- Email: [email protected]
Evaluation of mRNAs Encoding Muscarinic Receptor Subtypes in Human Detrusor Muscle
OO226347/96/1563-120~03.00/0
Vol. 156,1208-1213, September 1996 Printed in U S A
THEJOURNAL OF UROLOGY copyright 0 1996 by AMERICAN UROLOGlCAL ASSWIATION, INC.
EVALUATION OF mRNAs ENCODING MUSCARINIC RECEPTOR SUBTYPES IN HUMAN DETRUSOR MUSCLE 0. YAMAGUCHI,* K. SHISHIDO, K TAMURA, T. OGAWA, T. FUJIMURA From the Department
of
AND
M. OHTSUKA
Urology, Fukushima Medical College, Fukushima, and Pharmacological Research Laboratories, Fujisawa Pharmaceutical Co. Ltd., Osaka, Japan
ABSTRACT
Purpose: The present study evaluated the muscarinic receptor subtypes corresponding to m l to m5 genes in human detrusor muscle. Materials and Methods: The mRNAs encoding m2 and m3 subtypes were assessed by reverse transcription (RT)-polymerase chain reaction (PCR). The amounts of cDNA synthesized from m2 and m3 mRNAs were measured by using subcloned plasmid DNAs. The distribution of m2 and m3 mRNAs in detrusor was estimated by comparing the amount of m2 cDNA with t h a t of m3 cDNA. Results: The m2 mRNAm3 mRNA ratio was 1.06:l.OO in human detrusor. In the cryostat sections of human detrusor, the presence of both m2 and m3 mRNAs was confirmed by in situ hybridization. However, the RT-PCR products derived from m l , m4 and m5 subtype mRNAs were not detected. Conclusion: These results suggest that human detrusor muscle coexpresses muscarinic m2 and m3 receptors and that the populations of the 2 subtypes are not significantly different. KEY WORDS:receptors, muscarinic; bladder; RNA, messenger MATERIALS AND METHODS In urinary bladder, the detrusor muscle receives excitatory cholinergic innervation, and a voiding bladder contraction is Muscle specimens from the bladder dome (detrusor musmediated primarily by muscarinic receptors when stimulated cle) were obtained from 5 patients undergoing radical cystecby acetylcholine released from cholinergic nerve endings. It is tomy because of malignancy. There were 3 men and 2 women, now evident that muscarinic receptors exist as multiple sub- all urodynamically normal, with a mean age of 61 years. types,l,2 which are pharmacologically designated as M1, M2 Detrusor muscle was immediately frozen in liquid nitrogen and M3 receptors using the putative selective antagonists and used for reverse transcription (RT)-polymerase chain such as pirenzepine, AF-DXll6([11-[[2-(diethylmino) reaction (PCR). methyl]-1-piperidenyl] acetyll-5, ll-dihydr0-6H-pyrido[2,3,- Oligonucleotide synthesis. Oligonucleotide primers for PCR bl[1,4l-benzodiazepine-6-one)and pFHHSiD (p-fluoro- were synthesized by a DNA synthesizer (Model 392, ABI, hexahydrosila-difenidol). These M1, M2, and M3 receptors Foster City, California). The primer sequences for each huwere originally identified from binding studies in rat cerebral man muscarinic receptor subtypeg-12 and p-actinl3 are tissue (Ml), cardiac muscle (M2) and salivary gland (M3).3 shown in figure 1. The upstream and downstream primer set However, recent studies have suggested that, in many of p-actin was selected from different exon sequences so that smooth muscles, muscarinic receptors are not homogeneous the genomic DNA contamination that contains introns would but heterogeneous.4-7 In this regard, bladder smooth muscle be easily detectable. Ribonucleic acid isolation. Total RNA was extracted from is believed to possess several subtypes. When the muscarinic receptor subtypes in smooth muscle are studied, there is a limitation to pharmacological methods or binding assays, since the available antagonists are relaPrimers Upstream Expected tively selective for each subtype.2 However, complementary Downstream LengtWp) DNAs for muscarinic receptors have been cloned,8,9 suggesting a molecular biological classification of muscarinic recepAAATACAGTCAAGAGGCCGACTAAG ml CTTGTCCCAGCGGCAAAGCAGC 349 tors into m l , m2, m3, m4 and m5 subtypes. Thus, instead of using muscarinic receptor antagonists, the subtypes in a CTAAGCAAACATGCATCAGAATTGG given tissue can be discriminated by evaluating the mRNA m2 AAGGTGCACAAAAGGTGTTAATGAG 286 encoding these subtypes. ACCCAGCTCCGAGCAGATGGAC From a clinical point of view, it would be of great value to m3 CGGCTGACTCTAGCTGGATGGG 341 determine the subtypes of muscarinic receptor in human bladder because antimuscarinic agents are commonly used in CAGCCATTGAGA~GTGCCTGCC m4 GGTGGCGTTGCACAGAGCATAG the treatment of urinary frequency and incontinence second314 ary to hyperactivity of pathologic bladder. Thus, the present m5 TCAGAAATGTGTGGCCTATAGTTC study was undertaken to determine the subtypes correspondTGACTGGGACACACTTGTCACAG 304 ing to m l to m5 genes in the human detrusor. In addition, subtype mRNAs were analyzed quantitatively. CTGGCATCGTGATGGACTCCGG
fl -actin
GTGGATGCCACAGGACTCCATG
380
Accepted for publication February 2, 1996. * Re uests for re rints. Department of Urology, Fukushima MedFIG. 1. Polymerase chain reaction primers for each subtype and ical College, Fukustima 960-12, Japan. j3-actin. 1208
MUSCARINIC RECEPTOR SUBTYPE mRNAs IN HUMAN DETRUSOR
1209
detrusor muscle with ISOGEN (Nippon Gene, Japan) accord- A ing to the procedure of Chomczynski and Sacchi.14To remove (bp) contaminating genomic DNA, extracted RNA was treated 1 2 3 4 5 6 7 with RNase-free DNase I (Gen Hunter, Brookline, Massachu553 setts). 500 Reverse transcription (RT). Extracted RNA was reverse transcribed to obtain the corresponding cDNA. Total RNA (1 249 pg.) was mixed with RT reagent mixture (38 pl.), heated at 200 95C for 3 minutes and chilled in ice. The RT reagent mixture consisted of 20 mM. Tris-HC1 (pH 8.3),50 mM. KC1,2.5 mM. MgC1,l mM. dNTP and 100 pmol. random hexamer (GIBCO B BRL, Gaithersburg, Maryland). Then, 2 pl. (400 units) of M-MLV reverse transcriptase (GIBCO BRL) was added, and 1600 RT was carried out at 42C for 1hour. Samples were heated at 95C for 10 minutes to terminate RT. , 1400Polymerase chain reaction (PCR). The reverse-transcribed 5 1200material (10 pl.) was added to the PCR mixture to obtain a final volume of 50 pl. of mineral oil (Sigma Chemical Co., St. loo0i Louis, Missouri). The PCR mixture consisted of l x PCR 2 buffer (20 mM. Tris-HC1 pH 8.3, 50 mM. KC1, 2.5 U of Taq DNA polymerase (Toyobo, Osaka, Japan). Amplification was .$ then carried out in Thermal-Cycler (Perkin Elmer, Branch3$! 6oo burg, New Jersey). Denaturation for 25 cycles at 95C for 1 minute, annealing at 65C for 2 minutes and extension at 75C 400 for 2 minutes were routinely performed after a n initial 2 2-minute denaturation. The last cycle included 10 minutes 5 200 for extension. Finally, the PCR products (5 pl. aliquots) were electrophoresed on 2.3% agarose gels. The gels were stained with 5 pg./ml. of ethidium bromide and photographed with .01 .1 1 10 cDNA (attomol I tube) T-667 black and white film (Polaroid, Cambridge, Massachusetts). FIG.2. Quantitation of subtype cDNA. Measurement procedure Quantitative analysis. The DNA fragments (cDNA) of m2 m2 CDNA iS shown. In electrophoretic bands Of PCR products (A), or m3 subtype, which had been amplified by RT-PCR, were for lane (duplicate) 1 to 6 is 3.0, 1.0,0.33,0.11,0.037and 0.012 attomol. subcloned into the vector pGEM-T (Promega, Madison, Wis- per tube of subcloned plasmid DNA containing the m2 RT-PCR consin). The subcloned plasmids were diluted from 300 to product. Lane 7 (duplicate) shows RT-PCR products from m2 mRNA h m s standard curve. r 1.23 amol./ml. and used as standard DNA. The RT products extracted from human d e t n ~ ~ omuscle. from muscle and the various concentrations of &luted plas- Equation of this standard curve is y/103 = -1.6519L/[l+(X/ 0.183)'.341+1.65,where x is amount of cDNA and y is inte ated mids were simultaneously subjected to PCR for 25 Cycles optical density. Amount of m2 ,-DNA tube is determinerfrom using m2 or m 3 primer. The PCR products were electropho- integrated optical density of lane 7. g c h closed circle represents resed on agarose gels, f i r staining with ethidium bromide, mean value of optical density (duplicated measurements). Similarly, was quantitated. the gels were photographed with T-667 black and white film m3 (Polaroid). The pictures were scanned by an image scanner (GT-6500, EPSON, Suwa, Japan), and the integrated optical density of DNA bands was measured with an image analyzer B-Actin m l m2 m3 m4 m5 (NIH, Bethesda, Maryland). The integrated optical density of M + - + - + - + - + - + subcloned plasmid was plotted out on a semilogarithm scale against the amount of subcloned plasmid. The equation of (bp) standard curve was calculated for each gel by computer. The 553 amount of subtype cDNA was determined with this equation 500\ from the optical density of the subtype cDNA band in the 420same gel (fig. 2). It was assumed that the turnover rates of 311subtype mRNAs are approximately the same and that possi- 2 4 9 7 ble differences in reverse transcriptase efficiency of the dif- 200 ferent mRNAs are minimal. With these aSSUmPtion% the FIG.3. &verse transcriptase-PCR analysis of subtype mRNA in distribution of subtype mRNAs in detrusor was investigated human detrusor muscle. M: size marker, ,$ X174/Hinfl. bp: base pair. by comparing the amounts of subtype cDNAs. +: treated with reverse transcriptase. -: untreated with reverse In situ hybridization. Detrusor muscle from human blad- transcriptase. der was immersed in OCT compound (Miles Laboratories, Elkhart, Indiana) and rapidly frozen in dry ice and acetone. The tissue sections (5 pm. thick) were obtained with a micAmounts of cDNA synthesized from m2 and m3 mRNAs rotome cryostat and kept at -8OC until use. Oligonucleotide Urinary c~~~ (amoljClg.of total RNA) m2 ~ R N A: m3 mRNA probes were synthesized with DNA synthesizer (Model 392, Bladder m2 m3 (m2 cDNA : m3 cDNA) -1) to detect each subtype mRNA in the tissue section. The B-l 0.496 0.520 0.95 : 1.00 B.2 0.740 0.788 0.94 : 1.00 probes were complementary to bases 955-995 (ml), 10681.26 : 1.00 1108 (m2), 38-77 (m3), 4-43 (m4) and 9-48 (m5) of each B-3 0.174 0.138 1.02 : 1.00 B-4 0.224 0.220 human muscarinic receptor. A DIG oligonucleotide tailing kit 1.15 : 1.00 0.246 0.214 (Boehringer Mannheim GmbH, Mannheim, Germany) was 0.376 0.376 1.06 : 1.00 used to label each probe with digoxigenin (DIGbdUTP. Prior *SD 20.213 ?0.244 20.12 to hybridization, frozen tissue Sections were brought to ~~bare obtained fmm 5 different human detmsors. Distribution of& a d temperature, air dried, fixed by immersion for 20 minutes in m3 m R N h in detrusor is represented as ratio m2 mRNA : m3 ~ R N A S. D 4% paraformaldehyde in phosphate-buffered saline (PBS), standard deviation.
&
i:yF /
7
.z -
9
0"
--
1210
MUSCARINIC RECEPTOR
SUBTYPE mRNAs IN HUMAN DETRUSOR
FIG.4. In situ hybridization histochemistry. Notations m l to m5 show synthetic probes used for hybridizationof corresponding subtypes m l to m5. Purple regions indicate localization of subtype mRNAs. In cryostat sections of human detrusor, synthetic probes are hybridized only with m2 and m3 mRNAs. X200.
washed with PBS and incubated in a freshly prepared solution of pronase (Boehringer Mannheim GmbH) a t a final concentration of 250 pg./ml. in 50 mM. Tris-HC1pH 7.5 for 10 minutes a t room temperature. Proteolytic activity was stopped by immersion for 30 seconds in 2 mg./ml. glycine in PBS. Tissues were rinsed in PBS and dehydrated in a graded series of ethanols.
The DIG-labeled probes were diluted to a concentration of 1ng./pl. in the hybridization buffer. Hybridization was then performed for 16 hours in a humid chamber a t 42C. Sections were washed in 650 mM. NaC1, 20 mM. Tris-HC1 pH 7.5, 1 mM. EDTA for 4 hours with 4 changes of buffer at 55C. The localization of each muscarinic receptor mRNA was developed with the alkaline phosphatase conjugated anti-DIG de-
MUSCARINIC RECEPTOR SUBTYPE mRNAs IN HUMAN DETRUSOR
kction kit (Boehringer Mannheim GmbH). Finally, the sections were analyzed microscopically. For the neutralization of m2 or m3 oligonucleotide probe, each antisense probe was synthesized. The antisense probe (100 pg.) was preincubated with each corresponding oligonucleotide probe (200 ng.) in 200 111. of hybridization buffer for 1 hour a t 37C, followed by hybridization as above.
1211
probes were clearly hybridized with mRNAs encoding m2 and m3 subtypes. In contrast, no hybridizable mRNA was found for m l , m4 and m5 receptors. The m2 and m3 receptor mRNAs were located in the muscle (fig. 4). When the antisense probes for m2 and m3 subtypes were used, the oligonucleotide probes were never hybridized with m2 and m3 mRNAs (fig. 5 ) .
RESULTS
DISCUSSION
The electrophoretic bands of RT-PCR products from the subtype ( m l to m5) mRNAs and /3-actin mRNA are shown in fig. 3. It was demonstrated that, in human detrusor muscle, mRNAs encoding m2 and m3 subtypes were strongly detected. However, the RT-PCR products derived from m l , m4 and m5 subtype mRNAs were not detected. In addition, there was no contamination from genomic DNAs, since PCR did not yield any product from total RNA without RT (fig. 3). The subtype cDNA derived from m2 or m3 mRNA was quantitated by using the subcloned plasmid DNA. An example of this quantitation is shown in fig. 2. The amounts of cDNA synthesized from m2 and m3 mRNAs are shown in the table. The distribution of m2 and m3 mRNAs in detrusor was estimated by the ratio m2 cDNA : m3 cDNA (table). Thus, in human detrusor muscle, m2 mRNA and m3 mRNA were present in the ratio of 1.06 to 1.00. The presence of both m2 and m3 mRNAs in detrusor muscle was also confirmed by in situ hybridization (fig. 4). In the cryostat sections of human detrusor, the oligonucleotide
Muscarinic receptor subtypes in animal and human urinary bladder have been investigated largely by radioligand binding and pharmacological contraction studies. These studies consistently demonstrated a low affinity of prienzepine (M1 antagonist) for the muscarinic receptors in detrusor m~scle.l”~7Subsequent studiesls-20 using AF-DX116 (M2 antagonist) and pFHHSiD (M3 antagonist) anticipated that either M2 and M3, or both, would be present in detrusor. In this study, the results of RT-PCR and in situ hybridization clearly show that human detrusor muscle contains both m2 and m3 mRNA. The presence of these mRNAs indicates that human detrusor muscle coexpresses muscarinic m2 and m3 receptors. In agreement with our results, the most recent study using subtype-selective antisera has demonstrated significant immunoprecipitation only for m2 and m3 receptors in human bladder.21 With regard to a pharmacological equivalent of molecular biological subtypes, Doje et al. recently evaluated the antagonist binding properties of 5 cloned human muscarinic receptors ( m l to m5) expressed in Chinese
FIG. 5. Neutralization test for m2 and m3 probes. Left side shows hybridization usiflg m2 and m3 probes. On right, notations m2+anti(m2) and m3+anti(m3) represent neutralization of m2 and m3 probes by m2 and m3 antlsense probes.
1212
MUSCARINIC RECEPTOR SUBTYF'E mRNAs IN HUMAN DETRUSOR
hamster ovary cells.22 They have demonstrated that the mo- muscle tone under conditions of high sympathetic activity. lecularly distinct subtypes ml, m2 and m3 correspond most However, this evidence has not been demonstrated in detruclosely to the pharmacologically defined subtypes MI, M2 sor. Further studies are required to clarify the exact role of and M3. It is therefore suggested that human detrusor pos- the m2 subtype in urinary bladder. sesses pharmacological Mf2 -aswell as M3 receptors. The present study quantitatively analyzed m2 and m3 REFERENCES mRNAs. The amount of subtype mRNAs may not correlate 1. Hulme, E. C., Birdsall, N. J. M. and Buckley, N. J.: Muscarinic directly with the population of corresponding receptors in receptor subtypes. Annu. Rev. Pharmacol. Toxicol., 30: 663, human detrusor because the relationship between the den1990. sity of receptor subtype and the level of the message for each 2. Eglen, R. M., Reddy, H., Watson, N. and Challiss, R. A. J.: receptor remains to be clarified. Wang et al. have investiMuscarinic acetylcholine receptor subtypes in smooth muscle. gated the distribution of muscarinic receptors in urinary Trends Pharmacol. Sci., 15: 114, 1994. bladders from various species by subtype-specific immuno3. Mitchelson, F.: Muscarinic receptor differentiation. Pharmacol. precipitation.21 They showed that the m2 receptor was the Ther., 31: 357, 1988. most abundant in rat among all species studied and that the 4. Giraldo, E., Monferini, E., Ladinsky, H. and Hammer, R.: Musm2 : m3 ratio was 9.8:l in rat bladder. We examined the carinic receptor heterogeneity in guinea pig intestinal smooth musc1e:binding studies with AF-DX116. Eur. J. Pharmacol., distribution of subtype mRNAs in rat bladder, and our re141: 475, 1987. sults showed that the m2 mRNA : m3 mRNA ratio was 11:l 5. Entzeroth, M. and Mayer, N.: The binding of r3HIAF-DX384 to (data not shown). In the human bladder, Wang et al. demonrat ileal smooth muscle muscarinic receptors. J. Recept. Res., strated that the m2:m3 ratio was only 2.4:1, and the present 11: 141, 1991. study indicates that the m2 mRNA : m3 mRNA ratio is 6. Michel, A. D. and Whiting, R. L.: Methoctramine reveals heter1.06:l.Thus, as far as bladder muscarinic receptors are conogeneity of M2 muscarinic receptors in longitudinal ileal cerned, the distribution of m2 and m3 mRNAs seems to smooth muscle membrane. Eur. J. Pharmacol., 145:305, 1988. approximately reflect the distribution of m2 and m3 recep7. Michel, A. D. and Whiting, R. L.: The binding of [3H] tors in the bladder. Eventually, the results from the meas4-dephenylacetoxy-N-methylpiperdine to longitudinal ileal smooth muscle muscarinic receptors. Eur. J. Pharmacol., 176: urement of receptor subtype mRNAs as well as receptor 197, 1990. subtype proteins may suggest that the populations of m2 and 8. Kubo, T., Fukuda, K., Mikami, A., Maeda, A., Takahashi, H., m3 receptors are not significantly different in human detruMishima, M., Haga, T., Haga, K., Ichiyama, A., Kanagawa, K., sor. However, as demonstrated in other pharmacological Kojima, M., Matsuo, H., Hirose, T. and Numa, S.: Cloning, studies,23,24 it is important to note that the amount of a sequencing and expression of complementary DNA encoding receptor subtype does not correlate directly with the functhe muscarinic acetylcholine receptor. Nature, 323: 41 1, 1986. tional response. 9. Bonner, T. I., Buckley, N. J., Young, A. C. and Brann, M. R.: The role of muscarinic M2 and M3 receptors in bladder Identification of a family of muscarinic acetylcholine receptor contractility has been evaluated by Schild analysis using genes. Science, 237: 527, 1987. somewhat selective antagonists.19.21 These data clearly 10. Chapman, C. G. and Browne, M. J.: Isolation of the human m l (Hml) muscarinic acetylcholine receptor gene by PCR amplishowed that M3 receptors mediated contractile responses in fication. Nucleic Acids Res., 18: 2191, 1990. guinea pig, rabbit and rat bladder even though the m2 population predominated over the m3 population. In addition, it 11. Peralta, E. G., Ashkenazi, A,, Winslow, J . W., Smith, D. H., Ramachandran, J. and Capon, D. J.: Distinct primary strucis generally accepted that muscarinic m3 receptors couple to tures, ligand-binding properties and tissue-specific expression a stimulation of phosphoinositide hydrolysis via a pertussis of four human muscarinic acetvlcholine receDtors. E.M.B.O. J.. toxin (P"X)-insensitive G-protein.25-26Consequently, m3 re6 3923, 1987. ceptors initiate the formation of 2 intracellular messengers, 12. Bonner. T. I.. Young, A. C., Brann. M. R. and Bucklev. N. J.: inositol(l,4,5)-triphosphate and diacylglycerol, leading to Cloning and expr&sion of the human and rat m5 m;scarinic Ca2+release from intracellular stores and activation of proacetylcholine receptor genes. Neuron, 1: 403, 1988. tein kinase C, respectively. Both of these events are known to 13. Nakajima-Iijima, S., Hamada, H., Reddy, P. and Kakunaga, T.: Molecular structure of the human cytoplasmic beta-actin gene: be involved in the initiation and maintenance of smooth interspecies homology of sequences in the introns. Proc. Natl. muscle contraction. Recently, muscarinic receptor agonists Acad. Sci. U.S.A., 8 2 6133, 1985. were demonstrated to stimulate phosphoinositide turnover P. and Sacchi, N.: Single-step method of RNA in human bladder.27 Taken together with these results, it is 14. Chomcyznski, isolation by acid guanidinium thiocyanate-phenol-chloroform suggested that m3 receptors also mediate contraction in the extraction. Anal. Biochem., 162: 156, 1987. human bladder. 15. Zappia, L., Cartella, A., Potenzoni, D. and Bertraccini, G.: Action Despite the presence of m2 receptors, their functional role of pirenzepine on the human urinary bladder in vitro. J. Urol., in urinary bladder is unknown. Somogyi and de Groat28 136 739, 1986. showed that muscarinic M1 and M2 receptors in cholinergic 16. Levin, R. M., Ruggieri, M. R. and Wein, A. J.: Identification of receptor subtypes in the rabbit and human urinary bladder by nerve terminals of the rat bladder facilitate and inhibit aceselective radio-ligand binding. J. Urol., 139: 844, 1988. tylcholine release, respectively. If a presynaptic mechanism modulating acetylcholine release exists in human bladder, 17. Poli, E. and Monica, B.: Antimuscarinic activity of telenzepine on isolated human urinary bladder: no role for M1-muscarinic m2 (M2) as opposed to m l (M1) receptors seem to be involved receptors. Gen. Pharmacol., 23: 659, 1992. in this mechanism since we could not detect m l mRNA in 18. Latifpour, J., Gousse, A., Kondo, S., Morita, T. and Weiss, R. M.: human detrusor. Thus, it is likely that m2 receptors are Effects of experimental diabetes on biochemical and functional located on the presynaptic cholinergic terminals and inhibit characteristics of bladder muscarinic receptors. J. Pharmacol. acetylcholine release by negative feedback. This presynaptic Exp. Ther., 248: 81, 1989. inhibition may be important for modulating neural input to 19. Noronha-Blob, L., Prosser, J . C., Sturm, B. L., Lowe, V. C. and Enna, S. J.: ( 2)-Terodiline: an M1-selective muscarinic recepthe bladder during filling. tor antagonist. In vivo effects at muscarinic receptors mediatAnother role for m2 receptors may be to modulate the ing urinary bladder contraction, mydriasis and salivary secrerelaxant response of smooth muscle to P-adrenergic stimulation. Eur. J. Pharmacol., 201: 135, 1991. ti0n,~931since m2 receptors are known to inhibit adenylate S. and Morita. T.: A studv-. of muscarinic cholinerdc cyclase a~tivity.2~331 Thus, stimulation of postjunctional m2 20. Kondo, receptor subtypes in human detrusor muscle using radioligaid receptors is predicted to oppose a P-adrenergic relaxation of binding techniques. Jpn. J. Urol., 84: 1255, 1993. detrusor. As Eglen et al. proposed,2 m2 receptors may medi- 21. Wang, P., Luthin, G. R. and Ruggieri, M. R.: Muscarinic acetylate the dominant parasympathetic control over detrusor choline receptor subtypes mediating urinary bladder contrac-' - ~~~
~
MUSCARINIC RECEPTOR SUBTYPE mRNAs IN HUMAN DETRUSOR tility and coupling to GTP binding proteins. J. Pharmacol. Exp. Ther., 273: 959, 1995. 22. Dorje, F., Wess, J., Lambrecht, G., Tacke, R., Mutschler, E. and Brann, M. R.: Antagonists binding profiles of five cloned human muscarinic receptor subtypes. J. Pharmacol. Exp. Ther., 256 727, 1991. 23. Monferini, E., Giraldo, E. and Ladinsky, H.: Characterization of the muscarinic receptor subtypes in the rat urinary bladder. Eur. J. Pharmacol., 147: 453, 1988. 24. Eglen, R. M. and Harris, G. C.: Selective inactivation of muscarinic M2 and M3 receptors in guinea-pig ileum and atria in vitro. Br. J. Pharmacol., 109: 946, 1993. 25. Peralta, E. G., Ashkenazi, A., Winslow, J. W., Ramachandran, J. and Capon, D. J.: Differential regulation of PI hydrolysis and adenylyl cyclase by muscarinic receptor subtypes. Nature, 334 434, 1988. 26. Pinkas-Kramarski, R., Stein, R., Zimmer, Y. and Sokolovsky, M.: Cloned rat M3 muscarinic receptors mediate phosphoinositide hydrolysis but not adenylate cyclase inhibition. F.E.B.S. Lett., 239: 174, 1988.
1213
27. Andersson, K-E., Holmquist, F., Fovaeus, M., Hedlund, H. and Sundler, R.: Muscarinic receptor stimulation of phosphoinositide hydrolysis in the human isolated urinary bladder. J. Urol., 146: 1156, 1991. 28. Somogyi, G. T. and de Groat, W. C.: Evidence for inhibitory nicotinic and facilitatory muscarinic receptors in cholinergic nerve terminals of the rat urinary bladder. J. Auton. Nerv. Syst., 37:89, 1992. 29. Griffin, M. T. and Ehlert, F. J.: Specific inhibition of isoproterenol-stimulated cyclic AMP accumulation by M2 muscarinic receptors in rat intestinal smooth muscle. J. Pharmacol. Exp. Ther., 263 221, 1992. 30. Fernandes, L. B., Fryer, A. D. and Hirshman, C. A: M2 muscarinic receptors inhibit isoproterenol-induced relaxation of canine airway smooth muscle. J. Pharmacol. Exp. Ther., 262 119, 1992. 31. Thomas, E. A,, Baker, S. A. and Ehlert, F. J.: Functional role for the M2 muscarinic receptor in smooth muscle of guinea pig ileum. Mol. Pharmacol., 44:102, 1993.
Vol. 156,1208-1213, September 1996 Printed in U S A
THEJOURNAL OF UROLOGY copyright 0 1996 by AMERICAN UROLOGlCAL ASSWIATION, INC.
EVALUATION OF mRNAs ENCODING MUSCARINIC RECEPTOR SUBTYPES IN HUMAN DETRUSOR MUSCLE 0. YAMAGUCHI,* K. SHISHIDO, K TAMURA, T. OGAWA, T. FUJIMURA From the Department
of
AND
M. OHTSUKA
Urology, Fukushima Medical College, Fukushima, and Pharmacological Research Laboratories, Fujisawa Pharmaceutical Co. Ltd., Osaka, Japan
ABSTRACT
Purpose: The present study evaluated the muscarinic receptor subtypes corresponding to m l to m5 genes in human detrusor muscle. Materials and Methods: The mRNAs encoding m2 and m3 subtypes were assessed by reverse transcription (RT)-polymerase chain reaction (PCR). The amounts of cDNA synthesized from m2 and m3 mRNAs were measured by using subcloned plasmid DNAs. The distribution of m2 and m3 mRNAs in detrusor was estimated by comparing the amount of m2 cDNA with t h a t of m3 cDNA. Results: The m2 mRNAm3 mRNA ratio was 1.06:l.OO in human detrusor. In the cryostat sections of human detrusor, the presence of both m2 and m3 mRNAs was confirmed by in situ hybridization. However, the RT-PCR products derived from m l , m4 and m5 subtype mRNAs were not detected. Conclusion: These results suggest that human detrusor muscle coexpresses muscarinic m2 and m3 receptors and that the populations of the 2 subtypes are not significantly different. KEY WORDS:receptors, muscarinic; bladder; RNA, messenger MATERIALS AND METHODS In urinary bladder, the detrusor muscle receives excitatory cholinergic innervation, and a voiding bladder contraction is Muscle specimens from the bladder dome (detrusor musmediated primarily by muscarinic receptors when stimulated cle) were obtained from 5 patients undergoing radical cystecby acetylcholine released from cholinergic nerve endings. It is tomy because of malignancy. There were 3 men and 2 women, now evident that muscarinic receptors exist as multiple sub- all urodynamically normal, with a mean age of 61 years. types,l,2 which are pharmacologically designated as M1, M2 Detrusor muscle was immediately frozen in liquid nitrogen and M3 receptors using the putative selective antagonists and used for reverse transcription (RT)-polymerase chain such as pirenzepine, AF-DXll6([11-[[2-(diethylmino) reaction (PCR). methyl]-1-piperidenyl] acetyll-5, ll-dihydr0-6H-pyrido[2,3,- Oligonucleotide synthesis. Oligonucleotide primers for PCR bl[1,4l-benzodiazepine-6-one)and pFHHSiD (p-fluoro- were synthesized by a DNA synthesizer (Model 392, ABI, hexahydrosila-difenidol). These M1, M2, and M3 receptors Foster City, California). The primer sequences for each huwere originally identified from binding studies in rat cerebral man muscarinic receptor subtypeg-12 and p-actinl3 are tissue (Ml), cardiac muscle (M2) and salivary gland (M3).3 shown in figure 1. The upstream and downstream primer set However, recent studies have suggested that, in many of p-actin was selected from different exon sequences so that smooth muscles, muscarinic receptors are not homogeneous the genomic DNA contamination that contains introns would but heterogeneous.4-7 In this regard, bladder smooth muscle be easily detectable. Ribonucleic acid isolation. Total RNA was extracted from is believed to possess several subtypes. When the muscarinic receptor subtypes in smooth muscle are studied, there is a limitation to pharmacological methods or binding assays, since the available antagonists are relaPrimers Upstream Expected tively selective for each subtype.2 However, complementary Downstream LengtWp) DNAs for muscarinic receptors have been cloned,8,9 suggesting a molecular biological classification of muscarinic recepAAATACAGTCAAGAGGCCGACTAAG ml CTTGTCCCAGCGGCAAAGCAGC 349 tors into m l , m2, m3, m4 and m5 subtypes. Thus, instead of using muscarinic receptor antagonists, the subtypes in a CTAAGCAAACATGCATCAGAATTGG given tissue can be discriminated by evaluating the mRNA m2 AAGGTGCACAAAAGGTGTTAATGAG 286 encoding these subtypes. ACCCAGCTCCGAGCAGATGGAC From a clinical point of view, it would be of great value to m3 CGGCTGACTCTAGCTGGATGGG 341 determine the subtypes of muscarinic receptor in human bladder because antimuscarinic agents are commonly used in CAGCCATTGAGA~GTGCCTGCC m4 GGTGGCGTTGCACAGAGCATAG the treatment of urinary frequency and incontinence second314 ary to hyperactivity of pathologic bladder. Thus, the present m5 TCAGAAATGTGTGGCCTATAGTTC study was undertaken to determine the subtypes correspondTGACTGGGACACACTTGTCACAG 304 ing to m l to m5 genes in the human detrusor. In addition, subtype mRNAs were analyzed quantitatively. CTGGCATCGTGATGGACTCCGG
fl -actin
GTGGATGCCACAGGACTCCATG
380
Accepted for publication February 2, 1996. * Re uests for re rints. Department of Urology, Fukushima MedFIG. 1. Polymerase chain reaction primers for each subtype and ical College, Fukustima 960-12, Japan. j3-actin. 1208
MUSCARINIC RECEPTOR SUBTYPE mRNAs IN HUMAN DETRUSOR
1209
detrusor muscle with ISOGEN (Nippon Gene, Japan) accord- A ing to the procedure of Chomczynski and Sacchi.14To remove (bp) contaminating genomic DNA, extracted RNA was treated 1 2 3 4 5 6 7 with RNase-free DNase I (Gen Hunter, Brookline, Massachu553 setts). 500 Reverse transcription (RT). Extracted RNA was reverse transcribed to obtain the corresponding cDNA. Total RNA (1 249 pg.) was mixed with RT reagent mixture (38 pl.), heated at 200 95C for 3 minutes and chilled in ice. The RT reagent mixture consisted of 20 mM. Tris-HC1 (pH 8.3),50 mM. KC1,2.5 mM. MgC1,l mM. dNTP and 100 pmol. random hexamer (GIBCO B BRL, Gaithersburg, Maryland). Then, 2 pl. (400 units) of M-MLV reverse transcriptase (GIBCO BRL) was added, and 1600 RT was carried out at 42C for 1hour. Samples were heated at 95C for 10 minutes to terminate RT. , 1400Polymerase chain reaction (PCR). The reverse-transcribed 5 1200material (10 pl.) was added to the PCR mixture to obtain a final volume of 50 pl. of mineral oil (Sigma Chemical Co., St. loo0i Louis, Missouri). The PCR mixture consisted of l x PCR 2 buffer (20 mM. Tris-HC1 pH 8.3, 50 mM. KC1, 2.5 U of Taq DNA polymerase (Toyobo, Osaka, Japan). Amplification was .$ then carried out in Thermal-Cycler (Perkin Elmer, Branch3$! 6oo burg, New Jersey). Denaturation for 25 cycles at 95C for 1 minute, annealing at 65C for 2 minutes and extension at 75C 400 for 2 minutes were routinely performed after a n initial 2 2-minute denaturation. The last cycle included 10 minutes 5 200 for extension. Finally, the PCR products (5 pl. aliquots) were electrophoresed on 2.3% agarose gels. The gels were stained with 5 pg./ml. of ethidium bromide and photographed with .01 .1 1 10 cDNA (attomol I tube) T-667 black and white film (Polaroid, Cambridge, Massachusetts). FIG.2. Quantitation of subtype cDNA. Measurement procedure Quantitative analysis. The DNA fragments (cDNA) of m2 m2 CDNA iS shown. In electrophoretic bands Of PCR products (A), or m3 subtype, which had been amplified by RT-PCR, were for lane (duplicate) 1 to 6 is 3.0, 1.0,0.33,0.11,0.037and 0.012 attomol. subcloned into the vector pGEM-T (Promega, Madison, Wis- per tube of subcloned plasmid DNA containing the m2 RT-PCR consin). The subcloned plasmids were diluted from 300 to product. Lane 7 (duplicate) shows RT-PCR products from m2 mRNA h m s standard curve. r 1.23 amol./ml. and used as standard DNA. The RT products extracted from human d e t n ~ ~ omuscle. from muscle and the various concentrations of &luted plas- Equation of this standard curve is y/103 = -1.6519L/[l+(X/ 0.183)'.341+1.65,where x is amount of cDNA and y is inte ated mids were simultaneously subjected to PCR for 25 Cycles optical density. Amount of m2 ,-DNA tube is determinerfrom using m2 or m 3 primer. The PCR products were electropho- integrated optical density of lane 7. g c h closed circle represents resed on agarose gels, f i r staining with ethidium bromide, mean value of optical density (duplicated measurements). Similarly, was quantitated. the gels were photographed with T-667 black and white film m3 (Polaroid). The pictures were scanned by an image scanner (GT-6500, EPSON, Suwa, Japan), and the integrated optical density of DNA bands was measured with an image analyzer B-Actin m l m2 m3 m4 m5 (NIH, Bethesda, Maryland). The integrated optical density of M + - + - + - + - + - + subcloned plasmid was plotted out on a semilogarithm scale against the amount of subcloned plasmid. The equation of (bp) standard curve was calculated for each gel by computer. The 553 amount of subtype cDNA was determined with this equation 500\ from the optical density of the subtype cDNA band in the 420same gel (fig. 2). It was assumed that the turnover rates of 311subtype mRNAs are approximately the same and that possi- 2 4 9 7 ble differences in reverse transcriptase efficiency of the dif- 200 ferent mRNAs are minimal. With these aSSUmPtion% the FIG.3. &verse transcriptase-PCR analysis of subtype mRNA in distribution of subtype mRNAs in detrusor was investigated human detrusor muscle. M: size marker, ,$ X174/Hinfl. bp: base pair. by comparing the amounts of subtype cDNAs. +: treated with reverse transcriptase. -: untreated with reverse In situ hybridization. Detrusor muscle from human blad- transcriptase. der was immersed in OCT compound (Miles Laboratories, Elkhart, Indiana) and rapidly frozen in dry ice and acetone. The tissue sections (5 pm. thick) were obtained with a micAmounts of cDNA synthesized from m2 and m3 mRNAs rotome cryostat and kept at -8OC until use. Oligonucleotide Urinary c~~~ (amoljClg.of total RNA) m2 ~ R N A: m3 mRNA probes were synthesized with DNA synthesizer (Model 392, Bladder m2 m3 (m2 cDNA : m3 cDNA) -1) to detect each subtype mRNA in the tissue section. The B-l 0.496 0.520 0.95 : 1.00 B.2 0.740 0.788 0.94 : 1.00 probes were complementary to bases 955-995 (ml), 10681.26 : 1.00 1108 (m2), 38-77 (m3), 4-43 (m4) and 9-48 (m5) of each B-3 0.174 0.138 1.02 : 1.00 B-4 0.224 0.220 human muscarinic receptor. A DIG oligonucleotide tailing kit 1.15 : 1.00 0.246 0.214 (Boehringer Mannheim GmbH, Mannheim, Germany) was 0.376 0.376 1.06 : 1.00 used to label each probe with digoxigenin (DIGbdUTP. Prior *SD 20.213 ?0.244 20.12 to hybridization, frozen tissue Sections were brought to ~~bare obtained fmm 5 different human detmsors. Distribution of& a d temperature, air dried, fixed by immersion for 20 minutes in m3 m R N h in detrusor is represented as ratio m2 mRNA : m3 ~ R N A S. D 4% paraformaldehyde in phosphate-buffered saline (PBS), standard deviation.
&
i:yF /
7
.z -
9
0"
--
1210
MUSCARINIC RECEPTOR
SUBTYPE mRNAs IN HUMAN DETRUSOR
FIG.4. In situ hybridization histochemistry. Notations m l to m5 show synthetic probes used for hybridizationof corresponding subtypes m l to m5. Purple regions indicate localization of subtype mRNAs. In cryostat sections of human detrusor, synthetic probes are hybridized only with m2 and m3 mRNAs. X200.
washed with PBS and incubated in a freshly prepared solution of pronase (Boehringer Mannheim GmbH) a t a final concentration of 250 pg./ml. in 50 mM. Tris-HC1pH 7.5 for 10 minutes a t room temperature. Proteolytic activity was stopped by immersion for 30 seconds in 2 mg./ml. glycine in PBS. Tissues were rinsed in PBS and dehydrated in a graded series of ethanols.
The DIG-labeled probes were diluted to a concentration of 1ng./pl. in the hybridization buffer. Hybridization was then performed for 16 hours in a humid chamber a t 42C. Sections were washed in 650 mM. NaC1, 20 mM. Tris-HC1 pH 7.5, 1 mM. EDTA for 4 hours with 4 changes of buffer at 55C. The localization of each muscarinic receptor mRNA was developed with the alkaline phosphatase conjugated anti-DIG de-
MUSCARINIC RECEPTOR SUBTYPE mRNAs IN HUMAN DETRUSOR
kction kit (Boehringer Mannheim GmbH). Finally, the sections were analyzed microscopically. For the neutralization of m2 or m3 oligonucleotide probe, each antisense probe was synthesized. The antisense probe (100 pg.) was preincubated with each corresponding oligonucleotide probe (200 ng.) in 200 111. of hybridization buffer for 1 hour a t 37C, followed by hybridization as above.
1211
probes were clearly hybridized with mRNAs encoding m2 and m3 subtypes. In contrast, no hybridizable mRNA was found for m l , m4 and m5 receptors. The m2 and m3 receptor mRNAs were located in the muscle (fig. 4). When the antisense probes for m2 and m3 subtypes were used, the oligonucleotide probes were never hybridized with m2 and m3 mRNAs (fig. 5 ) .
RESULTS
DISCUSSION
The electrophoretic bands of RT-PCR products from the subtype ( m l to m5) mRNAs and /3-actin mRNA are shown in fig. 3. It was demonstrated that, in human detrusor muscle, mRNAs encoding m2 and m3 subtypes were strongly detected. However, the RT-PCR products derived from m l , m4 and m5 subtype mRNAs were not detected. In addition, there was no contamination from genomic DNAs, since PCR did not yield any product from total RNA without RT (fig. 3). The subtype cDNA derived from m2 or m3 mRNA was quantitated by using the subcloned plasmid DNA. An example of this quantitation is shown in fig. 2. The amounts of cDNA synthesized from m2 and m3 mRNAs are shown in the table. The distribution of m2 and m3 mRNAs in detrusor was estimated by the ratio m2 cDNA : m3 cDNA (table). Thus, in human detrusor muscle, m2 mRNA and m3 mRNA were present in the ratio of 1.06 to 1.00. The presence of both m2 and m3 mRNAs in detrusor muscle was also confirmed by in situ hybridization (fig. 4). In the cryostat sections of human detrusor, the oligonucleotide
Muscarinic receptor subtypes in animal and human urinary bladder have been investigated largely by radioligand binding and pharmacological contraction studies. These studies consistently demonstrated a low affinity of prienzepine (M1 antagonist) for the muscarinic receptors in detrusor m~scle.l”~7Subsequent studiesls-20 using AF-DX116 (M2 antagonist) and pFHHSiD (M3 antagonist) anticipated that either M2 and M3, or both, would be present in detrusor. In this study, the results of RT-PCR and in situ hybridization clearly show that human detrusor muscle contains both m2 and m3 mRNA. The presence of these mRNAs indicates that human detrusor muscle coexpresses muscarinic m2 and m3 receptors. In agreement with our results, the most recent study using subtype-selective antisera has demonstrated significant immunoprecipitation only for m2 and m3 receptors in human bladder.21 With regard to a pharmacological equivalent of molecular biological subtypes, Doje et al. recently evaluated the antagonist binding properties of 5 cloned human muscarinic receptors ( m l to m5) expressed in Chinese
FIG. 5. Neutralization test for m2 and m3 probes. Left side shows hybridization usiflg m2 and m3 probes. On right, notations m2+anti(m2) and m3+anti(m3) represent neutralization of m2 and m3 probes by m2 and m3 antlsense probes.
1212
MUSCARINIC RECEPTOR SUBTYF'E mRNAs IN HUMAN DETRUSOR
hamster ovary cells.22 They have demonstrated that the mo- muscle tone under conditions of high sympathetic activity. lecularly distinct subtypes ml, m2 and m3 correspond most However, this evidence has not been demonstrated in detruclosely to the pharmacologically defined subtypes MI, M2 sor. Further studies are required to clarify the exact role of and M3. It is therefore suggested that human detrusor pos- the m2 subtype in urinary bladder. sesses pharmacological Mf2 -aswell as M3 receptors. The present study quantitatively analyzed m2 and m3 REFERENCES mRNAs. The amount of subtype mRNAs may not correlate 1. Hulme, E. C., Birdsall, N. J. M. and Buckley, N. J.: Muscarinic directly with the population of corresponding receptors in receptor subtypes. Annu. Rev. Pharmacol. Toxicol., 30: 663, human detrusor because the relationship between the den1990. sity of receptor subtype and the level of the message for each 2. Eglen, R. M., Reddy, H., Watson, N. and Challiss, R. A. J.: receptor remains to be clarified. Wang et al. have investiMuscarinic acetylcholine receptor subtypes in smooth muscle. gated the distribution of muscarinic receptors in urinary Trends Pharmacol. Sci., 15: 114, 1994. bladders from various species by subtype-specific immuno3. Mitchelson, F.: Muscarinic receptor differentiation. Pharmacol. precipitation.21 They showed that the m2 receptor was the Ther., 31: 357, 1988. most abundant in rat among all species studied and that the 4. Giraldo, E., Monferini, E., Ladinsky, H. and Hammer, R.: Musm2 : m3 ratio was 9.8:l in rat bladder. We examined the carinic receptor heterogeneity in guinea pig intestinal smooth musc1e:binding studies with AF-DX116. Eur. J. Pharmacol., distribution of subtype mRNAs in rat bladder, and our re141: 475, 1987. sults showed that the m2 mRNA : m3 mRNA ratio was 11:l 5. Entzeroth, M. and Mayer, N.: The binding of r3HIAF-DX384 to (data not shown). In the human bladder, Wang et al. demonrat ileal smooth muscle muscarinic receptors. J. Recept. Res., strated that the m2:m3 ratio was only 2.4:1, and the present 11: 141, 1991. study indicates that the m2 mRNA : m3 mRNA ratio is 6. Michel, A. D. and Whiting, R. L.: Methoctramine reveals heter1.06:l.Thus, as far as bladder muscarinic receptors are conogeneity of M2 muscarinic receptors in longitudinal ileal cerned, the distribution of m2 and m3 mRNAs seems to smooth muscle membrane. Eur. J. Pharmacol., 145:305, 1988. approximately reflect the distribution of m2 and m3 recep7. Michel, A. D. and Whiting, R. L.: The binding of [3H] tors in the bladder. Eventually, the results from the meas4-dephenylacetoxy-N-methylpiperdine to longitudinal ileal smooth muscle muscarinic receptors. Eur. J. Pharmacol., 176: urement of receptor subtype mRNAs as well as receptor 197, 1990. subtype proteins may suggest that the populations of m2 and 8. Kubo, T., Fukuda, K., Mikami, A., Maeda, A., Takahashi, H., m3 receptors are not significantly different in human detruMishima, M., Haga, T., Haga, K., Ichiyama, A., Kanagawa, K., sor. However, as demonstrated in other pharmacological Kojima, M., Matsuo, H., Hirose, T. and Numa, S.: Cloning, studies,23,24 it is important to note that the amount of a sequencing and expression of complementary DNA encoding receptor subtype does not correlate directly with the functhe muscarinic acetylcholine receptor. Nature, 323: 41 1, 1986. tional response. 9. Bonner, T. I., Buckley, N. J., Young, A. C. and Brann, M. R.: The role of muscarinic M2 and M3 receptors in bladder Identification of a family of muscarinic acetylcholine receptor contractility has been evaluated by Schild analysis using genes. Science, 237: 527, 1987. somewhat selective antagonists.19.21 These data clearly 10. Chapman, C. G. and Browne, M. J.: Isolation of the human m l (Hml) muscarinic acetylcholine receptor gene by PCR amplishowed that M3 receptors mediated contractile responses in fication. Nucleic Acids Res., 18: 2191, 1990. guinea pig, rabbit and rat bladder even though the m2 population predominated over the m3 population. In addition, it 11. Peralta, E. G., Ashkenazi, A,, Winslow, J . W., Smith, D. H., Ramachandran, J. and Capon, D. J.: Distinct primary strucis generally accepted that muscarinic m3 receptors couple to tures, ligand-binding properties and tissue-specific expression a stimulation of phosphoinositide hydrolysis via a pertussis of four human muscarinic acetvlcholine receDtors. E.M.B.O. J.. toxin (P"X)-insensitive G-protein.25-26Consequently, m3 re6 3923, 1987. ceptors initiate the formation of 2 intracellular messengers, 12. Bonner. T. I.. Young, A. C., Brann. M. R. and Bucklev. N. J.: inositol(l,4,5)-triphosphate and diacylglycerol, leading to Cloning and expr&sion of the human and rat m5 m;scarinic Ca2+release from intracellular stores and activation of proacetylcholine receptor genes. Neuron, 1: 403, 1988. tein kinase C, respectively. Both of these events are known to 13. Nakajima-Iijima, S., Hamada, H., Reddy, P. and Kakunaga, T.: Molecular structure of the human cytoplasmic beta-actin gene: be involved in the initiation and maintenance of smooth interspecies homology of sequences in the introns. Proc. Natl. muscle contraction. Recently, muscarinic receptor agonists Acad. Sci. U.S.A., 8 2 6133, 1985. were demonstrated to stimulate phosphoinositide turnover P. and Sacchi, N.: Single-step method of RNA in human bladder.27 Taken together with these results, it is 14. Chomcyznski, isolation by acid guanidinium thiocyanate-phenol-chloroform suggested that m3 receptors also mediate contraction in the extraction. Anal. Biochem., 162: 156, 1987. human bladder. 15. Zappia, L., Cartella, A., Potenzoni, D. and Bertraccini, G.: Action Despite the presence of m2 receptors, their functional role of pirenzepine on the human urinary bladder in vitro. J. Urol., in urinary bladder is unknown. Somogyi and de Groat28 136 739, 1986. showed that muscarinic M1 and M2 receptors in cholinergic 16. Levin, R. M., Ruggieri, M. R. and Wein, A. J.: Identification of receptor subtypes in the rabbit and human urinary bladder by nerve terminals of the rat bladder facilitate and inhibit aceselective radio-ligand binding. J. Urol., 139: 844, 1988. tylcholine release, respectively. If a presynaptic mechanism modulating acetylcholine release exists in human bladder, 17. Poli, E. and Monica, B.: Antimuscarinic activity of telenzepine on isolated human urinary bladder: no role for M1-muscarinic m2 (M2) as opposed to m l (M1) receptors seem to be involved receptors. Gen. Pharmacol., 23: 659, 1992. in this mechanism since we could not detect m l mRNA in 18. Latifpour, J., Gousse, A., Kondo, S., Morita, T. and Weiss, R. M.: human detrusor. Thus, it is likely that m2 receptors are Effects of experimental diabetes on biochemical and functional located on the presynaptic cholinergic terminals and inhibit characteristics of bladder muscarinic receptors. J. Pharmacol. acetylcholine release by negative feedback. This presynaptic Exp. Ther., 248: 81, 1989. inhibition may be important for modulating neural input to 19. Noronha-Blob, L., Prosser, J . C., Sturm, B. L., Lowe, V. C. and Enna, S. J.: ( 2)-Terodiline: an M1-selective muscarinic recepthe bladder during filling. tor antagonist. In vivo effects at muscarinic receptors mediatAnother role for m2 receptors may be to modulate the ing urinary bladder contraction, mydriasis and salivary secrerelaxant response of smooth muscle to P-adrenergic stimulation. Eur. J. Pharmacol., 201: 135, 1991. ti0n,~931since m2 receptors are known to inhibit adenylate S. and Morita. T.: A studv-. of muscarinic cholinerdc cyclase a~tivity.2~331 Thus, stimulation of postjunctional m2 20. Kondo, receptor subtypes in human detrusor muscle using radioligaid receptors is predicted to oppose a P-adrenergic relaxation of binding techniques. Jpn. J. Urol., 84: 1255, 1993. detrusor. As Eglen et al. proposed,2 m2 receptors may medi- 21. Wang, P., Luthin, G. R. and Ruggieri, M. R.: Muscarinic acetylate the dominant parasympathetic control over detrusor choline receptor subtypes mediating urinary bladder contrac-' - ~~~
~
MUSCARINIC RECEPTOR SUBTYPE mRNAs IN HUMAN DETRUSOR tility and coupling to GTP binding proteins. J. Pharmacol. Exp. Ther., 273: 959, 1995. 22. Dorje, F., Wess, J., Lambrecht, G., Tacke, R., Mutschler, E. and Brann, M. R.: Antagonists binding profiles of five cloned human muscarinic receptor subtypes. J. Pharmacol. Exp. Ther., 256 727, 1991. 23. Monferini, E., Giraldo, E. and Ladinsky, H.: Characterization of the muscarinic receptor subtypes in the rat urinary bladder. Eur. J. Pharmacol., 147: 453, 1988. 24. Eglen, R. M. and Harris, G. C.: Selective inactivation of muscarinic M2 and M3 receptors in guinea-pig ileum and atria in vitro. Br. J. Pharmacol., 109: 946, 1993. 25. Peralta, E. G., Ashkenazi, A., Winslow, J. W., Ramachandran, J. and Capon, D. J.: Differential regulation of PI hydrolysis and adenylyl cyclase by muscarinic receptor subtypes. Nature, 334 434, 1988. 26. Pinkas-Kramarski, R., Stein, R., Zimmer, Y. and Sokolovsky, M.: Cloned rat M3 muscarinic receptors mediate phosphoinositide hydrolysis but not adenylate cyclase inhibition. F.E.B.S. Lett., 239: 174, 1988.
1213
27. Andersson, K-E., Holmquist, F., Fovaeus, M., Hedlund, H. and Sundler, R.: Muscarinic receptor stimulation of phosphoinositide hydrolysis in the human isolated urinary bladder. J. Urol., 146: 1156, 1991. 28. Somogyi, G. T. and de Groat, W. C.: Evidence for inhibitory nicotinic and facilitatory muscarinic receptors in cholinergic nerve terminals of the rat urinary bladder. J. Auton. Nerv. Syst., 37:89, 1992. 29. Griffin, M. T. and Ehlert, F. J.: Specific inhibition of isoproterenol-stimulated cyclic AMP accumulation by M2 muscarinic receptors in rat intestinal smooth muscle. J. Pharmacol. Exp. Ther., 263 221, 1992. 30. Fernandes, L. B., Fryer, A. D. and Hirshman, C. A: M2 muscarinic receptors inhibit isoproterenol-induced relaxation of canine airway smooth muscle. J. Pharmacol. Exp. Ther., 262 119, 1992. 31. Thomas, E. A,, Baker, S. A. and Ehlert, F. J.: Functional role for the M2 muscarinic receptor in smooth muscle of guinea pig ileum. Mol. Pharmacol., 44:102, 1993.