Evaluation of sodium arsenite exposure on reproductive competence in pregnant and postlactational dams and their offspring

Evaluation of sodium arsenite exposure on reproductive competence in pregnant and postlactational dams and their offspring

Accepted Manuscript Title: Evaluation of sodium arsenite exposure on reproductive competence in pregnant and postlactational dams and their offspring ...
Download PDF
865KB Sizes 0 Downloads 81 Views
Report

Accepted Manuscript Title: Evaluation of sodium arsenite exposure on reproductive competence in pregnant and postlactational dams and their offspring Author: Nadia Soledad Bourguignon Mar´ıa Marta Bonaventura Diego Rodr´ıguez Marianne Bizzozzero Clara Ventura Mariel Nu˜nez Victoria Adela Lux-Lantos Carlos Libertun PII: DOI: Reference:

S0890-6238(17)30007-2 http://dx.doi.org/doi:10.1016/j.reprotox.2017.01.002 RTX 7439

To appear in:

Reproductive Toxicology

Received date: Revised date: Accepted date:

30-3-2016 7-12-2016 4-1-2017

Please cite this article as: Bourguignon Nadia Soledad, Bonaventura Mar´ıa Marta, Rodr´ıguez Diego, Bizzozzero Marianne, Ventura Clara, Nu˜nez Mariel, Lux-Lantos Victoria Adela, Libertun Carlos.Evaluation of sodium arsenite exposure on reproductive competence in pregnant and postlactational dams and their offspring.Reproductive Toxicology http://dx.doi.org/10.1016/j.reprotox.2017.01.002 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Evaluation of sodium arsenite exposure on reproductive competence in pregnant and postlactational dams and their offspring

Nadia Soledad Bourguignona, María Marta Bonaventuraa, Diego Rodrígueza, Marianne Bizzozzeroa, Clara Venturab, Mariel Nuñezb, Victoria Adela Lux-Lantosa, Carlos Libertuna,c.

a

Laboratorio de Neuroendocrinología, Instituto de Biología y Medicina Experimental

(IBYME-CONICET), Buenos Aires, Argentina. b

Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos

Aires, Argentina. c

Departamento de Fisiología, Facultad de Medicina, Universidad de Buenos Aires (UBA),

Argentina.

Address correspondence to: Dr. Victoria Lux-Lantos IBYME-CONICET Vuelta de Obligado 2490, (C1428ADN) Buenos Aires, Argentina. Phone: 54 11 4783 2869 Fax: 54 11 4786-2564 e-mail : [email protected]

Highlights  Arsenic reduced BW and increased T and E2 in pregnancy without hindering gestation.  Arsenic compromises postlactational estrous cycle resumption.  Arsenite decreases preovulatory follicles and serum E2 and increases cysts and FSH levels.  Young arsenic-exposed litters show altered GnRH and FSH expression.

Abstract We investigated arsenite exposure on the reproductive axis of dams (during pregnancy and at cyclicity resumption) and their offspring. Pregnant rats were exposed to 5 (A5) or 50 ppm (A50) of sodium arsenite in drinking water from gestational day 1 (GD1) until sacrifice at GD18 or two months postpartum. Offspring were exposed to the same treatment as their mothers from weaning to adulthood. A50-pregnant rats gained less weight, showed increased testosterone and estradiol but pregnancy was unaffected. After lactation, arsenic-exposed dams presented compromised cyclicity,

decreased estradiol,

increased

follicle-stimulating

hormone

(FSH),

less

preovulatory follicles and presence of ovarian cysts, suggesting impaired reproduction. A50offspring presented lower body weight; A50-female-offspring showed elevated gonadotropin releasing hormone (GnRH), FSH and testosterone, while A50-males showed diminished GnRH/FSH, but normal testosterone. We conclude that arsenite at the present exposure levels did not compromise pregnancy outcome while it negatively affected reproductive physiology in postpartum dams and their offspring.

Keywords: Sodium arsenite; pregnancy; postlactational estrous cycles; offspring; hormones; oxidative stress. Abbreviations: GD: gestational day; MPP: months postpartum; PND: postnatal day; BW: body weight; PF: primary follicles; PAF: preantral follicles; AF: antral follicles; POF: preovulary follicles; AtF: atretic follicles; CL: corpora lutea; CAT: catalase; TBARS: 2thiobarbituric acid reactant substances; LH: luteinizing hormone, FSH: follicle stimulating hormone, GnRH: gonadotropin releasing hormone.

1. Introduction. In recent years, environmental toxicants have become a serious health concern, and studies on environmental endocrine disruptors are becoming more prevalent. Arsenic is a widely distributed metalloid found in water, soil, and air from natural and anthropogenic sources and exists in inorganic as well as organic forms [1]. It is also used in the manufacture of wood preservatives, glass, pesticides, pharmaceuticals, mining, etc. Humans can be exposed to arsenic via air and food, but the primary exposure route is through contaminated drinking water in which inorganic forms of arsenic predominate. High levels of arsenic in water, up to 2 mg/L or 2 ppm, have been reported around the world [2]. According to World Health Organization, the guideline value of arsenic in drinking water is 0.01 mg/L (equivalent to 0.01 ppm). Once ingested, soluble forms of arsenic are readily absorbed from the gastrointestinal tract to bloodstream and distributed to organs/tissues after passing through the liver. Chronic exposure to inorganic arsenic has been associated with skin lesions, cardiovascular diseases, cancer, metabolic disorders and dysfunction of the endocrine system [3]. In addition to being a toxicant [4], arsenic has been catalogued as a metalloestrogen. Arsenic shows high affinity interaction with the ligand binding domain of ER and is therefore also considered an endocrine disruptor [5-7]. The stages of development in animals (which extend from fetal and neonatal stages to pubertal accomplishment) are targets of endocrine disruptors [8]. Within the hypothalamicpituitary-gonadal axis, reproductive maturation and function is coordinated by the release of gonadotropin releasing hormone (GnRH) from the hypothalamus. The neuronal components of the hypothalamic-pituitary-gonadal axis that regulate GnRH secretion are sexually differentiated by endogenous gonadal hormones, primarily estradiol, through a series of pre-

and perinatal critical periods [9], although recently direct effects of sex chromosomes have also been described [10]. Therefore, disruption of this sex-specific organization by exposure to endocrine disruptors during one or more of these critical periods could affect both the timing of puberty and the maintenance of regular estrus in female rats. The toxic effects of arsenic on the female reproductive system have not yet been well characterized, although it has been hypothesized that the reproductive hazards may be due to disruption of the steroid hormones signaling pathways [7,11]. Given that arsenic interacts with steroid hormones it seems likely that arsenic exposure may have additional adverse effects on maternal health as well as on women´s health more generally. Nevertheless, the effect of arsenic on the particular, sensitive endocrine milieu of pregnancy and postlactational ovarian cycle recommencement has been insufficiently addressed, as well as the consequences on litter reproduction. Consequently, the aim of the present study was to elucidate the effect of arsenic on the reproductive axis in rats: we evaluated its effects during pregnancy and at postlactational resumption of reproductive competence in dams, and in their offspring.

2. Materials and methods. 2.1. Animals and treatments. Sprague-Dawley rats from the IBYME-CONICET colony, established from Charles River stock in 1985, were maintained under a controlled 12 hr light/dark cycle (lights on at 7 AM) and temperature conditions (23 ºC). Rats were housed in stainless steel boxes (3-4 animals per box) with wood chip bedding changed every other day. Rats were allowed standardized pellet food (GEBSA, CGDA, Compañía General de Accesorios de Gregorio Carreras, Buenos Aires, Argentina) and beverage ad libitum in glass bottles. Studies were performed according to protocols approved by the Institutional Animal Care and Use Committee of the IBYMECONICET (in accordance with the Division of Animal Welfare, Office for Protection from Research Risks, National Institutes of Health, Animal Welfare Assurance for the Institute of Biology and Experimental Medicine A#5072-01). Animals were treated humanely and with regard for alleviation of suffering. Sodium arsenite (NaAsO2) (Interchemistry, Buenos Aires, Argentina) was dissolved in distilled water to yield 5 ppm (A5) or 50 ppm (A50) of sodium arsenite in drinking water. These concentrations of sodium arsenite corresponded to 2.88 ppm (2.88 mg/L) and 28.8 ppm (28.8 mg/L) As. Bottles were changed every 2-3 days to avoid oxidation of sodium arsenite. Sodium arsenite treated rats did not show any differences in appearance with respect to controls that drank distilled water. In addition, water consumption did not show statistical differences among groups (Controls: 55.6 ± 4.5 ml/ day vs A5: 58.4 ± 3.9 ml/ day vs A50: 45.4 ± 2.1 ml/ day, ANOVA: NS). Figure 1 illustrates the experimental design.

Figure 1. Schematic representation of experimental protocol.

Adult Sprague Dawley rats (200–250 g BW) were mated in the ratio of three females to one male and presence of sperm plug in vagina was examined every morning. The day when sperm plug was confirmed was designated as day 1 of gestation (GD1) and thereafter rats were randomly housed singly and exposed to A5 or A50 through drinking water until sacrifice at GD18 or 2 months postpartum (2MPP). The control group (C) received distilled water. At delivery pups were sexed according to anogenital distance and each litter was adjusted to 8 pups (4 males, 4 females whenever possible). Following birth (postnatal day 1: PND1), the pups continued to be exposed to arsenic via lactation, as arsenic passes to milk [12]. Male and female offspring of each dam were weaned at PND21 and continued to receive the same treatment (A5 and A50) until sacrifice (3-4 months). The pups from control dams continued to receive distilled water. The animals were identified individually by ear punches and housed by gender according to treatment. All pups were weighed at PND1, PND21 and, after weaning, once weekly for two months. 2.2. Arsenic Determination. We determined arsenic content in liver samples from dams sacrificed at 2MPP and their offspring at 4 months of age. After a wet-digested mineralization, total As was determined by the silver diethyldithiocarbamate (AgDDTC) method that follows ISO 2590 guidelines [13]. Technique detection limit = 0.5 mg/kg. 2.3. Pregnancy and litter parameters. To evaluate the effect of sodium arsenite on gestation, the number of implantation sites, resorption sites and fetuses, BW of fetuses, number of corpora lutea (CL) in the ovaries and placentae weights and lengths were determined on GD18. A group of pregnant females were weighed and sacrificed in the morning of GD18 by quick decapitation. GD18 was chosen to correspond with the onset of rapid fetus growth in normal rat gestation [14]. Trunk blood was

collected and sera obtained for hormones quantification by RIA. The ovaries were dissected, weighed and the number of corpora lutea (CL) was quantified by direct visualization. These organs were then frozen (-70 °C) for the determination of sex steroids. Adrenal glands were also dissected, weighed and frozen and kept for testosterone determination. The two-horned uteri were removed and visually inspected to identify resorption sites and implantation sites. Resorption sites were defined as endometrial sites with an appended amorphous mass without fetus. The number of implantation sites was defined as the result of the total number of placentae with fetuses plus the total number of resorption sites [15]. The live fetuses were removed from their surrounding membranes and counted and fetuses and placentae were weighed individually. The placentae were measured with a caliper in its greatest dimension and kept for testosterone determinations. The other group of pregnant rats continued their pregnancy until delivery. The day of delivery and BW of the dams along pregnancy were recorded. On the day of delivery pups were counted, sexed and the number of live/dead pups noted. 2.4. Postlactational parameters in dams. We determined BW in postlactational dams at 1 and 2MPP. We evaluated estrous cycles in these dams starting at 1 month postpartum. The pituitary response to in vivo-injected GnRH was determined at 1 month postpartum. At 2 months post-partum these dams were euthanized by quick decapitation (in minimal conditions of stress) in the morning of estrus. The hypothalami were weighed and used fresh for evaluation of ex vivo pulsatile GnRH release, frozen to measure GnRH content by RIA or for assessment of gene expressions by quantitative real time PCR (qPCR). One ovary from each rat was weighed and frozen for the evaluation of oxidative stress parameters or steroid hormone contents, while the other ovary was fixed in 4 % buffered formalin for 12 h at room temperature and embedded in paraffin to study the ovarian morphology.

We also collected trunk blood and serum samples were stored at -20 ºC for hormone determinations. 2.5. Offspring parameters. We evaluated various parameters (see below) at different developmental ages, designated as neonatal (PND1), peripubertal (PND21 to PND40) and adulthood (PND60 and over). Animals tested in any experimental group belonged to at least 7 different litters. On the day of sacrifice we recorded BWs and euthanized the animals by quick decapitation (in minimal conditions of stress) in the morning, at 4 months of age (females in estrus). We collected trunk blood and separated serum samples by centrifugation and dissected and weighed hypothalami; we stored all samples at -20 ºC for hormone determinations. 2.6. Sexual developmental markers. 2.6.1. Anogenital distance. We measured anogenital distance using a vernier-calliper on male and female pups on PND1 [16]. 2.6.2. Testicular descent/vaginal opening. We recorded the age and weight at vaginal opening in female pups or testicular descent in male pups [16], as markers of puberty onset. In both cases we examined rats daily, starting on PND21. 2.7. Estrous cycles. At 1MPP and 2 month of age we determined the estrous cycles in dams and their offspring, respectively, every day for one month (6-7 cycles), by examining the vaginal smear under a light microscope. We calculated the percentage of days in regular cycles versus the percentage of irregular cycles for each animal, considering regular cycles those of 4-5 days. Results are expressed as % of days in regular cycles (cycling days/total experimental days x

100) and % of days in irregular cycles (days in irregular cycles/total experimental days x 100). 2.8. In vivo GnRH-induced gonadotropin release. At 1MPP in dams and at PND90-120 in their offspring we determined the pituitary response to in vivo GnRH injection in all treatment groups. As described previously[8], under ketamine/xylazine anesthesia (60/10 mg/kg BW), we collected one basal blood sample from the jugular vein (0 min) and then injected GnRH (100 ng/100 μl, Peninsula Laboratories, Belmont, CA, USA, dissolved in saline solution) into the same vein. We took further samples at 15 and 50 min. We determined serum LH and FSH by RIA. 2.9. GnRH pulsatility studies. At 2MPP pulsatility studies were performed ex vivo in hypothalami from dams as described by Heger et al. [8]. Briefly, whole hypothalami were incubated in 1.5 ml microfuge tubes containing 300 µl of Krebs-Ringer bicarbonate buffer with 4.5 mg/ml glucose and 16 mM HEPES at 37°C under constant shaking. After 30 min of preincubation, media were discarded and fresh medium was added. The medium from each tube was thereafter collected at 8.5 min intervals and replaced with fresh medium. GnRH in the incubation media was measured by RIA as previously described [8]. GnRH assay sensitivity was 1.5 pg/tube, and intra- and inter-assay coefficients of variation were 7.1 and 11.6 %, respectively. GnRH pulses were identified and their parameters determined using the computer algorithm Cluster8 analysis developed by Veldhuis and Johnson [17]. A 2x2 cluster configuration and a t statistic of 2 for the upstroke and downstroke were used to maintain false-positive and falsenegative error rates below 10 %. The number of animals per group was 6–7. 2.10. GnRH content determination. We measured GnRH content in whole hypothalami including the preoptic area at 2MPP in dams and at 4 months of age in their offspring by RIA as previously described [18].

2.11. Protein hormone dosages. At GD18 and 1 or 2MPP in dams and at 4 months of age in offspring serum levels of luteinizing hormone (LH), follicle stimulating hormone (FSH) and prolactin (PRL) were determined by RIA using kits obtained from the National Hormone and Peptide Program and Dr A. Parlow (Torrance, CA, USA), as previously described [18]. Results are expressed in terms of reference preparation 3 rat LH, FSH, and PRL standards. Assay sensitivities were 0.015 ng/ml for LH, 0.1175 ng/ml for FSH, and 0.04 ng/ml for PRL and intra-assay and interassay coefficients of variation were as follows: LH, 7.2 % and 11.4 %; FSH, 8.0 % and 13.2 %; PRL, 8.1 % and 11.4 %. 2.12. Sex hormone serum levels and ovarian, adrenal and placentae contents. On the day of sacrifice (GD18 and 2MPP in dams and 4 months of age in offspring) basal serum levels of estradiol (E2), testosterone (T), and progesterone (P4) were measured by RIA after ethyl ether extraction as previously described [18]. Sex steroid contents were also evaluated in ovaries, adrenal glands and placentae of pregnant rats (GD 18). Assay sensitivities were 3.7 pg/ml (E2), 37.5 pg/ml (T) and 150 pg/ml (P4). Intra- and inter-assay coefficients of variation were 6.8 % and 11.7 % for E2, 7.1 % and 12.2 % for P4, and 7.8 % and 12.3 % for T, respectively. Amount of tissues used to measure steroid hormones were approximately: 100 mg for placenta (1/4 of whole placenta), 40 mg for adrenals (whole gland) and 55 mg for ovaries (whole gland). 2.13. Ovarian morphology. To evaluate changes in general structure, ovaries from 2MPP dams were cut in fivemicrometer step sections and mounted at 50 mm intervals onto microscope slides to prevent counting the same follicle twice. Slides were stained with hematoxylin-eosin. The number of primary follicles (PF), preantral follicles (PAF), antral follicles (AF), preovulary follicles (POF), atretic follicles (AtF) and corpora lutea (CL) was determined under a light microscope

(3 slides per ovary, 5-6 ovaries/treatment) as described by Parborell et al. [19]. Atresia was defined as the presence of more than 10 pyknotic nuclei per follicle; in the smallest follicles, the criteria for atresia was a degenerate oocyte, precocious antrum formation, or both [19]. Cysts were defined as follicles with a thin granulosa layer (two to three layers) and nondetectable theca [19]. Representative images at 10 or 40 X magnifications were taken with a light Nikon Photomicroscope Eclipse 200 and NIS-Elements BR 2.30 software. 2.14. Oxidative stress measurements. At 2MPP in dams oxidative stress measurements were performed in ovaries from the different experimental groups, as previously described [20] with minor modifications. Sample preparation: at sacrifice one ovary per rat was dissected, cut in half and each half weighed. For catalase (CAT) activity and lipid peroxidation assays half an ovary was homogenized in 1 ml phosphate buffer (KH2PO4/K2HPO4 50 mM pH 7.4). For GSH content the other half of the ovary was homogenized in 1 ml HClO4 0.5 N. CAT activity: Ovary homogenates were centrifuged at 10,000 X g for 10 min at 4 °C and the supernatant kept for CAT activity determination.

CAT activity was measured

spectrophotometrically by monitoring the disappearance of H2O2 at 240 nm. The reaction mixture

for

the

assay

contained 50

mM phosphate

buffer

(pH

7.8), 25

mM H2O2 (MERK, Darmstadt, Germany) and 50 µl of CAT-containing samples, in a total volume of 1 ml. One unit of CAT was defined as the disappearance of 1 µmol of H2O2/min (ε = 43.6 M-1cm-1). Results are indicated as International Units of CAT per g of tissue. Lipid peroxidation: The formation of lipid oxidation products was evaluated by determination of 2-thiobarbituric acid reactant substances (TBARS). 0.3 ml of ovary homogenates were mixed with reaction buffer [15 % (v/v) trichloroacetic acid, 0.25 N hydrochloric acid and 0.375 % (w/v) 2-thiobarbituric acid and heated for 15 min at 90 °C. The complex formed with 2-thiobarbituric acid was extracted with 3 ml of butanol and

quantified fluorimetrically (λex=515 nm; λem=555 nm). TBARS were expressed as µmol of malondialdehyde (MDA) per gram of tissue. MDA standard was prepared from 16.4 µM 1,1,3,3-tetraethoxy propane. GSH content: Ovary homogenates in HClO4 acid were centrifuged at 600 x g for 10 min at 4 °C and were neutralized with 0.44 M Na3PO4 to pH=7. 20 µl of each sample was mixed with 0.9 ml of reaction buffer (100 mM phosphate buffer, 10 mM EDTA, pH 7.4) and the absorbance at 412 nm was measured. Thereafter, 100 µl of DTNB solution [6 mM DTNB (Sigma Chemical Co., MO, USA) in sodium bicarbonate 0.5 % w/v was added. Samples were incubated for 1 minute and absorbance at 412 nm was measured for a second time. GSH content was calculated as: GSH content = (Abs2 – Abs1) /ε x Vs x Cp, were Abs2: Absorbance after addition of DTNB solution and Abs1: Absorbance before addition of DTNB solution, ε = 13.6 mM-1cm-1, Vs: sample volume and Cp: protein concentration. 2.15. RNA Isolation and Reverse Transcription. Total RNA from whole hypothalami of dams at 2MPP was isolated using TRIzol Reagent (Invitrogen, Carlsbad, Calif., USA) according to the manufacturer’s protocol and kept at 70°C until used. 1 μg of total RNA was reverse-transcribed in a 20 μl reaction using MMLV reverse transcriptase (Epicentre, Madison, Wisconsin, USA) and oligo(dT)15 primers (Biodynamics, Buenos Aires, Argentina). The reverse transcriptase was omitted in control reactions, where the absence of an amplification product indicated the isolation of RNA free of genomic DNA. cDNA was stored at –20 °C until use in real-time quantitative PCR. 2.16. Real-time quantitative PCR. Primer sets were designed for the specific amplifications of the following rat genes: gonadotropin releasing hormone (Gnrh1), kisspeptin (Kiss1), glutamic acid decarboxylase 65 (Gad65, the limiting enzyme in GABA synthesis) and aromatase (Cyp19), and the

housekeeping control gene Cyclophilin b (Table 1).

The amplification efficiency of each primer set was calculated from the slope of a standard amplification curve of log (ng cDNA) per reaction versus Ct value (E = 10−(1/slope)). Efficiencies of 2 ± 0.1 were considered optimal. Quantitative measurements were performed by qPCR in a total volume of 10 μl as previously described [18]. Amplification was carried out in a Bio-Rad iCycler Detection System. Results were validated based on the quality of dissociation curves.

Table 1. Primer sequences and details used for gene expression assays by qPCR. Genebank Gene

Primer forward 5´- 3´

Product

Annealing

size, bp

temp. (ºC)

Primer reverse 5´- 3´

access num. Gnrh1

NM_012767.2

GGCAAGGAGGAGGATCAAA

CCAGTGCATTACATCTTCTTCTG

143

56

Kiss1

NM_181692.1

GCAAAAATGGCACCTGTGGT

GCCACCTGCCTCCTGCCGTAGCGC

301

60

Gad65

NM_012563.1

AATTATGCACTTCTCCACGCAACA

GAAATGCGAGAGTGGGCCTTT

70

60

Cyp19

NM_017085.2

ATCGCAGAGTATCCGGAGGT

GTCCACGACAGGCTGATACC

150

60

Cyclophilin b

NM_022536.2

GACCCTCCGTGGCCAACGAT

GTCACTCGTCCTACAGGTTCGTCTC

97

59

Each sample was analyzed in duplicate along with non-template controls to monitor contaminating DNA and each gene was normalized to Cyclophilin b, whose expression is constant. Quantitative differences in the cDNA target between samples were determined using the mathematical model of Pfaffl [21] which refers expression to a single randomly selected control dam. For standard curves, a dilution series of cloned genes templates ranging from 10 to 108 copies were used. Data were collected from threshold values using the automatic function of the Bio-Rad software. 2.17. Statistical analysis. Results were expressed as means ± SEM, and values were considered significant at p<0.05. We used by Chi-Square (%), one-way analysis of variance (ANOVA) or two-way ANOVA with repeated measures design to analyze data sets (Statistica, version 7; Statsoft Inc., Tulsa,

OK, USA) and Tukey’s for unequal N posttest. Data were transformed when the test for homogeneity of variances so required. In the case of estrous cycles and ovarian structures, percentages were arcsine transformed to convert them from a binomial to a normal distribution and were then analyzed by one-way ANOVA. For all analysis in dams, the experimental unit was the single animal. For offspring analysis the experimental unit was the litter for prenatal and postnatal endpoints up to PND21. Thereafter, offspring were considered singly, as in this case, after weaning, each rat consumed sodium arsenite solutions according to the experimental group.

3. Results. 3.1. Gestational and newborn litter parameters. Some studies suggest that arsenic exposure may result in adverse effects on pregnancy outcome. For this reason, BWs of dams were followed along pregnancy. Gestational and litter parameters were evaluated at GD18 and at parturition. 3.1.1. Body Weight. Body weights were recorded during pregnancy on GD1, GD7, GD14 and GD 21. A50 rats showed diminished BW increase along pregnancy with regard to control dams starting on GD7 (Table 2).

Table 2. Effect of sodium arsenite exposure on BW increase during gestation in rats GD BW (g)

1

7

14

21

N

C

228 ± 5

254 ± 6

283 ± 5

352 ± 8

12

A5

228 ± 3

262 ± 4

289 ± 5

353 ± 7

14

A50

236 ± 6

223 ± 7*

249 ± 11*

301 ± 8*

11

One-way ANOVA for each GD. *: p<0.05 or less, significantly different from C and A5 dams.

3.1.2. Hormonal status at GD18. To evaluate whether arsenic affected the hormonal milieu of pregnancy, we determined hormone levels on GD18. Serum gonadotropins were similar in all groups, as well as PRL (not shown). Conversely, there was an approximately 2-fold increase in serum E2 and T levels in A50 animals,

compared to controls, with no significant alterations in A5 rats (Figure 2A-B), while P4 did not differ among groups (Figure 2C).

T (pg/ml)

E2 (pg/ml)

*

40 30 20 10 0

D

E2 (pg)/ mg of ovary

C

A5

C

1200 1000 800 600 400 200 0

*

A5

E

20 15

*

10 5 0

C

A5

A50

50 40 30 20 10 0

C

A50

P4 (ng/ml)

B 50

T (pg)/ mg of adrenal gland

A

C

A50

A5

A50

0.3

* 0.2

0.1

0

C

A5

A50

Figure 2. GD18: Effect of sodium arsenite exposure on serum Estradiol (E2) (A), Testosterone (T) (B) and Progesterone (P4) (C) and on ovary E2 content (D) and adrenal T content (E). A. One-way ANOVA, p<0.05, * A50 vs. C and A5, p<0.01, n= 13(C), 8(A5), 10(A50). B. One-way ANOVA, p<0.05, * A50 vs. C and A5, p<0.01, n=13 (C), 8(A5), 10(A50). C. One-way ANOVA: NS, n= 13(C), 8(A5), 10(A50). D. One-way ANOVA, p<0.01: * A50 vs. C, p<0.01, n= 12(C), 8(A5), 11(A50). E. One-way ANOVA, p<0.005: * A50 vs. C and A5, p<0.005, n= 4(C), 4(A5), 5(A50).

As we found increased serum E2 and T at GD18, we evaluated the ovarian content of these steroid hormones. E2 ovarian content was significantly decreased in A50 dams compared to controls (Figure 2D), while T tended to increase, not reaching statistical significance (not shown). To assess other possible sources of T contributing to serum levels, T contents were measured in adrenal glands and placentae: A50 dams presented a significant increase in

adrenal gland content of this hormone (Figure 2E), while no differences were found in placentae T contents (not shown). At this GD, A50 rats showed significant lower BW than Controls [BW GD18 (g): C: 344±6 (n=13), A5: 333±12 (n=14), A50: 319±16 (n=14), One-way ANOVA, p<0.05: A50 vs. C, p<0.05], similar to what was observed on GD21. Nevertheless, ovarian, adrenal and placentae weights did not vary among groups (not shown).

3.1.3. Gestational parameters on GD18 and at parturition. No significant differences due to arsenite exposure were observed among groups in the number of implantation sites, resorption sites and fetuses, BW of fetuses, number of corpora lutea (CL) in the ovaries and placentae weights and lengths determined on GD18 (not shown). No differences were also found among treatment groups (not shown) in the endpoints evaluated at parturation. 3.2. Postpartum dams. 3.2.1. Liver arsenic content at sacrifice. Chronic treatment with sodium arsenite for approximately 80 days (from pregnancy commencement to 2 months postpartum) produced a significant, dose-dependent increase in total liver arsenic content, exhibiting 3.4- and 17-fold increases in the A5 and A50 groups, respectively (mg As/kg liver: C: 0.5±0.0; A5: 1.7±0.6*; A50: 8.7±0.9#; One-way ANOVA, p<0.001: *: A5 vs. C, p<0.01; #: A50 vs. C and A5, p<0.01. n= 5 per group).

3.2.2. Body weight and estrous cycles. BW, which had been low during pregnancy, was still low the day after birth (0MPP) and at 1MPP in A50 rats but had normalized by 2MPP when compared to control animals, although these animals were still exposed to sodium arsenite in drinking water (Figure 3A).

A

C

A5

A50

#

300

100

*

*

250

B *

*

200 150 100

0 1

A5

A50

60 40

*

20

50 0

C

80

Days (%)

Body weitght (g)

350

2

*

0

Months postpartum

Regular cycles

Irregular cycles

Figure 3. Postpartum dams: Effect of sodium arsenite exposure on postpartum body weight (BW): 0MPP (day after parturition), 1MPP and 2MPP (A) and on estrous cycles (B). A. Twoway ANOVA with repeated-measures design: interaction, p<0.05; *: A50 vs. C and A5 at 0MPP and 1MPP, p<0.05. #: 2MPP vs. 0MPP for A50, p<0.005, n=10(C), 12(A5), 8(A50). B. Percentages were arcsine transformed to convert them from a binomial to a normal distribution and were then analyzed by one-way ANOVA, p<0.04, *: C vs A5: p<0.02; *: C vs A50: p<0.05; A5 vs A50: NS, n=6 for each treatment.

After weaning of the pups (day 21 postpartum), estrous cycles normally recommence in dams. At 1MPP we determined the estrous cycles in dams of all treatments. Arsenic-treated animals presented increased percentage of days in irregular cycles (Figure 3B), with the concomitant decrease in regular cycles. 3.2.3. Basal levels of LH, FSH, PRL and pituitary response to in vivo GnRH administration. Basal levels of LH were similar among groups (not shown), whereas FSH levels were increased in A50 treated animals (Figure 4A). There was a marked impairment in GnRHstimulated FSH secretion (Figure 4B): while Control animals showed an increase of 283% and 310% after 15 and 50 minutes respectively, A5 and A50 groups exhibited a dose-

dependent diminished increase in FSH, attaining statistical significance only in A50 treated animals (A5: 135 % and 196 %; A50: 107 and 144 %, p<0.05 with regards to C, both at 15 and 50 minutes post-injection). Conversely, LH secretion showed a time-dependent increase, with out differences among groups (not shown). When analyzing the PRL at 2MPP we observed a decrease in arsenic-treated rats, attaining significance only in A50 animals [PRL (ng/ml): C: 14.97±2.13; A5: 10.24±1.58; A50: 8.94±1.36, One-way ANOVA, p<0.05: * A50 vs. C, p<0.05; n= 11(C), 10(A5), 10(A50)].

B *

4 2 0

% increase of FSH (ng/ml)

FSH (ng/ml)

A 6

450

C

400

A5

A50

*

350 300

*

250 200 150 100

#

50

* #

0

C

A5

A50

0

15 Time (min)

50

Figure 4. Postpartum dams: Effect of sodium arsenite exposure on basal FSH (A) and GnRH-stimulated FSH response (B, percent increase over basal levels) at 1MPP. A. One-way ANOVA, p<0.05: *: A50 vs. C, p<0.01, n= 10(C), 9(A5), 10(A50). B. Two-way ANOVA with repeated-measures design: interaction, ns; main factor time: p<0.05, *: 50 min different from basal for all treatments, p<0.05, main factor treatment: p<0.05, #: A50 vs C, p<0.05, n=10(C), 9(A5), 10(A50).

3.2.4. Gene expression in hypothalami.

Since we observed increased FSH at 1MPP we evaluated whether arsenic exposure modified the expression of key genes involved in the regulation of gonadotropin secretion, such as Gnrh1, Kiss1, Gad65 and Cyp19. Arsenic-exposed animals showed a dose-dependent increase in Kiss1 and Gad65 mRNA expression in the hypothalamus (Figure 5). No differences were found in Gnrh1 and Cyp19

6.0 5.0

B *

4.0 3.0

*

2.0 1.0 0.0

Relative expression GAD65 / Ciclophilyn b

A Relative expression Kiss-1 / Ciclophilyn b

mRNA expression (not shown).

5.0 4.0

*

3.0

*

2.0 1.0 0.0

C

A5

A50

C

A5

A50

Figure 5. Postpartum dams: Effect of sodium arsenite exposure on Kiss1 (A) and Gad65 (B) mRNA expression in whole hypothalami at 2MPP. A. One-way ANOVA, p<0.05: *: C vs. A5 p<0.02; C vs. A50 p<0.01, n= 9(C), 7(A5), 6(A50). B. One-way ANOVA, p<0.05: *: C vs. A5 p<0.05; C vs. A50 p<0.02, n= 9(C), 7(A5), 6(A50).

3.2.5. Hypothalamic GnRH content and GnRH pulsatility. Since the expression of Kiss1 and Gad65 genes were altered in hypothalami of arsenictreated postpartum rats, and the products of these genes, kisspeptins and glutamic acid decarboxylase (the rate limiting enzyme in GABA synthesis), respectively, participate in the regulation of GnRH synthesis and release, we next evaluated hypothalamic GnRH content, finding no significant differences between treatments (not shown). We also measured pulsatile GnRH release from whole hypothalamic explants incubated ex vivo, since this pulsatile secretion is critical for pituitary function. GnRH in media samples

revealed a pulsatile pattern of secretion with a similar frequency among treatments of about one pulse per hour (not shown). Peak amplitude was also similar among groups (not shown). Other parameters such as peak duration, mean interpeak interval, or mean secretion pulse mass were also similar to control hypothalami (not shown).

3.2.6. Sex hormones at 2 MPP and ovarian morphology. Serum E2, which was elevated in A50 rats on GD18, markedly decreased after weaning, being significantly lower than in Controls in both A5 and A50 treated animals (Figure 6A). On the other hand, T levels had normalized in A50 rats (T had been increased at GD18, as shown above) while P4 remained unchanged (not shown). Hematoxylin-eosin staining was performed on ovarian sections at 2MPP to determine whether alterations in cyclicity, FSH and E2 levels at this age may correlate with alterations in the ovarian morphology. A50 rats showed a significantly lower number of POF (Figure 6B). In addition, only ovaries from arsenic-exposed animals presented a large number of follicles with a thin granulosa layer (two to three cell layers), non-detectable theca and a high intrafollicular volume, compatible with the formation of cysts (Cys) (Figure 6C). However, when we analyzed the percentage of animals with Cys only A50 dams attained statistical significance (Figure 6D).

C

B 60

25 20 15 10

*

*

% ovary structures

E2 (pg/ml)

A 30

A5

A50

40

20

5 0

*

0

A5

C

PF

A50

PAF

AF

POF

AtF

CL

D100 % animals with Cys

C

80

*

60 40 20 0 C

A5

A50

Figure 6. Postpartum dams: A. Effect of sodium arsenite exposure on basal serum E2 at 2MPP. One-way ANOVA, p<0.05: *: A5 and A50 vs. C, p<0.05, n=10. B. Number of specific ovary structures relative to total structures (%): primary follicles (PF), preantral follicles (PAF), antral follicles (AF), preovulatory follicles (POF), atretic follicles (AtF) and corpora lutea (CL). For analysis of ovarian structures, percentages were subjected to arc-sine transformation to convert them from a binomial to a normal distribution. One-way ANOVA, p<0.05: *: vs. C, p<0.05, n=6(C), 5(A5), 5(A50). C. Representative microphotograph (10X) of an ovary section from an A50 rat with cystic follicles (Cys). The scale bar represents 100 µm. D. Percentage of animals with cysts in their ovaries: Chi- Square: *: A50 vs. C, p<0.05, n=6(C), 5(A5), 5(A50).

3.2.7. Oxidative stress parameters in ovaries.

We determined several parameters of oxidative stress in ovaries, as we had observed decreased serum E2 and an altered ovarian morphology at 2MPP. CAT activity and GSH and TBARS levels were similar among experimental groups (not shown), suggesting oxidative stress was not compromised by arsenic exposure in our experimental model.

3.3. Offspring parameters. 3.3.1. Developing offspring. 3.3.1.1. Body weight and sexual development. On PND1, male and female A50 pups showed decreased BW compared with controls of the respective sex: this decrease in BW was more marked in male offspring (Figure 7A). This was followed by catch-up growth at weaning, where we furthermore noted an increase in weight with regard to controls (Figure 7B). The A5 group also showed increased BW at PND21 compared to controls in both sexes.

FEMALES

PND 1

MALES

8.4

B

8.2

*

*

8.0

a

7.8 *

7.6 7.4 7.2 7.0

FEMALES

PND 21

70

MALES

a

60

Body weigth (g)

Body weigth (g)

A

50

a *

*

*

40 30 20 10 0

C

A5

A50

C

A5

A50

Figure 7. Offspring: Effects of sodium arsenite exposure on: BW at PND1 (A) and PND21 (B). A. Two-way ANOVA: interaction NS; main effect sex: *: p<0.05; main effect treatment p<0.05:

a: p<0.05 vs. C and A5, n=10(C), 11(A5), 9(A50). B. Two-way ANOVA:

interaction NS; main effect sex: *: p<0.05; main effect treatment p<0.005, a: p<0.005 vs. C, n=8(C), 8(A5), 8(A50).

We measured AGD relative to BW as a sexual developmental marker. In female offspring, 50ppm of sodium arsenite significantly reduced the AGD at birth with regard to same litter controls [AGD (mm)/ BW (g): C: 0.0200 ± 0.0005 vs. A5: 0.0159 ± 0.0016 vs. A50: 0.0131 ± 0.0011*, One-way ANOVA, p<0.05, *: p<0.05 vs. C, n=5(C), 4(A5), 4(A50)]. In male offspring arsenic did not modify this parameter (not shown). For puberty onset we determined the age of vaginal opening in females or of testicular descent in males; these parameters were not altered by arsenic exposure (not shown).

3.3.2. Adult offspring 3.3.2.1. Liver arsenic content at sacrifice. Liver arsenic content significantly increased 4-fold in A50-exposed offspring, while A5exposed rats did not differ from controls (mg As/kg liver: C: 0.5±0.0; A5: 0.7±0.3; A50: 5.1±1.9*. One-way ANOVA: p<0.01: * p<0.05 vs. C. n= 10 per group).

3.3.2.2. Body weight and estrous cycles. At three months of age we recorded BWs and we observed the same differences found at PND1: diminished BW in both sexes in A50-treated rats (Figure 8).

500

Body weigth (g)

FEMALES

3 MONTHS *

400

*

MALES

# *

300 200 100 0 C

A5

A50

Figure 8. Offspring: Effect of sodium arsenite exposure on BW at 3 months of age. Twoway ANOVA: interaction: NS; main effect sex: *: p<0.005; main effect treatment p<0.005: #: p<0.005 vs. C and A5. We observed no estrous cycles irregularities after arsenic exposure from conception to adulthood [days in regular cycles (%) = C: 90.17 ± 2.65 vs. A5: 89.16 ± 3.92 vs. A50: 90.71 ± 2.38, One-way ANOVA: NS, n= 21(C), 12(A5), 12(A50)].

3.3.2.3. Basal levels of LH, FSH and PRL, pituitary response to in vivo GnRH administration and hypothalamic GnRH content. In females, basal FSH was increased in the A50 rats (Figure 9A), whereas in males this hormone was reduced by the same treatment (Figure 9B). FSH response to GnRH stimulation was significantly increased in A50-treated males with regard to Control and A5 males, both at 15 and 50 minutes post-injection (Figure 9D, p<0.005). Conversely, arsenic did not affect the FSH response to GnRH in females (Figure 9C). Neither basal nor GnRH-stimulated LH levels were affected by arsenic exposure (not shown). Arsenic exposure did not alter serum PRL levels in either sex (not shown). Because basal FSH was altered in both males (decreased) and females (increased) in arsenictreated animals, we measured hypothalamic GnRH content, as an approach to the function of this brain area. In females the A50 group showed increased GnRH content (Figure 9E) whereas in males GnRH was reduced in both A5 and A50 treated rats (Figure 9F), correlating with the FSH levels observed.

FSH (ng/ml)

5

B

FEMALES

4 3 *

2 1 0 A5

4

*

2

A50

C

D FEMALES

250

C

A5

200 150 100 50 0

0

15 Time (min)

A50

50

FEMALES *

4000 2000 0

A50

* #

150 100 50 0

3000

GnRH (pg) / ht

6000

A5

*

F 8000

A50 C

200

0

E

A5 MALES

250

% increase of FSH (ng/ml)

C % increase of FSH (ng/ml)

6

0 C

GnRH (pg) / ht

MALES

8

FSH (ng/ml)

A

15 Time (min)

50

MALES

2000 ** *

1000 0

C

A5

A50

C

A5

A50

Figure 9. Offspring: Basal FSH in females (A) and males (B) during the in vivo pituitary response to GnRH. GnRH-stimulated FSH increase (% increase over basal levels) for females (C) and males (D). Females: n=22(C), 12(A5), 17(A50); males: n=17(C), 8(A5), 8(A50). A. One-way ANOVA: p<0.05, *: p<0.05 vs C. B. One-way ANOVA: p<0.05, *: p<0.05 vs C. C. ANOVA with repeated measures design: Interaction: NS, main effect treatment: NS; main effect time: p<0.005, *: p<0.005 vs time 0 for all treatments. D. ANOVA with repeated measures design: Interaction: NS, main effect time: p<0.005, *: p<0.005 vs time 0 for all treatments; main effect treatment: p<0.005, #: p<0.005 vs. C and A5. Female (E) and male (F) GnRH hypothalamic content. E. One-way ANOVA: p<0.05, *: p<0.05 vs. C. n= 20(C), 9(A5), 14(A50). F. One-way ANOVA: p<0.05, *: p<0.05 vs. all treatments. n=25(C), 8(A5), 14(A50).

3.3.2.4. Sex hormone levels. Arsenic exposure did not alter serum E2 and P4 in females offspring (not shown). Conversely, T was significantly elevated in the A50 group compared to control females [T (ng/ml): C: 0.16 ± 0.02 vs. A5: 0.18 ± 0.02 vs. A50: 0.22 ± 0.02*, One-way ANOVA: p<0.05, *: p<0.05 vs. C. n=21 (C), 12 (A5), 17 (A50)]. In male offspring there were no significant effects on T following arsenic treatments (not shown).

4. Discussion Arsenic, widely distributed through drinking water, is considered a serious, worldwide environmental health threat [22]. High levels are found in Mexico, Bangladesh, India and Argentina among other countries [23]. The present study investigated adverse effects of arsenic on the reproductive axis in rats during pregnancy and at postlactational restoration of reproductive competence and in their offspring. Arsenic exposure at the present doses significantly increased liver arsenic content in dams and offspring (A50 Dams: 8.7±0.9 mg/kg liver and A50 offspring: 5.1±1.9 mg/kg liver) to levels similar to those found in hair or nails of exposed human population [24] although differences in the tissues analyzed and arsenic metabolism between species have to be taken into account [25]. Arsenic has been shown to affect BW in several experimental models [26]. During pregnancy diminished body weight increase was observed in arsenic-exposed dams that was not attributable to differences in offspring number or weight, nor did other studied organs seem to be affected. Regarding hormone levels, T and E2 were increased on GD18 in A50 rats, while progesterone was unaffected. During pregnancy androgens are mainly produced by the placenta [27]. Nevertheless, placental T content was not altered by arsenic exposure, while a significant increase in adrenal T content was determined in A50 rats that may account for the elevated serum titers. Serum E2 was also increased at this stage of gestation in A50 dams. Increased E2 is probably the consequence of aromatization of T in the ovaries, since the rat placenta lacks aromatase [28]. However, ovarian E2 content was, surprisingly, lower than in controls. The increase in serum E2 could be due to aromatization in peripheral tissue, though this would have to be corroborated in future studies. Nevertheless, neither decreased body weight nor increased E2 and T disturbed pregnancy outcome, since none of the pregnancy

parameters evaluated were affected by arsenic exposure, in agreement with no alterations in progesterone levels. These results suggest that at these exposure levels pregnancy was not at risk in this experimental model, as also proposed by others [29]. These results differ from those informed by some authors in which fewer offspring were born to arsenic-exposed mice [30] and women [31]. After parturition, the body weight of arsenic-exposed dams, that had been low during pregnancy, slowly recovered attaining normal values at 2MPP, even under constant sodium arsenite exposure. Postlactational restoration of cyclicity is a sensitive period when the reproductive axis is liberated from the inhibition imposed by pregnancy and lactation and the recommencement of normal estrous cycles is fundamental to regain reproductive competence. At this delicate period sodium arsenite induced an increase in irregular cycles, a marked decrease in serum E2, increased basal FSH, decreased pituitary response to GnRH stimulation in terms of FSH secretion and decreased PRL levels. These results could expose an impact of arsenic on hypothalamic regulation of reproduction. Many studies suggest that arsenic compounds produce adverse health effects by acting as endocrine disruptors and thus altering gene regulation [32]. Arsenic exposure significantly increased Kiss1 and Gad65 mRNA in the hypothalamus in both A5 and A50 rats. Both, increased kisspeptins, the products of the Kiss1 gene, and GABA, synthesized by glutamic acid decarboxylase, the product of Gad65 gene, could affect GnRH synthesis and release. Nevertheless, neither Gnrh1 mRNA expression, nor GnRH hypothalamic content, nor GnRH pulsatile release varied in arsenite-exposed rats, suggesting a non-neural origin of the alterations observed in these animals. Some investigations propose that arsenite may have deleterious effects on ovarian cells [33] and that follicle loss can be dramatically accelerated by external insults, including environmental toxicants, leading to premature menopause [34]. In addition, some

studies suggested that arsenic increased reactive oxygen species inducing oxidative stress [35]. In fact, A50 dams presented significantly less preovulatory follicles and, additionally, A50 and A5 dams showed the presence of large cysts, also observed in arsenic-exposed mice [36]. In agreement with our observations, Chattopadhyay and Ghosh showed a decrease in follicle development in arsenic-exposed adult Wistar rats [37], which may result from increased oxidative stress in the ovary. Nevertheless, neither CAT activity, nor lipid peroxidation, nor glutathione levels were altered in ovaries by sodium arsenite treatment in our rats. Therefore, oxidative stress does not seem to be the main cause of follicle loss or diminished E2 secretion, although we cannot discard that other components of the cell redox system may be affected. Arsenic may also induce ovarian damage by other mechanisms such as impairment in steroid hormones synthesis or action and/or DNA damage [7,33]. Further studies will be necessary to elucidate the mechanisms of arsenic-induced ovarian damage in our experimental model. Altogether, our results show that the sensitive period of postlactational cycle reinstatement is affected by arsenic exposure. In this context, Su et al described low E2 together with high FSH in 11-month female SD rats, an age in which rats become senescent [38], suggesting that early aging of the reproductive axis may have occurred under arsenic exposure. We next analyzed the effect of arsenite exposure on the reproductive axis of offspring. Litters of A50-exposed dams had reduced BW at birth, in agreement with other animal [39] and human studies [26,31]. Low birth weight was followed by catch-up growth at weaning. Although arsenical compounds pass to breast milk, the concentration of this metalloid is lower than in other tissues [12]. Therefore, a decrease in exposure during lactation may have permitted the catch-up growth observed. Thereafter, offspring started to drink water and arsenic, once again, induced a decrease in BW. Since we had observed increased serum T and E2 at GD18 in A50 dams, an impact on the sexual differentiation in their offspring could be

expected. Anogenital distance provides the simplest, non-invasive “read-out” of the correct in utero sex differentiation [40] and it is dependent upon prenatal exposure to androgens in mammals [41,42]. Counterintuitively, female offspring of A50-exposed dams had diminished anogenital distance at PND1, suggesting a “hyperfeminizing” effect, without differences in male offspring. To our knowledge, this is the first time that an effect of arsenic exposure on anogenital distance was registered. Interestingly, Christiansen et al. described that exposure to very low doses of the estrogenic compound Bisphenol A induced a decrease of AGD in females [43], similar to our observation. Future studies will determine the mechanisms by which endocrine disruptors such as arsenic or BPA induce this trait. Nevertheless, arsenic did not affect vaginal opening or testicular descent, in agreement with other studies [44]. In adult, arsenite-exposed offspring FSH was significantly increased in A50 females and decreased in A50 males. In addition, arsenite exposure increased the in vivo GnRH-induced FSH release in adult males that may be related to the reduced basal secretion, demonstrating a clear alteration in FSH physiology. Correlating with FSH titers, A50 females had higher GnRH content while males exposed to both concentrations of arsenic had lower GnRH contents. In contrast, other studies evaluating arsenic exposure only during adulthood had shown reduced FSH and LH levels in female and male rats [45,46]. Furthermore, A50 females showed increased serum T while male T did not change. We detected no differences in basal serum E2 levels in female offspring; in contrast, decreased E2 was reported in adult offspring [47]. Others reported reduced E2 in females [48,49] and T levels in males [50], even at similar doses (4 and 40ppm) to those used here. Different experimental models may account for these differences. Despite high testosterone and FSH in adult arsenic-exposed female offspring, no effects on estrous cycles were detected at this time point, different from our results on postlactational dams (see above) and those of others [48,49]. Nevertheless, the alterations in the hypothalamic-pituitary-gonadal axis observed in young offspring may be

early signs of reproductive compromise that could fully develop later in life. Evaluation of arsenic-exposed offspring will have to be performed at later stages to evaluate this possibility. 5. Conclusion Taking our results together we can postulate that these levels of arsenic exposure: a) do not substantially jeopardize gestation in rats, b) clearly compromise the sensitive period of reinstatement of reproductive competence after pregnancy and lactation, affecting estrous cyclicity, hypothalamic, pituitary and ovarian hormones expression/secretion, as well as ovarian morphology, putting reproduction at risk, and c) alter the expression of critical components of the hypothalamic-pituitary-gonadal axis in young adults from litters exposed to arsenic from conception, possibly endangering their future reproductive health.

A model showing our interpretation of the inter-relationships and control mechanisms that are affected by arsenic exposure are shown in postpartum dams, the group most affected in our experimental conditions (Figure 10).

Figure 10. A model of the inter-relationships and control mechanisms affected by arsenic exposure is shown in postpartum dams. Numbers propose the sequence of events.

6. Conflict of Interest statement The authors declare that there are no conflicts of interest.

7. Acknowledgements This work was supported by Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET, PIP 2010-363 to CL and PIP 2013-571 to VLL), Agencia Nacional de Promoción Científica y Técnica (ANPCyT, PICT 2013-061 to CL and PICT 2012 Nº 707 to VLL) and Universidad de Buenos Aires (UBA, 20020130100006BA 2014-2017 to CL). Argentina. We also thank Fundación René Barón, Argentina, for their generous support.

8. References [1] Hughes M.F.; Beck BD; Chen Y; Lewis AS; Thomas DJ. Arsenic exposure and toxicology: a historical perspective. Toxicol.Sci 2011, 123, 305-332. [2] Concha G.; Vogler G; Lezcano D; Nermell B; Vahter M. Exposure to inorganic arsenic metabolites during early human development. Toxicol.Sci. 1998, 44, 185-190. [3] Singh N.; Kumar D; Sahu AP. Arsenic in the environment: effects on human health and possible prevention. J Environ.Biol. 2007, 28, 359-365. [4] Wang A.; Holladay SD; Wolf DC; Ahmed SA; Robertson JL.

Reproductive and

developmental toxicity of arsenic in rodents: a review. Int.J Toxicol. 2006, 25, 319-331. [5] Stoica A.; Pentecost E; Martin MB. Effects of arsenite on estrogen receptor-alpha expression and activity in MCF-7 breast cancer cells. Endocrinology 2000, 141, 35953602. [6] Watson W.H.; Yager JD. Arsenic: extension of its endocrine disruption potential to interference with estrogen receptor-mediated signaling. Toxicol.Sci 2007, 98, 1-4.

[7] Parodi D.A.; Greenfield M; Evans C et al. Alteration of mammary gland development and gene expression by in utero exposure to arsenic. Reprod.Toxicol. 2015, 54, 66-75. [8] Fernandez M.O.; Bianchi MS; Lux-Lantos VA; Libertun C. Neonatal Exposure to Bisphenol A Alters Reproductive Parameters and Gonadotropin Releasing Hormone Signaling in Female Rats. Environ.Health Perspect. 2009, 117, 757-762. [9] Cooke B.; Hegstrom CD; Villeneuve LS; Breedlove SM. Sexual differentiation of the vertebrate brain: principles and mechanisms. Front.Neuroendocrinol. 1998, 19, 323362.

[10] Maekawa F.; Tsukahara S; Kawashima T; Nohara K; Ohki-Hamazaki H.

The

mechanisms underlying sexual differentiation of behavior and physiology in mammals and birds: relative contributions of sex steroids and sex chromosomes. Front Neurosci. 2014, 8, 242. [11] Davey J.C.; Bodwell JE; Gosse JA; Hamilton JW. Arsenic as an endocrine disruptor: effects of arsenic on estrogen receptor-mediated gene expression in vivo and in cell culture. Toxicol.Sci. 2007, 98, 75-86. [12] Xi S.; Jin Y; Lv X; Sun G. Distribution and speciation of arsenic by transplacental and early life exposure to inorganic arsenic in offspring rats. Biol.Trace Elem.Res. 2010, 134, 84-97. [13] ISO TC 47 SC1. ISO 2590:1973, General method for the determination of arsenic Silver diethyldithiocarbamate photometric method. 1st edn. American National Standards Institute (ANSI), 1973. [14] Witlin A.G.; Li ZY; Wimalawansa SJ et al.

Placental and fetal growth and

development in late rat gestation is dependent on adrenomedullin. Biol.Reprod. 2002, 67, 1025-1031.

[15] Varayoud J.; Ramos JG; Bosquiazzo VL et al. Neonatal exposure to bisphenol A alters rat uterine implantation-associated gene expression and reduces the number of implantation sites. Endocrinology 2011, 152, 1101-1111. [16] Pallares M.E.; Adrover E; Baier CJ et al. Prenatal maternal restraint stress exposure alters the reproductive hormone profile and testis development of the rat male offspring. Stress. 2013, 16, 429-440.

[17] Veldhuis J.D.; Johnson ML. Cluster analysis: a simple, versatile, and robust algorithm for endocrine pulse detection. Am.J.Physiol 1986, 250, E486-E493. [18] Di Giorgio N.P.; Catalano PN; Lopez PV et al. Lack of Functional GABAB Receptors Alters Kiss1 , Gnrh1 and Gad1 mRNA Expression in the Medial Basal Hypothalamus at Postnatal Day 4. Neuroendocrinology 2013, 98, 212-223. [19] Parborell F.; Irusta G; Vitale A et al. Gonadotropin-releasing hormone antagonist antide inhibits apoptosis of preovulatory follicle cells in rat ovary. Biol.Reprod. 2005, 72, 659-666. [20] Ventura C.; Venturino A; Miret N et al. Chlorpyrifos inhibits cell proliferation through ERK1/2 phosphorylation in breast cancer cell lines. Chemosphere 2015, 120, 343-350. [21] Pfaffl M.W. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 2001, 29, e45. [22] National Research Council (US) Subcommittee on Arsenic in Drinking Water. Arsenic in Drinking Water. 1999. [23] Petrusevski B.; Sharma S; Schippers J; Shordt K. Water.

Arsenic

in

Drinking

Thematic Overview Papers 2007, 2-57.

[24] Ali N.; Hoque M; Haque A et al. Association between arsenic exposure and plasma cholinesterase activity: a population based study in Bangladesh. Environ Health 2010, 9, 36. [25] Vahter M. Biotransformation of trivalent and pentavalent inorganic arsenic in mice and rats. Environ.Res. 1981, 25, 286-293. [26] Hopenhayn C.; Ferreccio C; Browning SR et al. Arsenic exposure from drinking water and birth weight. Epidemiology 2003, 14, 593-602.

[27] Rembiesa R.; Marchut M; Warchol A.

Ovarian--placental dependency in rat. I.

Biotransformation of C 21 steroids to androgens by rat placenta in vitro. Steroids 1972, 19, 65-84. [28] Al Bader M.D. Estrogen receptors alpha and beta in rat placenta: detection by RT-PCR, real time PCR and Western blotting. Reprod.Biol.Endocrinol 2006, 4, 13. [29] Myers S.; Lobdell D; Liu Z et al. Maternal drinking water arsenic exposure and perinatal outcomes in inner Mongolia, China. J Epidemiol Community Health 2010, 64, 325-329. [30] He W.; Greenwell RJ; Brooks DM et al. Arsenic exposure in pregnant mice disrupts placental vasculogenesis and causes spontaneous abortion. Toxicol.Sci. 2007, 99, 244253. [31] Ahmad S.A.; Sayed MH; Barua S et al. Arsenic in drinking water and pregnancy outcomes. Environ.Health Perspect. 2001, 109, 629-631. [32] Stoica A.; Pentecost E; Martin MB. Effects of arsenite on estrogen receptor-alpha expression and activity in MCF-7 breast cancer cells. Endocrinology 2000, 141, 35953602. [33] Akram Z.; Jalali S; Shami SA et al.

Genotoxicity of sodium arsenite and DNA

fragmentation in ovarian cells of rat. Toxicol.Lett. 2009, 190, 81-85. [34] Tilly J.L.; Sinclair DA. Germline energetics, aging, and female infertility. Cell Metab 2013, 17, 838-850. [35] Flora S.J. Arsenic-induced oxidative stress and its reversibility. Free Radic.Biol.Med. 2011, 51, 257-281. [36] Ahn R.W.; Barrett SL; Raja MR et al. Nano-encapsulation of arsenic trioxide enhances efficacy against murine lymphoma model while minimizing its impact on ovarian reserve in vitro and in vivo. PLoS.One. 2013, 8, e58491.

[37] Chattopadhyay S.; Ghosh D. Role of dietary GSH in the amelioration of sodium arsenite-induced ovarian and uterine disorders. Reprod.Toxicol. 2010, 30, 481-488. [38] Su J.Y.; Xie QF; Liu WJ et al.

Perimenopause Amelioration of a TCM Recipe

Composed of Radix Astragali, Radix Angelicae Sinensis, and Folium Epimedii: An In Vivo Study on Natural Aging Rat Model. Evid.Based.Complement Alternat.Med. 2013, 2013, 747240. [39] Petrick J.S.; Blachere FM; Selmin O; Lantz RC. Inorganic arsenic as a developmental toxicant: in utero exposure and alterations in the developing rat lungs. Mol Nutr.Food Res. 2009, 53, 583-591. [40] Welsh M.; Saunders PT; Fisken M et al. Identification in rats of a programming window for reproductive tract masculinization, disruption of which leads to hypospadias and cryptorchidism. J Clin.Invest 2008, 118, 1479-1490. [41] Wolf C., Jr.; Lambright C; Mann P et al. Administration of potentially antiandrogenic pesticides (procymidone, linuron, iprodione, chlozolinate, p,p'-DDE, and ketoconazole) and toxic substances (dibutyl- and diethylhexyl phthalate, PCB 169, and ethane dimethane sulphonate) during sexual differentiation produces diverse profiles of reproductive malformations in the male rat. Toxicol.Ind.Health 1999, 15, 94-118. [42] Thankamony A.; Ong KK; Dunger DB; Acerini CL; Hughes IA. Anogenital distance from birth to 2 years: a population study. Environ.Health Perspect. 2009, 117, 17861790. [43] Christiansen S.; Axelstad M; Boberg J et al. Low dose effects of BPA on early sexual development of male and female rats. Reproduction. 2013. [44] Gandhi D.N.; Panchal GM; Patel KG. Developmental and neurobehavioural toxicity study of arsenic on rats following gestational exposure. Indian J Exp.Biol. 2012, 50, 147-155.

[45] Jana K.; Jana S; Samanta PK. Effects of chronic exposure to sodium arsenite on hypothalamo-pituitary-testicular activities in adult rats: possible an estrogenic mode of action. Reprod.Biol.Endocrinol. 2006, 4, 9. [46] Akram Z.; Jalali S; Shami SA et al. Adverse effects of arsenic exposure on uterine function and structure in female rat. Exp.Toxicol.Pathol. 2010, 62, 451-459. [47] Davila-Esqueda M.E.; Jimenez-Capdeville ME; Delgado JM et al. Effects of arsenic exposure during the pre- and postnatal development on the puberty of female offspring. Exp.Toxicol.Pathol. 2012, 64, 25-30. [48] Chattopadhyay S.; Pal GS; Ghosh D; Debnath J. Effect of dietary co-administration of sodium selenite on sodium arsenite-induced ovarian and uterine disorders in mature albino rats. Toxicol.Sci. 2003, 75, 412-422. [49] Chatterjee A.; Chatterji U. Arsenic abrogates the estrogen-signaling pathway in the rat uterus. Reprod.Biol.Endocrinol. 2010, 8, 80. [50] Sarkar M.; Chaudhuri GR; Chattopadhyay A; Biswas NM. Effect of sodium arsenite on spermatogenesis, plasma gonadotrophins and testosterone in rats. Asian J Androl 2003, 5, 27-31.