) could be an excellent alternative for HCV diagnosis, since it is less invasive and can be stored and transported without refrigeration. Objectives: The aim of this study was to optimize quantitative and qualitative methods for HCV detection in DBS. Study Design: DBS and serum samples were collected from 99 subjects (59 anti-HCV/HCV RNA positive and 40 seronegative samples). Seven extraction methods and different PCR parameters were evaluated in DBS samples in the quantitative RT-PCR (qRT-PCR) developed to amplify the 5' noncoding region of HCV. A qualitative PCR for amplification of NS5B region of HCV was also valued and the nested-PCR sequenced. Results: The qRT-PCR showed good correlation to commercial assay for HCV viral measurement in serum. To quantify HCV RNA in DBS, it was necessary to increase reverse transcriptase and cDNA concentration. HCV RNA quantification in DBS demonstrated sensitivity of 65.9%, 100% of specificity and kappa statistic of 0.65. The median viral load of DBS samples was 5.38 log10 copies/ml (minimum value=1.76 and maximum value=10.48 log10 copies/ml). 2
HCV RNA was detected in NS5B regions and nucleotide sequences obtained in 43 serum and 11 DBS samples. The presence of the same subtype was observed in paired serum and DBS samples. Conclusions: In this study, it was possible to demonstrate that, despite the low sensitivity, the optimized protocol was able to determine the viral load, as well as, the infecting HCV genotype, validating the usefulness of DBS for viral load determination and molecular epidemiology studies of HCV.
Keywords: Hepatitis C Virus; Dried blood Spot (DBS); quantitative methods; genotyping; optimization.
1- BACKGROUND Diagnosis of Hepatitis C virus (HCV) infection is made by detection of antibodies, antigen and genome of the virus in serum samples obtained by blood collection. Dried blood spots (DBS) could be an excellent alternative for HCV diagnosis, since it is less invasive, can be stored and transported without refrigeration and highly trained personnel are not required [1-3]. HCV RNA was detected in DBS samples showing different values of sensitivity and specificity [3-10], but most of these studies optimized commercial methods that were developed for serum or plasma samples.
3
2. OBJECTIVES The objective of this study was to optimize quantitative and qualitative methods for HCV detection in DBS samples.
3. STUDY DESIGN 3.1. Studied population The participants were recruited at Viral Hepatitis Laboratory (Oswaldo Cruz Foundation, Rio de Janeiro) and Hepatology Unit at Clementino Fraga Filho University Hospital (Federal University of Rio de Janeiro, Rio de Janeiro) from 2010
to
2012.
Fiocruz
ethics
committee
approved
the
study.
Inclusion criteria were age 18 years or older, of any gender, race or ethnicity. After giving their informed consent, the participants provided serum and DBS samples. A total of 59 HCV-infected individuals with both anti-HCV and HCV RNA detected in serum, and 40 individuals, who tested negative for anti-HCV, were included. Mean age±SD was 47.3 (± 16.6) years and more than 50% were female (56.5%).
3.2. Sample collection and processing Blood samples were collected by venipuncture to obtain whole blood and serum samples. DBS samples were obtained by spotting 3–5 drops (approximately 75 L) of whole blood onto Whatman filter paper (Whatman
4
Protein SaverTM n° 903, G&E) to fill completely 12-mm preprinted circular paper disks and processed as described previously [1].
3.3. Anti-HCV detection DBS and serum samples were tested for anti-HCV using commercial enzyme immunoassay (EIA) (HCV Ab Radim, Pomezia, Italy). For serum samples, supplier’s information was followed and for DBS, sample volume was increased (200 microliters of DBS eluate and 20 microliters of serum were used) [1].
3.4. Evaluation of HCV RNA extraction methods For serum, HCV RNA was extracted using QIAamp Viral RNA Mini Kit (Qiagen, Germany) according supplier’s instructions. Seven extraction methods were evaluated using HCV spiked DBS panel. This panel was prepared by diluting serum sample containing HCV (viral load of 8.69 x 106 copies/mL) in negative blood to give dilutions ranging between 8.69 x 105 copies/mL to 8.69 copies/mL and seventy-five microliters of each dilution was then spotted onto Protein SaverTM 903® Cards as described above. The extraction methods were: (I) QIAamp Viral RNA Mini Kit (Qiagen, Germany); (II) QIAamp DNA Mini Kit/ QIAamp DNA Blood Mini Kit (Qiagen); (III) SV Total RNA Isolation System (Promega, USA); (IV) Genomic DNA from Blood (Nucleospin, Germany); (V) Dried Blood Spot (DBS) Genomic DNA Isolation Kit 5
(Norgen Biokit Corp, Canada); (VI) Fenol-Cloroformio [11]; (VII) Metanol [12]. Principle of the method, elution volume and number of discs of DBS for each sample are presented in table 1. For commercial methods, it was used disk sizes recommended by the manufacturers. For nucleospin Blood kit, it was employed the same elution volume recommended by the manufacturer. For other commercial methods, elution volume was decreased to 2 to 5 fold in comparison to manufacturer´s recommendation. For in house methods, disk size and elution volume was the same as described previously and cited in table 1.
3.6. Development of quantitative PCR (qPCR) for HCV To construct standard curve for in house qPCR, serum sample containing HCV RNA (genotype 1b and viral load of 1.33 x 105 copies/mL) was submitted to PCR for amplification of HCV 5' non coding region (NCR) [13]. Amplicons were purified using QIAquick Gel Extraction set (QIAGEN, Hilden, Germany) and cloned using pCR ® 4 TOPO ® (Invitrogen, USA) according manufacturer’s instructions. DNA concentration was determined by spectrophotometer at a wavelength of 260nm (BioPhotometer, Eppendorf, Hamburg, Germany). Quantification is available in ng/microliters and converted to copies/mL using the following formula: number of copies = (ng * 6.022 x 1023)/(length of base pairs of recombinant plasmid * 660). A tenfold serial dilutions were carried out ranging from 1010 to 10 copies/mL for obtaining the standard curve.
6
3.7. Design of probes and primers Sequences of 5' NCR of HCV were aligned using CLUSTAL X software, version 1.83 [14], to determine the optimal design for primers and probes. Primer Express (Applied Biosystems, USA) was used to generate an assay containing primers and probe for specific detection and quantification of 5'NCR common to all
genotypes
antisense
PR3
sense
(5’TATGAYACCCGCTGYTTTGACTC3’),
(5’GCNGARTAYCTVGTCATAGCCTC3’),
PR5
antisense
PR4 (5’
GCTAGTCATAGCCTCCGT3’). The probe was labeled with a particular fluorophore at 5'(FAM), and a quencher at 3' end (TAMRA).
3.8. In house qPCR for HCV in serum and DBS samples Reactive anti-HCV serum samples were submitted to COBAS TaqMan ® HCV (Roche, New Jersey, USA) for quantitative detection of HCV [detection limit of 8.8 copies/ mL in serum]. For serum samples, 10 L of RNA was used as template for cDNA construction using 20 pmol of random primers and 200 U of SuperScript enzyme Reverse Transcriptase III (Invitrogen, CA,USA) in a final volume of 20 L at 50ºC for 1 hour, followed by 10 minutes incubation at 70ºC [13]. In house qPCR for HCV RNA was conducted using iCycler machine (Biorad, France) and TaqMan methodology. For each reaction, 0.4 L of real time TaqMan assay [300 nM concentration of each primer and 150nm of TaqMan probe (Gentec , Applied Biosystems assay , CA)], 12.5 L of the reaction mixture: 1x 7
TaqMan Universal PCR Master Mix (buffer, dNTPs UTP , AmpErase UNG , and AmpliTaq Gold DNA polymerase) (Roche, New Jersey, USA), and 6.7L of ultrapure distilled water were used. Reaction conditions were: initial step of 50°C for 2 minutes, followed by a denaturation step at 95°C for 10 minutes, and 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. For serum samples, 5.4 L of cDNA was used. For optimization of reaction condition for DBS samples, a panel of six DBS samples (3 HCV RNA negative and 3 HCV RNA positive presenting mean±SD value of 5.72 ± 0.61 log copies/mL at serum samples) was used to evaluate cDNA volume (5 L and 7.5 L), Superscript III reverse transcriptase volume (Invitrogen™, Life Technologies, Carlsbad, CA) (1 L and 1.5 L) and number of amplification cycles (40 and 45) for reaction. Negative controls were included in all steps as mentioned above. All samples were tested in duplicate and absolute quantification was done using the internal standard curve. Sensitivity and specificity were determined comparing the results obtained among paired DBS and serum. Reproducibility was done by the analysis of five reactions of internal curve executed in five different days and by analysis of four DBS specimens (3 HCV RNA positive and 1 HCV RNA negative) assayed on 3 consecutive days as blind procedure for the operator. The presence of inhibitors were determined using Applied Biosystems® TaqMan® GAPDH Control Reagents kit (ThermoFisher Scientific, USA) as described by manufacturer.
8
3.9. Qualitative detection of HCV RNA in NS5B region in serum and DBS samples Qualitative HCV RNA detection was performed using a RT nested PCR for amplification of NS5B region of HCV using primers described by Sandres-Sauné et al. [15] and the conditions previously described [16]. For DBS samples, cDNA volumes of 5L and 7.5L were evaluated. Sequence analysis was performed using nested RT-PCR products after purifying it with the QIAquick gel extraction kit (Qiagen, Hilden, Germany). Direct nucleotide sequencing reaction was done in both directions using Big Dye Terminator kit (version 3.1, Applied Biosystems, Foster City, CA, USA) with PR3 and PR5 primers. Sequencing reactions were analyzed on ABI3730 automated sequencer (Applied Biosystems). The sequencing protocol was done as described by Otto et al. [17]. Nucleotide sequence was analysed and aligned using Clustal X software [18]. The phylogenetic tree was constructed with MEGA 6.0 software [19] using the Neighbor-Joining and the Maximum Composite Likelihood methods. The reliability of the phylogenetic tree was assessed by bootstrap test (1000 replicates). The analysis involved 12 reference sequences representative of HCV genotypes 1 and 3 available in Genbank (referred in the phylogenetic tree by subtype, followed by the number of access to Genbank). The HCV sequences determined in this study were registered in the GenBank database under the accession numbers KF878974 to KF879006.
9
3.11. Data analysis Descriptive statistical analysis was performed with calculation of means and standard deviation (SD), frequencies and confidence intervals (CI) of 95%. Paired Wilcoxon and spearman correlation tests were used for comparison of HCV RNA among commercial and in house methods, being significant when p value is <0.05. Statistical analysis was determined using GraphPad InStat 1.3 (San Diego, CA GraphPad software) and MedCalc (version 9.2.1.0, MedCalc Software, Belgium) software.
4. RESULTS
4.1.
Anti-HCV detection in serum and DBS Samples In this study, of the 59 anti-HCV positive serum sample 56 were also
reactive in DBS sample, while the 40 anti-HCV negative serum were also negative in DBS samples. Sensitivity of anti-HCV test in DBS assay was 94.9% (95%CI 85.8–98.9), specificity was 100% (95% CI 91.2–100), positive predictive value (PPV) was 100% (95% CI 93.6–100), negative predictive value (NPV) was 93.0% (95% CI 80.9–98.5) and kappa coefficient was 0.93.
4.2.
Evaluation of HCV RNA extraction method for DBS samples Using HCV spiked DBS panel, HCV RNA was only detected in samples
that were submitted to QIAamp DNA Mini kit (Qiagen, Germany) down to 8.69 x
10
104 copies/mL and phenol chloroform method down to 8.69 x 105 copies/mL, and thus Qiamp DNA mini kit was choosen to extract HCV RNA in DBS samples.
4.3. Development of in house qPCR for HCV RNA Sequence used for designing primers and probes for qPCR showed more than 95% of similarity to 300 sequences of HCV from genotypes 1-6. The sequences of primers and probe developed in this study are described on table 2. The chosen plasmid was approximately 1 x 1010 copies/ µL and this sample was tenfold serial diluted in DNAse free water to obtain standard curve (1 x 109 to 10 copies/µL). The standard curve exhibited linear regression coefficient (R2) of 0.997, "slope" of -3.22 and efficiency of 100%.
4.4.
Optimization of reaction conditions of qPCR for DBS samples
No statistical difference was observed among median viral load of DBS samples according number of cycles, transcriptase reverse and cDNA volumes. Nevertheless, high mean viral load was observed when 1.5 L of reverse transcriptase and 7.5L of cDNA was used and these conditions were followed for DBS testing. HCV RNA was not detected among DBS negative samples.
4.5.
Quantitative detection of HCV RNA in serum
11
Among 59 HCV RNA reactive serum samples by commercial method, 44 were also detected by in house qRT-PCR. Median viral load by in house method was 4.94 log10 copies/mL (minimum of 3.26 and maximum of 10.68) and using commercial method was 6 log10 copies / mL (minimum of 1 and maximum of 7.2). A good correlation was observed among HCV viral load in serum samples for both methods (rho = 0.263 equal to R, p = 0.085) (Figure 1). All anti-HCV negative serum samples tested negative for HCV RNA by both methods. In house qPCR for serum demonstrated sensitivity of 74.6%, specificity of 100.0% and kappa statistic of 0.703 compared to commercial method.
4.6.
Quantitative detection of HCV RNA in DBS
Among 44 HCV RNA reactive serum samples by qPCR, HCV RNA was also quantified among 35 DBS samples (median viral load of 5.38 log10 copies/ml and minimum value = 1.76 and maximum value = 10.48 log10 copies/ml). A median viral load of 3.74 log10 copies/ml (3.74 to 10.63 log10 copies/mL) was observed among paired HCV RNA reactive serum samples by in house qPCR. A positive correlation was observed among median HCV RNA viral load of serum and DBS samples (r = 0.515, p = 0.004) (Figure 2). In house qPCR showed a limit of detection of HCV of 58.5 copies/ml in DBS that is lower than observed for in house serum assay.
12
In house qPCR for DBS demonstrated 65.9% of sensitivity, 100% of specificity and kappa statistic of 0.648 in comparison to in house qRT-PCR results in serum samples (Figures 1 and 2).
4.7.
Evaluation of Quality Parameters of qPCR
A good reproducibility of in house qPCR was observed when internal curve was assayed for five consecutive days (p = 0.99). Low coefficient variation (CV) was observed during the period of testing for each sample (table 3). In addition, low variation of CV was observed among 3 HCV RNA reactive DBS samples tested for 3 consecutive days (0.34 – 3.03%). No amplification was observed for HCV RNA negative DBS in these 3 days. Absence of inhibitors was observed by testing DBS using GAPDH as internal control.
4.8.
Qualitative detection of HCV RNA in NS5B region
Forty-five out of 59 anti-HCV reactive serum samples were HCV RNA positive by qualitative assay. Among 45 individuals presenting HCV RNA reactive serum samples, 15 also had HCV RNA in DBS using qualitative assay. Of those, nucleotide sequences for HCV RNA were obtained for 43 serum and 11 DBS. Among serum samples, 29 were classified as subgenotype 1b, 13 as subgenotype 1a, 1 as genotype 3. In DBS, 9 were subgenotype 1b and 2 were subgenotype 1a (Figure 3). Among 11 individuals that presented HCV RNA in serum and DBS, 1 showed the same nucleotide sequence in both specimens and
13
10 showed the same subgenotype, but different nucleotide sequence among serum and DBS.
5. DISCUSSION HCV diagnosis is quite difficult in low resource areas due to constraints for sample collection. In the present study, quantitative and qualitative methods for HCV RNA was optimized among DBS samples. First, extraction methods for HCV RNA in DBS were evaluated and the most efficient was QIAamp DNA Mini Kit (Qiagen, Germany), the same method used for quantitative detection of HCV RNA using in house qPCR using SybrGreen method [5]. In order to optimize qPCR for DBS, cDNA and transcriptase reverse concentration were increased, probably due to low HCV RNA concentration in DBS samples. Optimization of reaction conditions is fundamental for developing of in house methods as the same as demonstrated by Zhang et al. [20]. In house qPCR showed low limit of detection in DBS (58.5 copies/ml) in DBS compared to previous studies that used in house Taqman quantitative RT-PCR (minimum of 675 copies/ml) [6], SYBR green quantitative PCR (1350 copies/ml) [5] and PCR (2700 copies/mL) [21]. These results could be attributable to primers and probe developed in the present study, since they showed more than 90% of homology among HCV sequences at Genbank. In house qPCR in serum demonstrated a high low limit of detection compared to commercial assay. However, for HCV diagnosis, the lower limit of detection may not be useful since HCV infected patients are expected to have 14
high levels of HCV RNA in their blood. Then in-house assay could be useful for HCV testing in low resource areas. In house qPCR was useful for HCV RNA quantification in DBS and serum samples as the same as showed by Tuaillon et al. [4] and Bennett et al. [6]. In addition, the limit of detection for DBS was lower than observed in serum, what could be due to differences in viral RNA extraction and PCR conditions. The utility of DBS samples for determination of HCV genotype was evaluated by comparing the results of the respective serum samples. There was a predominance of genotype 1 as the same as observed among DBS of drug users from Senegal [22]. All patients presented the same genotype in DBS and serum, but HCV RNA was not detected in several DBS samples, probably due to low viral load in these specimens. High rate of similarity among nucleotide sequence of serum and DBS was observed demonstrating the usefulness of DBS for molecular epidemiology studies. The same observation was demonstrated by Hope et al [23] who analyzed serum and DBS samples from drug users in United Kingdom. Some sequence heterogeneity was observed among DBS and serum samples from the same individuals (S1293/SPF1293, S1493/SPF1493 and S1619/SPF1619). This could occur due to the presence of HCV quasiespecies or viral replication in other cells, like PBMC. As conclusion, in house qPCR was developed for HCV RNA in serum and DBS demonstrating the usefulness of DBS for viral load determination. In addition, HCV genotype determination could be done using DBS samples demonstrating the utility of these samples for diagnosis and molecular epidemiology studies of HCV. 15
Competing interests: The authors disclose no actual or potential conflicts of interest, including any financial, personal or other relationships with people or organizations within two years of the beginning of this study that could inappropriately influence the study.
Funding: This research was supported by the Fundação de Amparo a Pesquisa do Estado do Rio de Janeiro (FAPERJ), the Brazilian National Council of Technological and Scientific Development (CNPq), Brazilian Ministry of Health, the Coordination of Improvement of Higher Education Personnel (CAPES) and the Oswaldo Cruz Foundation (FIOCRUZ).
Ethical Approval: This study was approved by the Ethics Committee of FIOCRUZ under the number protocol 459/08.
Acknowledgments: The authors would like to thank technicians of Viral Hepatitis Laboratory for technical assistance. The authors are grateful to the sequencing group of the PDTIS program from Oswaldo Cruz Foundation for performing the DNA sequencing.
16
REFERENCES
1. B.L.C. Marques, C.U. Brandão, E.F. Silva, V.A. Marques, C.A. VillelaNogueira, K.M.R. do Ó et al., Dried Blood Spot Samples: Optimization of Commercial EIAs for Hepatitis C Antibody Detection and Stability Under Different Storage Conditions. J. Med. Virol. 84 (2012) 1600-1607.
2. C.P. Brandão, B.L. Marques, V.A. Marques, C.A. Villela-Nogueira, K.M. do Ó, M.T. de Paula, et al., Simultaneous detection of hepatitis C virus antigen and antibodies in dried blood spots. J. Clin. Virol. 57 (2013) 98102.
3. J. Greenman, T. Roberts, J. Cohn, L. Messac, Dried blood spot in the genotyping, quantification and storage of HCV RNA: a systematic literature review. J. Viral Hepat. 22 (2015) 353-61.
4. E. Tuaillon, A.M. Mondain, F. Meroueh, L. Ottomani, M.C. Picot, N. Nagot et al., Dried Blood Spot for Hepatitis C Virus Serology and Molecular Testing. Hepatology 51 (2010) 752-758.
5. E. De Crignis, M.C. Re, L. Cimatti, L. Zecchi, D. Gibellini. HIV-1 and HCV detection in dried blood spots by SYBR Green multiplex real-time RT-PCR. J Virol Methods 165 (2010) 51-56. 17
6. S. Bennet, R.N. Gunson, G.E. McAllister, S.J. Hutchinson, D.J. Goldberg, S.O. Cameron, et al., Detection of hepatitis C virus RNA in dried blood spots. J. Clin. Virol. 54 (2012) 106– 109.
7. C. Santos, A. Reis, C.V. dos Santos, C. Damas, M.H. Silva, M.V. Viana, et al., The use of real-time PCR to detect hepatitis C virus RNA in dried blood spots from Brazilian patients infected chronically. J. Virol. Methods 179 (2012) 17– 20.
8. A. Soulier, L. Poiteau, I. Rosa, C. Hézode, F. Roudot-Thoraval, J.M. Pawlotsky, et al., Dried blood spots: a tool to ensure broad access to hepatitis C screening, diagnosis and treatment monitoring. J. Infect. Dis. 2015 Sep 2. pii: jiv423.
9. E.K. Dokubo, J. Evans, V. Winkelman, S. Cyrus, L.H. Tobler, A. Asher A, et al., Comparison of Hepatitis C Virus RNA and antibody detection in dried blood spots and plasma specimens. J Clin Virol. 59 (2014) 223-7.
10. A. Tejada-Strop, J. Drobeniuc, T. Mixson-Hayden, J.C. Forbi, N.T. Le, L. Li, et al., Disparate detection outcomes for anti-HCV IgG and HCV RNA in dried blood spots. J. Virol. Methods 212 (2015) 66-70.
18
11. J. Sambrook, E.F. Fritsch, T. Maniatis. Molecular Cloning: A Laboratory Manual. 2nd edition. New York: Cold Spring Harbor Laboratory Press; 1989.
12. S. Bereczky, A. Martensson, J.P. Gil, A. Farnert, Short report: Rapid DNA Extraction from archive blood spot on filter paper for genotyping of Plasmodium Falciparum. Am. J. Trop. Med. Hyg. 72 (2005) 249–251.
13. P.P. Martins, E. Lampe, L.L. Lewis-Ximenez, P.S. de Souza, C.A. Fernandes, L.M. Villar. Performance of molecular methods for hepatitis C virus diagnosis: usefulness among chronic cases and during the course of infection. Clin. Lab. 9-10 (2013) 1031-9.
14. J.D. Thompson, T.J. Gibson, F. Plewniak, F. Jeanmougin, D.G. Higgins, et al. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25 (1997) 4876-4882.
15. K. Sandres-Sauné, P. Deny, C. Pasquier, V. Thibaut, G. Duverlie, J. Izopet. Determining hepatitis C genotype by analyzing the sequence of the NS5b region. J. Virol. Methods 109 (2003) 187-93.
19
16. E. Lampe, L. Lewis-Ximenez, M.P. Espírito-Santo, N.M. Delvaux, S.A. Pereira, A. Peres-da-Silva, et al., Genetic diversity of HCV in Brazil. Antivir. Ther. 18 (2013) 435-44.
17. T.D. Otto, E.A. Vasconcellos, L.H. Gomes, A.S. Moreira, W.M. Degrave, L. Mendonça-Lima, et al., ChromaPipe: a pipeline for analysis, quality control and management for a DNA sequencing facility. Genet. Mol. Res. 7 (2008) 861-71.
18. M.A. Larkin, G. Blackshields, N.P. Brown, R. Chenna, P.A. McGettigan, H. McWilliam, et al., Clustal W and Clustal X version 2.0. Bioinformatics. 23 (2007) 2947-2948.
19. K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 30 (2013) 2725-2729.
20. E.Z. Zhang, D.J. Bartels, J.D. Frantz, S. Seepersaud, J.A. Lippke, B. Shames, et al., Development of a sensitive RT-PCR method for amplifying and sequencing near full-length HCV genotype 1 RNA from patient samples. Virol. J. 10 (2013) :53.
20
21. B.S. Brown, P.E. Klapper, M. Guiver. Development of diagnostic serological and molecular screening from dried blood spots for HCV,HIV, HBV and syphilis. J. Clin. Virol. 44 Supplement 1 (2009) S27-S28.
22. O. Ndiaye, J. Gozlan, H. Diop-Ndiaye, A.S. Sall, S. Chapelain, A. Leprêtre, et al., Usefulness of Dried Blood Spots (DBS) to perform hepatitis C virus genotyping in drug users in Senegal. J. Med. Virol. 2015 Dec 24.
23. V.D. Hope, M. Hickman, S.L. Ngui, S. Jones, M. Telfer, M. Bizzarri, et al., Measuring the incidence, prevalence and genetic relatedness of hepatitis C infections among a community recruited sample of injecting drug users, using dried blood spots. J. Viral Hepat. 18 (2011) 262-270.
21
Figure 1. Quantitative comparison of HCV viral load (log10 copies/ml) in serum samples determined by commercial and in house quantitative methods (p = 0.085).
22
Figure 2. Quantitative comparison of HCV viral load (log10 copies/ml) among paired serum and dried blood spot (DBS) samples determined by in house quantitative methods (p = 0.004).
23
Figure 3. Phylogenetic tree of HCV NS5B sequences of 43 serum samples (S) and 11 dried blood spot samples (SPF) of this study and 12 sequences from HCV genotypes 1 and 3 obtained from GeneBank.
24
Table 1. RNA extraction methods evaluated in this study for DBS samples. Number and size of DBS discs used in this study
RNA elution volume determined by manufacturer
RNA elution volume used in this study
3 (3mm)
150L
30L
3 (3mm)
30-50L
30L
SV Total RNA Isolation System (Promega, USA)
1 (6mm)
100L
40L
Nucleospin Blood (Nucleospin, Germany)
1 (6mm)
100L
100L
3 (3mm)
200L
60L
1 (12mm)
25L
25L
1 (3mm)
65L
65L
RNA Extraction
Method
QIAamp DNA Mini Kit (Qiagen, Germany) QIAamp Viral RNA Mini Kit (Qiagen, Germany)
Dried Blood Spot (DBS) Genomic DNA Isolation Kit (Norgen Biotek, Canada)
Silica gel
Resin
Phenol cloroform (Maniatis et al., 1989) Chemical Reaction Methanol (Bereczky et al., 2005)
25
Table 2. Sequences of primers and probes used in this study for in house quantitative PCR Oligonucleotides
Sequence
Position in HCV genome (5’ non coding region)
Primer sense
GCGAAAGGCCTTGTGGTACT
271- 290
Primer anti-sense
ACGGTCTACGAGACCTCCC
318-336
Probe
ACTCGCAAGCACCCTAT
296-312
26
S1386-6532(16)30179-2 http://dx.doi.org/doi:10.1016/j.jcv.2016.07.009 JCV 3664
To appear in:
Journal of Clinical Virology
Received date: Revised date: Accepted date:
8-2-2016 18-7-2016 19-7-2016
Please cite this article as: Marques Brunna Lemos Crespo, do Esp´ırito-Santo M´arcia Paschoal, Marques Vanessa Alves, Miguel Juliana Cust´odio, da Silva Elisangela Ferreira, Villela-Nogueira Cristiane Alves, Lewis-Ximenez Lia Laura, Lampe Elisabeth, Villar Livia Melo.EVALUATION OF DRIED BLOOD SPOT SAMPLES FOR HEPATITIS C VIRUS DETECTION AND QUANTIFICATION.Journal of Clinical Virology http://dx.doi.org/10.1016/j.jcv.2016.07.009 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
EVALUATION OF DRIED BLOOD SPOT SAMPLES FOR HEPATITIS C VIRUS DETECTION AND QUANTIFICATION
Brunna Lemos Crespo Marques1, Márcia Paschoal do Espírito-Santo1, Vanessa Alves Marques1, Juliana Custódio Miguel1, Elisangela Ferreira da Silva1, Cristiane Alves Villela-Nogueira2, Lia Laura Lewis-Ximenez1, Elisabeth Lampe1, Livia Melo Villar1. 1Laboratory
of Viral Hepatitis, Oswaldo Cruz Institute, FIOCRUZ, Rio de Janeiro,
Brazil. 2Hepatology
Division, Clementino Fraga Filho University Hospital, Federal
University of Rio de Janeiro, Rio de Janeiro, Brazil.
*Correspondence to: Livia Melo Villar, Viral Hepatitis Laboratory, Helio and Peggy Pereira Pavillion - Ground Floor - Room B09, FIOCRUZ Av. Brasil, 4365 - Manguinhos - Rio de Janeiro, RJ, Brazil. Postal Code: 210360-040. Tel: +55 21 2562 1918 E-mail: lvillar@ioc.fiocruz.br
WORD COUNT ABSTRACT: 250 WORD COUNT ARTICLE: 2,776
1
Highlights
Optimization of qualitative and quantitative methods for HCV RNA in serum and DBS.
In house qPCR for HCV in serum showed good correlation to commercial assay.
Detection limit of qPCR for HCV in DBS is 58.5 copies/ml.
Our method enabled HCV genotyping in DBS samples.
ABSTRACT Background: Dried blood spots (DBS) could be an excellent alternative for HCV diagnosis, since it is less invasive and can be stored and transported without refrigeration. Objectives: The aim of this study was to optimize quantitative and qualitative methods for HCV detection in DBS. Study Design: DBS and serum samples were collected from 99 subjects (59 anti-HCV/HCV RNA positive and 40 seronegative samples). Seven extraction methods and different PCR parameters were evaluated in DBS samples in the quantitative RT-PCR (qRT-PCR) developed to amplify the 5' noncoding region of HCV. A qualitative PCR for amplification of NS5B region of HCV was also valued and the nested-PCR sequenced. Results: The qRT-PCR showed good correlation to commercial assay for HCV viral measurement in serum. To quantify HCV RNA in DBS, it was necessary to increase reverse transcriptase and cDNA concentration. HCV RNA quantification in DBS demonstrated sensitivity of 65.9%, 100% of specificity and kappa statistic of 0.65. The median viral load of DBS samples was 5.38 log10 copies/ml (minimum value=1.76 and maximum value=10.48 log10 copies/ml). 2
HCV RNA was detected in NS5B regions and nucleotide sequences obtained in 43 serum and 11 DBS samples. The presence of the same subtype was observed in paired serum and DBS samples. Conclusions: In this study, it was possible to demonstrate that, despite the low sensitivity, the optimized protocol was able to determine the viral load, as well as, the infecting HCV genotype, validating the usefulness of DBS for viral load determination and molecular epidemiology studies of HCV.
Keywords: Hepatitis C Virus; Dried blood Spot (DBS); quantitative methods; genotyping; optimization.
1- BACKGROUND Diagnosis of Hepatitis C virus (HCV) infection is made by detection of antibodies, antigen and genome of the virus in serum samples obtained by blood collection. Dried blood spots (DBS) could be an excellent alternative for HCV diagnosis, since it is less invasive, can be stored and transported without refrigeration and highly trained personnel are not required [1-3]. HCV RNA was detected in DBS samples showing different values of sensitivity and specificity [3-10], but most of these studies optimized commercial methods that were developed for serum or plasma samples.
3
2. OBJECTIVES The objective of this study was to optimize quantitative and qualitative methods for HCV detection in DBS samples.
3. STUDY DESIGN 3.1. Studied population The participants were recruited at Viral Hepatitis Laboratory (Oswaldo Cruz Foundation, Rio de Janeiro) and Hepatology Unit at Clementino Fraga Filho University Hospital (Federal University of Rio de Janeiro, Rio de Janeiro) from 2010
to
2012.
Fiocruz
ethics
committee
approved
the
study.
Inclusion criteria were age 18 years or older, of any gender, race or ethnicity. After giving their informed consent, the participants provided serum and DBS samples. A total of 59 HCV-infected individuals with both anti-HCV and HCV RNA detected in serum, and 40 individuals, who tested negative for anti-HCV, were included. Mean age±SD was 47.3 (± 16.6) years and more than 50% were female (56.5%).
3.2. Sample collection and processing Blood samples were collected by venipuncture to obtain whole blood and serum samples. DBS samples were obtained by spotting 3–5 drops (approximately 75 L) of whole blood onto Whatman filter paper (Whatman
4
Protein SaverTM n° 903, G&E) to fill completely 12-mm preprinted circular paper disks and processed as described previously [1].
3.3. Anti-HCV detection DBS and serum samples were tested for anti-HCV using commercial enzyme immunoassay (EIA) (HCV Ab Radim, Pomezia, Italy). For serum samples, supplier’s information was followed and for DBS, sample volume was increased (200 microliters of DBS eluate and 20 microliters of serum were used) [1].
3.4. Evaluation of HCV RNA extraction methods For serum, HCV RNA was extracted using QIAamp Viral RNA Mini Kit (Qiagen, Germany) according supplier’s instructions. Seven extraction methods were evaluated using HCV spiked DBS panel. This panel was prepared by diluting serum sample containing HCV (viral load of 8.69 x 106 copies/mL) in negative blood to give dilutions ranging between 8.69 x 105 copies/mL to 8.69 copies/mL and seventy-five microliters of each dilution was then spotted onto Protein SaverTM 903® Cards as described above. The extraction methods were: (I) QIAamp Viral RNA Mini Kit (Qiagen, Germany); (II) QIAamp DNA Mini Kit/ QIAamp DNA Blood Mini Kit (Qiagen); (III) SV Total RNA Isolation System (Promega, USA); (IV) Genomic DNA from Blood (Nucleospin, Germany); (V) Dried Blood Spot (DBS) Genomic DNA Isolation Kit 5
(Norgen Biokit Corp, Canada); (VI) Fenol-Cloroformio [11]; (VII) Metanol [12]. Principle of the method, elution volume and number of discs of DBS for each sample are presented in table 1. For commercial methods, it was used disk sizes recommended by the manufacturers. For nucleospin Blood kit, it was employed the same elution volume recommended by the manufacturer. For other commercial methods, elution volume was decreased to 2 to 5 fold in comparison to manufacturer´s recommendation. For in house methods, disk size and elution volume was the same as described previously and cited in table 1.
3.6. Development of quantitative PCR (qPCR) for HCV To construct standard curve for in house qPCR, serum sample containing HCV RNA (genotype 1b and viral load of 1.33 x 105 copies/mL) was submitted to PCR for amplification of HCV 5' non coding region (NCR) [13]. Amplicons were purified using QIAquick Gel Extraction set (QIAGEN, Hilden, Germany) and cloned using pCR ® 4 TOPO ® (Invitrogen, USA) according manufacturer’s instructions. DNA concentration was determined by spectrophotometer at a wavelength of 260nm (BioPhotometer, Eppendorf, Hamburg, Germany). Quantification is available in ng/microliters and converted to copies/mL using the following formula: number of copies = (ng * 6.022 x 1023)/(length of base pairs of recombinant plasmid * 660). A tenfold serial dilutions were carried out ranging from 1010 to 10 copies/mL for obtaining the standard curve.
6
3.7. Design of probes and primers Sequences of 5' NCR of HCV were aligned using CLUSTAL X software, version 1.83 [14], to determine the optimal design for primers and probes. Primer Express (Applied Biosystems, USA) was used to generate an assay containing primers and probe for specific detection and quantification of 5'NCR common to all
genotypes
antisense
PR3
sense
(5’TATGAYACCCGCTGYTTTGACTC3’),
(5’GCNGARTAYCTVGTCATAGCCTC3’),
PR5
antisense
PR4 (5’
GCTAGTCATAGCCTCCGT3’). The probe was labeled with a particular fluorophore at 5'(FAM), and a quencher at 3' end (TAMRA).
3.8. In house qPCR for HCV in serum and DBS samples Reactive anti-HCV serum samples were submitted to COBAS TaqMan ® HCV (Roche, New Jersey, USA) for quantitative detection of HCV [detection limit of 8.8 copies/ mL in serum]. For serum samples, 10 L of RNA was used as template for cDNA construction using 20 pmol of random primers and 200 U of SuperScript enzyme Reverse Transcriptase III (Invitrogen, CA,USA) in a final volume of 20 L at 50ºC for 1 hour, followed by 10 minutes incubation at 70ºC [13]. In house qPCR for HCV RNA was conducted using iCycler machine (Biorad, France) and TaqMan methodology. For each reaction, 0.4 L of real time TaqMan assay [300 nM concentration of each primer and 150nm of TaqMan probe (Gentec , Applied Biosystems assay , CA)], 12.5 L of the reaction mixture: 1x 7
TaqMan Universal PCR Master Mix (buffer, dNTPs UTP , AmpErase UNG , and AmpliTaq Gold DNA polymerase) (Roche, New Jersey, USA), and 6.7L of ultrapure distilled water were used. Reaction conditions were: initial step of 50°C for 2 minutes, followed by a denaturation step at 95°C for 10 minutes, and 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. For serum samples, 5.4 L of cDNA was used. For optimization of reaction condition for DBS samples, a panel of six DBS samples (3 HCV RNA negative and 3 HCV RNA positive presenting mean±SD value of 5.72 ± 0.61 log copies/mL at serum samples) was used to evaluate cDNA volume (5 L and 7.5 L), Superscript III reverse transcriptase volume (Invitrogen™, Life Technologies, Carlsbad, CA) (1 L and 1.5 L) and number of amplification cycles (40 and 45) for reaction. Negative controls were included in all steps as mentioned above. All samples were tested in duplicate and absolute quantification was done using the internal standard curve. Sensitivity and specificity were determined comparing the results obtained among paired DBS and serum. Reproducibility was done by the analysis of five reactions of internal curve executed in five different days and by analysis of four DBS specimens (3 HCV RNA positive and 1 HCV RNA negative) assayed on 3 consecutive days as blind procedure for the operator. The presence of inhibitors were determined using Applied Biosystems® TaqMan® GAPDH Control Reagents kit (ThermoFisher Scientific, USA) as described by manufacturer.
8
3.9. Qualitative detection of HCV RNA in NS5B region in serum and DBS samples Qualitative HCV RNA detection was performed using a RT nested PCR for amplification of NS5B region of HCV using primers described by Sandres-Sauné et al. [15] and the conditions previously described [16]. For DBS samples, cDNA volumes of 5L and 7.5L were evaluated. Sequence analysis was performed using nested RT-PCR products after purifying it with the QIAquick gel extraction kit (Qiagen, Hilden, Germany). Direct nucleotide sequencing reaction was done in both directions using Big Dye Terminator kit (version 3.1, Applied Biosystems, Foster City, CA, USA) with PR3 and PR5 primers. Sequencing reactions were analyzed on ABI3730 automated sequencer (Applied Biosystems). The sequencing protocol was done as described by Otto et al. [17]. Nucleotide sequence was analysed and aligned using Clustal X software [18]. The phylogenetic tree was constructed with MEGA 6.0 software [19] using the Neighbor-Joining and the Maximum Composite Likelihood methods. The reliability of the phylogenetic tree was assessed by bootstrap test (1000 replicates). The analysis involved 12 reference sequences representative of HCV genotypes 1 and 3 available in Genbank (referred in the phylogenetic tree by subtype, followed by the number of access to Genbank). The HCV sequences determined in this study were registered in the GenBank database under the accession numbers KF878974 to KF879006.
9
3.11. Data analysis Descriptive statistical analysis was performed with calculation of means and standard deviation (SD), frequencies and confidence intervals (CI) of 95%. Paired Wilcoxon and spearman correlation tests were used for comparison of HCV RNA among commercial and in house methods, being significant when p value is <0.05. Statistical analysis was determined using GraphPad InStat 1.3 (San Diego, CA GraphPad software) and MedCalc (version 9.2.1.0, MedCalc Software, Belgium) software.
4. RESULTS
4.1.
Anti-HCV detection in serum and DBS Samples In this study, of the 59 anti-HCV positive serum sample 56 were also
reactive in DBS sample, while the 40 anti-HCV negative serum were also negative in DBS samples. Sensitivity of anti-HCV test in DBS assay was 94.9% (95%CI 85.8–98.9), specificity was 100% (95% CI 91.2–100), positive predictive value (PPV) was 100% (95% CI 93.6–100), negative predictive value (NPV) was 93.0% (95% CI 80.9–98.5) and kappa coefficient was 0.93.
4.2.
Evaluation of HCV RNA extraction method for DBS samples Using HCV spiked DBS panel, HCV RNA was only detected in samples
that were submitted to QIAamp DNA Mini kit (Qiagen, Germany) down to 8.69 x
10
104 copies/mL and phenol chloroform method down to 8.69 x 105 copies/mL, and thus Qiamp DNA mini kit was choosen to extract HCV RNA in DBS samples.
4.3. Development of in house qPCR for HCV RNA Sequence used for designing primers and probes for qPCR showed more than 95% of similarity to 300 sequences of HCV from genotypes 1-6. The sequences of primers and probe developed in this study are described on table 2. The chosen plasmid was approximately 1 x 1010 copies/ µL and this sample was tenfold serial diluted in DNAse free water to obtain standard curve (1 x 109 to 10 copies/µL). The standard curve exhibited linear regression coefficient (R2) of 0.997, "slope" of -3.22 and efficiency of 100%.
4.4.
Optimization of reaction conditions of qPCR for DBS samples
No statistical difference was observed among median viral load of DBS samples according number of cycles, transcriptase reverse and cDNA volumes. Nevertheless, high mean viral load was observed when 1.5 L of reverse transcriptase and 7.5L of cDNA was used and these conditions were followed for DBS testing. HCV RNA was not detected among DBS negative samples.
4.5.
Quantitative detection of HCV RNA in serum
11
Among 59 HCV RNA reactive serum samples by commercial method, 44 were also detected by in house qRT-PCR. Median viral load by in house method was 4.94 log10 copies/mL (minimum of 3.26 and maximum of 10.68) and using commercial method was 6 log10 copies / mL (minimum of 1 and maximum of 7.2). A good correlation was observed among HCV viral load in serum samples for both methods (rho = 0.263 equal to R, p = 0.085) (Figure 1). All anti-HCV negative serum samples tested negative for HCV RNA by both methods. In house qPCR for serum demonstrated sensitivity of 74.6%, specificity of 100.0% and kappa statistic of 0.703 compared to commercial method.
4.6.
Quantitative detection of HCV RNA in DBS
Among 44 HCV RNA reactive serum samples by qPCR, HCV RNA was also quantified among 35 DBS samples (median viral load of 5.38 log10 copies/ml and minimum value = 1.76 and maximum value = 10.48 log10 copies/ml). A median viral load of 3.74 log10 copies/ml (3.74 to 10.63 log10 copies/mL) was observed among paired HCV RNA reactive serum samples by in house qPCR. A positive correlation was observed among median HCV RNA viral load of serum and DBS samples (r = 0.515, p = 0.004) (Figure 2). In house qPCR showed a limit of detection of HCV of 58.5 copies/ml in DBS that is lower than observed for in house serum assay.
12
In house qPCR for DBS demonstrated 65.9% of sensitivity, 100% of specificity and kappa statistic of 0.648 in comparison to in house qRT-PCR results in serum samples (Figures 1 and 2).
4.7.
Evaluation of Quality Parameters of qPCR
A good reproducibility of in house qPCR was observed when internal curve was assayed for five consecutive days (p = 0.99). Low coefficient variation (CV) was observed during the period of testing for each sample (table 3). In addition, low variation of CV was observed among 3 HCV RNA reactive DBS samples tested for 3 consecutive days (0.34 – 3.03%). No amplification was observed for HCV RNA negative DBS in these 3 days. Absence of inhibitors was observed by testing DBS using GAPDH as internal control.
4.8.
Qualitative detection of HCV RNA in NS5B region
Forty-five out of 59 anti-HCV reactive serum samples were HCV RNA positive by qualitative assay. Among 45 individuals presenting HCV RNA reactive serum samples, 15 also had HCV RNA in DBS using qualitative assay. Of those, nucleotide sequences for HCV RNA were obtained for 43 serum and 11 DBS. Among serum samples, 29 were classified as subgenotype 1b, 13 as subgenotype 1a, 1 as genotype 3. In DBS, 9 were subgenotype 1b and 2 were subgenotype 1a (Figure 3). Among 11 individuals that presented HCV RNA in serum and DBS, 1 showed the same nucleotide sequence in both specimens and
13
10 showed the same subgenotype, but different nucleotide sequence among serum and DBS.
5. DISCUSSION HCV diagnosis is quite difficult in low resource areas due to constraints for sample collection. In the present study, quantitative and qualitative methods for HCV RNA was optimized among DBS samples. First, extraction methods for HCV RNA in DBS were evaluated and the most efficient was QIAamp DNA Mini Kit (Qiagen, Germany), the same method used for quantitative detection of HCV RNA using in house qPCR using SybrGreen method [5]. In order to optimize qPCR for DBS, cDNA and transcriptase reverse concentration were increased, probably due to low HCV RNA concentration in DBS samples. Optimization of reaction conditions is fundamental for developing of in house methods as the same as demonstrated by Zhang et al. [20]. In house qPCR showed low limit of detection in DBS (58.5 copies/ml) in DBS compared to previous studies that used in house Taqman quantitative RT-PCR (minimum of 675 copies/ml) [6], SYBR green quantitative PCR (1350 copies/ml) [5] and PCR (2700 copies/mL) [21]. These results could be attributable to primers and probe developed in the present study, since they showed more than 90% of homology among HCV sequences at Genbank. In house qPCR in serum demonstrated a high low limit of detection compared to commercial assay. However, for HCV diagnosis, the lower limit of detection may not be useful since HCV infected patients are expected to have 14
high levels of HCV RNA in their blood. Then in-house assay could be useful for HCV testing in low resource areas. In house qPCR was useful for HCV RNA quantification in DBS and serum samples as the same as showed by Tuaillon et al. [4] and Bennett et al. [6]. In addition, the limit of detection for DBS was lower than observed in serum, what could be due to differences in viral RNA extraction and PCR conditions. The utility of DBS samples for determination of HCV genotype was evaluated by comparing the results of the respective serum samples. There was a predominance of genotype 1 as the same as observed among DBS of drug users from Senegal [22]. All patients presented the same genotype in DBS and serum, but HCV RNA was not detected in several DBS samples, probably due to low viral load in these specimens. High rate of similarity among nucleotide sequence of serum and DBS was observed demonstrating the usefulness of DBS for molecular epidemiology studies. The same observation was demonstrated by Hope et al [23] who analyzed serum and DBS samples from drug users in United Kingdom. Some sequence heterogeneity was observed among DBS and serum samples from the same individuals (S1293/SPF1293, S1493/SPF1493 and S1619/SPF1619). This could occur due to the presence of HCV quasiespecies or viral replication in other cells, like PBMC. As conclusion, in house qPCR was developed for HCV RNA in serum and DBS demonstrating the usefulness of DBS for viral load determination. In addition, HCV genotype determination could be done using DBS samples demonstrating the utility of these samples for diagnosis and molecular epidemiology studies of HCV. 15
Competing interests: The authors disclose no actual or potential conflicts of interest, including any financial, personal or other relationships with people or organizations within two years of the beginning of this study that could inappropriately influence the study.
Funding: This research was supported by the Fundação de Amparo a Pesquisa do Estado do Rio de Janeiro (FAPERJ), the Brazilian National Council of Technological and Scientific Development (CNPq), Brazilian Ministry of Health, the Coordination of Improvement of Higher Education Personnel (CAPES) and the Oswaldo Cruz Foundation (FIOCRUZ).
Ethical Approval: This study was approved by the Ethics Committee of FIOCRUZ under the number protocol 459/08.
Acknowledgments: The authors would like to thank technicians of Viral Hepatitis Laboratory for technical assistance. The authors are grateful to the sequencing group of the PDTIS program from Oswaldo Cruz Foundation for performing the DNA sequencing.
16
REFERENCES
1. B.L.C. Marques, C.U. Brandão, E.F. Silva, V.A. Marques, C.A. VillelaNogueira, K.M.R. do Ó et al., Dried Blood Spot Samples: Optimization of Commercial EIAs for Hepatitis C Antibody Detection and Stability Under Different Storage Conditions. J. Med. Virol. 84 (2012) 1600-1607.
2. C.P. Brandão, B.L. Marques, V.A. Marques, C.A. Villela-Nogueira, K.M. do Ó, M.T. de Paula, et al., Simultaneous detection of hepatitis C virus antigen and antibodies in dried blood spots. J. Clin. Virol. 57 (2013) 98102.
3. J. Greenman, T. Roberts, J. Cohn, L. Messac, Dried blood spot in the genotyping, quantification and storage of HCV RNA: a systematic literature review. J. Viral Hepat. 22 (2015) 353-61.
4. E. Tuaillon, A.M. Mondain, F. Meroueh, L. Ottomani, M.C. Picot, N. Nagot et al., Dried Blood Spot for Hepatitis C Virus Serology and Molecular Testing. Hepatology 51 (2010) 752-758.
5. E. De Crignis, M.C. Re, L. Cimatti, L. Zecchi, D. Gibellini. HIV-1 and HCV detection in dried blood spots by SYBR Green multiplex real-time RT-PCR. J Virol Methods 165 (2010) 51-56. 17
6. S. Bennet, R.N. Gunson, G.E. McAllister, S.J. Hutchinson, D.J. Goldberg, S.O. Cameron, et al., Detection of hepatitis C virus RNA in dried blood spots. J. Clin. Virol. 54 (2012) 106– 109.
7. C. Santos, A. Reis, C.V. dos Santos, C. Damas, M.H. Silva, M.V. Viana, et al., The use of real-time PCR to detect hepatitis C virus RNA in dried blood spots from Brazilian patients infected chronically. J. Virol. Methods 179 (2012) 17– 20.
8. A. Soulier, L. Poiteau, I. Rosa, C. Hézode, F. Roudot-Thoraval, J.M. Pawlotsky, et al., Dried blood spots: a tool to ensure broad access to hepatitis C screening, diagnosis and treatment monitoring. J. Infect. Dis. 2015 Sep 2. pii: jiv423.
9. E.K. Dokubo, J. Evans, V. Winkelman, S. Cyrus, L.H. Tobler, A. Asher A, et al., Comparison of Hepatitis C Virus RNA and antibody detection in dried blood spots and plasma specimens. J Clin Virol. 59 (2014) 223-7.
10. A. Tejada-Strop, J. Drobeniuc, T. Mixson-Hayden, J.C. Forbi, N.T. Le, L. Li, et al., Disparate detection outcomes for anti-HCV IgG and HCV RNA in dried blood spots. J. Virol. Methods 212 (2015) 66-70.
18
11. J. Sambrook, E.F. Fritsch, T. Maniatis. Molecular Cloning: A Laboratory Manual. 2nd edition. New York: Cold Spring Harbor Laboratory Press; 1989.
12. S. Bereczky, A. Martensson, J.P. Gil, A. Farnert, Short report: Rapid DNA Extraction from archive blood spot on filter paper for genotyping of Plasmodium Falciparum. Am. J. Trop. Med. Hyg. 72 (2005) 249–251.
13. P.P. Martins, E. Lampe, L.L. Lewis-Ximenez, P.S. de Souza, C.A. Fernandes, L.M. Villar. Performance of molecular methods for hepatitis C virus diagnosis: usefulness among chronic cases and during the course of infection. Clin. Lab. 9-10 (2013) 1031-9.
14. J.D. Thompson, T.J. Gibson, F. Plewniak, F. Jeanmougin, D.G. Higgins, et al. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25 (1997) 4876-4882.
15. K. Sandres-Sauné, P. Deny, C. Pasquier, V. Thibaut, G. Duverlie, J. Izopet. Determining hepatitis C genotype by analyzing the sequence of the NS5b region. J. Virol. Methods 109 (2003) 187-93.
19
16. E. Lampe, L. Lewis-Ximenez, M.P. Espírito-Santo, N.M. Delvaux, S.A. Pereira, A. Peres-da-Silva, et al., Genetic diversity of HCV in Brazil. Antivir. Ther. 18 (2013) 435-44.
17. T.D. Otto, E.A. Vasconcellos, L.H. Gomes, A.S. Moreira, W.M. Degrave, L. Mendonça-Lima, et al., ChromaPipe: a pipeline for analysis, quality control and management for a DNA sequencing facility. Genet. Mol. Res. 7 (2008) 861-71.
18. M.A. Larkin, G. Blackshields, N.P. Brown, R. Chenna, P.A. McGettigan, H. McWilliam, et al., Clustal W and Clustal X version 2.0. Bioinformatics. 23 (2007) 2947-2948.
19. K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 30 (2013) 2725-2729.
20. E.Z. Zhang, D.J. Bartels, J.D. Frantz, S. Seepersaud, J.A. Lippke, B. Shames, et al., Development of a sensitive RT-PCR method for amplifying and sequencing near full-length HCV genotype 1 RNA from patient samples. Virol. J. 10 (2013) :53.
20
21. B.S. Brown, P.E. Klapper, M. Guiver. Development of diagnostic serological and molecular screening from dried blood spots for HCV,HIV, HBV and syphilis. J. Clin. Virol. 44 Supplement 1 (2009) S27-S28.
22. O. Ndiaye, J. Gozlan, H. Diop-Ndiaye, A.S. Sall, S. Chapelain, A. Leprêtre, et al., Usefulness of Dried Blood Spots (DBS) to perform hepatitis C virus genotyping in drug users in Senegal. J. Med. Virol. 2015 Dec 24.
23. V.D. Hope, M. Hickman, S.L. Ngui, S. Jones, M. Telfer, M. Bizzarri, et al., Measuring the incidence, prevalence and genetic relatedness of hepatitis C infections among a community recruited sample of injecting drug users, using dried blood spots. J. Viral Hepat. 18 (2011) 262-270.
21
Figure 1. Quantitative comparison of HCV viral load (log10 copies/ml) in serum samples determined by commercial and in house quantitative methods (p = 0.085).
22
Figure 2. Quantitative comparison of HCV viral load (log10 copies/ml) among paired serum and dried blood spot (DBS) samples determined by in house quantitative methods (p = 0.004).
23
Figure 3. Phylogenetic tree of HCV NS5B sequences of 43 serum samples (S) and 11 dried blood spot samples (SPF) of this study and 12 sequences from HCV genotypes 1 and 3 obtained from GeneBank.
24
Table 1. RNA extraction methods evaluated in this study for DBS samples. Number and size of DBS discs used in this study
RNA elution volume determined by manufacturer
RNA elution volume used in this study
3 (3mm)
150L
30L
3 (3mm)
30-50L
30L
SV Total RNA Isolation System (Promega, USA)
1 (6mm)
100L
40L
Nucleospin Blood (Nucleospin, Germany)
1 (6mm)
100L
100L
3 (3mm)
200L
60L
1 (12mm)
25L
25L
1 (3mm)
65L
65L
RNA Extraction
Method
QIAamp DNA Mini Kit (Qiagen, Germany) QIAamp Viral RNA Mini Kit (Qiagen, Germany)
Dried Blood Spot (DBS) Genomic DNA Isolation Kit (Norgen Biotek, Canada)
Silica gel
Resin
Phenol cloroform (Maniatis et al., 1989) Chemical Reaction Methanol (Bereczky et al., 2005)
25
Table 2. Sequences of primers and probes used in this study for in house quantitative PCR Oligonucleotides
Sequence
Position in HCV genome (5’ non coding region)
Primer sense
GCGAAAGGCCTTGTGGTACT
271- 290
Primer anti-sense
ACGGTCTACGAGACCTCCC
318-336
Probe
ACTCGCAAGCACCCTAT
296-312
26