- Email: [email protected]
Evaluation of the Abbott RealTime™ CT assay with the BD ProbeTec™ ET assay for the detection of Chlamydia trachomatis in a clinical microbiology laboratory
Available online at www.sciencedirect.com
Diagnostic Microbiology and Infectious Disease 64 (2009) 13 – 19 www.elsevier.com/locate/diagmicrobio
Evaluation of the Abbott RealTime™ CT assay with the BD ProbeTec™ ET assay for the detection of Chlamydia trachomatis in a clinical microbiology laboratory☆ Anne Walsh⁎, Fiona O. Rourke, Bairbre Ní Laoi, Brendan Crowley Microbiology Department, St. James's Hospital, James St., Dublin 8, Ireland Received 30 October 2008; accepted 23 January 2009
Abstract The Abbott RealTime™ CT assay (Abbott Molecular, Des Plaines, IL) was evaluated by testing male urine samples (n = 204) and female urine samples (n = 207) with matched endocervical swabs (n = 207) collected from patients attending the Genito-Urinary Infectious Disease Clinic, St. James's Hospital, Dublin, Ireland. Results were compared with the BD ProbeTec™ ET assay (Becton Dickinson, Sparks, MD). Both assays were performed within 3 days of specimen collection. Samples positive with 1 or other assay were subjected to discrepant-based analysis using 2 additional assays, an “in house real-time polymerase chain reaction [PCR]” and a “nested PCR with amplicon sequence detection”. After resolution of discordant results, the Abbott RealTime™ CT assay demonstrated greater clinical sensitivity than the BD ProbeTec™ ET assay for the detection of Chlamydia trachomatis (CT) in all sample types. Both assays demonstrated acceptable analytic sensitivity with detection limits of 22 and 33 cryptic plasmid copies/reaction, respectively. The sensitivity of the Abbott RealTime™ CT assay combined with automated throughput establishes this assay as a quality diagnostic tool. © 2009 Elsevier Inc. All rights reserved. Keywords: C. trachomatis; Abbott RealTime CT assay; Performance characteristics; Throughput
1. Introduction Chlamydia trachomatis (CT) is the most common cause of bacterial sexually transmitted infections and therefore represents a major public health concern with significant financial costs to health services. Control of CT infection is complicated by the “silent nature” of the infection because approximately 75% of women and 50% of men remain asymptomatic, thus forming a large unrecognized reservoir of infected persons (Tavakoli et al., 2002). Women especially endure the clinical sequelae of untreated CT infection; these complications include pelvic inflammatory disease, ectopic pregnancy, and infertility (Manavi, 2006; Ray, 2006). Rapid early detection and treatment of CT-infected individuals and their sexual partners are required to control transmission. At ☆
The findings in this article were presented at ESSTI Collaborative Group Meeting Hotel Phoenicia, Malta, October 8 to 9, 2008, by Anne Walsh. ⁎ Corresponding author. Department of Clinical Microbiology, St. James's Hospital, James St., 8 Dublin, Ireland. Tel.: +353-14162977. E-mail address: [email protected] (A. Walsh). 0732-8893/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2009.01.021
present, there are several nucleic acid amplification tests (NAATs) available for the qualitative detection of CT. These tests are based on the amplification of specific DNA and RNA targets, and all demonstrate high sensitivity, specificity, and reproducibility (Marshall et al., 2007; Martin et al., 2004). The clinical diagnostic laboratory at St. James's Hospital (SJH), Dublin, Ireland, provides a diagnostic service for its Genito-Urinary Infectious Disease Clinic (GUIDE) and general practitioners in the local catchment area. Before this study, screening of specimens was performed using the semi-automated Becton Dickinson (BD) ProbeTec™ ET System (BD ProbeTec assay; BD, Sparks, MD), and positives were confirmed using the Roche COBAS® Amplicor CT Assay (Amplicor assay; Roche Diagnostics, Mannheim, Germany). Because of an increased demand for CT testing combined with decreasing resources within the pathology service, the laboratory required a more automated system. The new automated Conformité Européenne (CE)marked, dual-target Abbott RealTime™ CT Assay (Abbott m2000 assay; Abbott Molecular, Des Plaines, IL) was evaluated by comparing it with the BD ProbeTec assay. The
14
A. Walsh et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 13–19
evaluation assessed the performance characteristics of the Abbott m2000 assay and the ability of the assay to improve laboratory workflow and throughput.
amplification control is optional for PCR inhibition testing. The BD ProbeTec assay uses a 96-microwell tray format in a closed amplification system. 2.2. Abbott m2000 assay
2. Materials and methods Specimens were collected from male and female patients (symptomatic and asymptomatic) attending the GUIDE clinic at SJH (n = 411) for routine diagnostic testing for a 3-month period. Patients were instructed not to urinate for 1 h before collection and to provide 20 to 30 mL of first-void urine (FVU) into a sterile sealed container. Two endocervical swabs and 1 FVU were collected from each female patient (n = 207). The first swab was taken into a BD Culturette Direct kit, so as not to compromise the diagnostic result; the second swab was taken into the Abbott multi-Collect Specimen Collection kit (multi-Collect). One FVU (n = 204) was collected from each male patient. Specimens were refrigerated within 4 h of collection and tested within 3 days. Both female and male urine samples and all endocervical swabs collected in BD Culturette tubes were tested using the BD ProbeTec system. An aliquot of each urine sample (sufficient volume to fall within the clear fill window) was transferred to Abbott multi-Collect tubes and subsequently tested alongside the second endocervical swab using the Abbott m2000 system. All urine and swab samples testing positive using the BD ProbeTec and/or the Abbott m2000 assays were subsequently tested for confirmation using the Amplicor assay. Samples yielding discordant results were resolved using an “in-house real-time polymerase chain reaction [PCR] assay” (in-house assay) and a “nested PCR assay with amplicon sequence detection” (nested PCR). Using this discrepant analysis approach, we defined a result as “true positive” when a positive result was obtained in at least 2 of the 5 assays tested—BD ProbeTec, Abbott m2000, Amplicor, in-house and nested PCR assays. All commercial assays were performed according to the manufacturer's instructions. 2.1. BD ProbeTec assay The BD ProbeTec assay is based on strand displacement amplification technology and real-time homogeneous detection. The assay amplifies a single target region in the CT chromosomal DNA cryptic plasmid and detects both the CT wild-type and the Swedish chlamydial variant (vCT) strains (Little et al., 1999; Ripa and Nilsson, 2007). A separate
The Abbott m2000 System consists of the automated m2000sp for sample preparation and the m2000rt closed platform for simultaneous real-time PCR amplification and detection. The homogenous triplex assay targets 2 separate regions in the CT cryptic plasmid for the detection of wildtype CT and vCT (proprietary sequence). Both hydrolysis probes are labeled with 5′ FAM (6-carboxyfluorescein fluorescent dye); therefore, it is not possible to differentiate the 2 CT strains. An internal control (IC) is added preextraction to each patient sample to monitor the process from extraction through to amplification and detection and to detect potential PCR inhibition. The Abbott m2000 System has a 96-microtiter tray well format, processing 93 samples and 3 controls per run. The numerical result is reported as a decision cycle (DC) value. This is obtained by calculating the mean cycle number (CN) of 2 “cutoff” calibrators, plus the addition of 4.4 cycles (predetermined number) to generate the DC “cutoff” (CO). A sample with a valid cycle number less than or equal to the CO is deemed positive. A sample with a valid CN greater than the CO sample is deemed to be in the “grey zone”. This sample result is termed “beyond the cutoff” (BCO), and the sample must be retested. If this equivocal sample is positive or BCO on retesting, it is considered a true positive. If the equivocal sample is negative on retesting, it is interpreted as a true negative. A sample with no signal is negative. Positive samples are given a numerical DC value ≥0, which corresponds to the difference in CN between the CO and the sample CN. This DC value is proportional to the starting copy number of target DNA. 2.3. In-house assay The in-house assay was designed as a singleplex real-time PCR assay for the detection of CT using the primers and probe as previously described by Pickett et al. (2005) (Table 1). These primers were selected from the cryptic plasmid gene sequence because of the high degree of sequence conservation between CT genotypes. After automated extraction of nucleic acid from clinical samples on the m2000sp, amplification and real-time PCR detection were
Table 1 Nucleic acid sequence of the primer and probes used in the in-house real-time CT PCR and nested PCR assays Primer/probe CT-F CT-R CT-R CT-R1F CT-R1R
Sense Antisense Probe Sense Antisense
Sequence
Reference
5′ CAGCTTGTAGTCCTGCTTGAGAGAG 3′ 5′ CAAGAGTACATCGGTCAACGAAGA 3′ 5′ FAM CCCCACCATTTTTCCGGAGCGA TAMRA 3′ 5′ GCGGGGTTATCTTAAAAGG 3′ 5′ GAGGATTATTATAACTTATCCTCAGAAG 3′
(Pickett et al., 2005) (Pickett et al., 2005) (Pickett et al., 2005) This study This study
FAM = 6-carboxyfluorescein fluorescent dye; TAMRA = tetramethyl-6-carboxyrhodamine dye.
A. Walsh et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 13–19
performed on the ABI Prism® 7500 sequence detection system (Applied Biosystems, Foster City, CA). The final 50-μL PCR reaction mixture contained TaqMan® Universal PCR Mastermix (Applied Biosystems), CT-F, CT-R primer (300 nmol/L), CT-P probe (250 nmol/L), and 20 μL of extracted DNA. Real-time PCR amplification was performed using Universal Thermal Cycling Conditions. The thermal cycling protocol was composed of 2 min at 50 °C (uracil-Nglycosylase activation), 10 min at 95 °C (AmpliTaq Gold® enzyme activation), and 45 cycles of 15 s at 95 °C (denaturation) and 1 min at 60 °C (combined annealing and primer extension). Real-time PCR results are expressed as cycle threshold (Ct) values. The Ct is the PCR cycle at which the sample crosses the threshold level of detection set during the exponential phase of the PCR reaction. A negative specimen and nontemplate control was included in each run. 2.4. Nested PCR assay Primers for round 1 PCR (CT-R1F, CT-R1R) were designed external to the primers described by Pickett (Table 1) using Primer3 software (Rozen and Skaletsky et al., 1998). The CT primers of Pickett were used for round 2 PCR (CT-F, CT-R) (Pickett et al., 2005). The template DNA extracted on the m2000sp was amplified using the HotStar Hi Fidelity Polymerase kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions, using the GeneAmp® PCR System 9700 thermal cycler (Applied Biosystems). Each reaction contained 20 μL of extracted DNA on round 1 and 10 μL DNA on round 2 in a final volume of 50 μL. A negative specimen and nontemplate control was included in each run. The amplified products were electrophoresed through a 2% agarose gel containing ethidium bromide and visualized using ultraviolet illumination. The cryptic plasmid nested PCR primer sets were designed to generate a 185-bp product. The specific PCR products were purified using the QIAquick® PCR Purification kit (QIAGEN, Hilden, Germany). Purified products were sequenced using 10 μmol/L of each corresponding round 2 primer and BigDye terminator v3.1 Cycle Sequencing kit (Applied Biosystems) according to the manufacturer's instructions. Automated DNA sequencing was performed on the ABI Prism® 3130xl DNA analyzer (Applied Biosystems). Sequence analysis was carried out using DNASTAR® Lasergene (DNASTAR, Madison, WI). A consensus sequence was assembled and edited using SeqMan sequence analysis software. The BLAST N sequence alignment tool
15
was used to confirm the identification by comparing sequence homology in the GenBank (Altschul et al., 1997). 2.5. Assay performance 2.5.1. Analytic sensitivity The limits of detection (LODs) of the Abbott m2000, BD ProbeTec, and in-house PCR assays were determined by analyzing in duplicate 3 pre-sample preparation dilution series of CT quantitated DNA control (Autogen Bioclear, Wiltshire, UK), covering a range from 5.5 to 700 cryptic plasmid copies/reaction (50-μL PCR reaction). The LOD was defined as the lowest concentration to give a reproducible positive result. A Quality Control for Molecular Diagnostics (QCMD) CT DNA 08A Proficiency Panel consisting of 8 vials containing various quantitated freeze-dried positive samples and 2 vials containing freeze-dried negative samples were analyzed using the Abbott m2000, BD ProbeTec, and inhouse PCR assays. The concentrations of CT in the QCMD panel ranged from 6 to 5700 CT copies /vial. QCMD samples were tested in accordance with QCMD instructions. 2.5.2. CT clinical trial The performance of the BD ProbeTec and Abbott m2000 assays were analyzed using samples from patients attending the GUIDE clinic at SJH (n = 411). This involved testing male urine samples (n = 204), female urine samples (n = 207), and paired endocervical swabs (n = 207) on both diagnostic systems. Statistical analysis was performed on the results. The performance of the in-house assay was also validated using 24 clinical samples consisting of negative samples (n = 10), weak positive samples with DC b 2.0 (n = 11), and positive samples with DC N 2.0 (n = 3). One vCT positive sample was analyzed using the Abbott m2000, BD ProbeTec, and in-house PCR assays. A workflow analysis of the Abbott m2000 was conducted during the clinical trial.
3. Results 3.1. Analytic sensitivity Using 3 dilution series of a CT quantitated DNA control (Autogen Bioclear) ranging from 5.5 to 700 cryptic plasmid copies/reaction, the Abbott m2000 and in-house assay demonstrated an LOD of 22 copies/reaction, whereas the
Table 2 Analytic sensitivity results of 3 dilution series using the Abbott m2000, BD ProbeTec, and in-house assays Dilution series (presample preparation)
Range plasmid copies/reaction
No. of dilutions per series
BD ProbeTec assay LOD
Abbott m2000 assay LOD
In-house assay LOD
1 2 3
5.5–99 25–300 40–700
10 7 5
33 50 40
22 25 40
22 25 40
16
A. Walsh et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 13–19
Table 3 QCMD CT DNA 08A proficiency panel results using the Abbott m2000, BD ProbeTec, and in-house assays QCMD 2008
QCMD CT result
Abbott m2000 assay
BD ProbeTec assay
In-house assay
CT
Cop/vial
Log cop/vial
CT
CT DC
CT
MOTA
CT
CT Ct
CTA08-01 CTA08-02 CTA08-03 CTA08-04 CTA08-05 CTA08-06 CTA08-07 CTA08-08 CTA08-09 CTA08-10
Pos Wk pos Pos Wk pos Neg Pos Wk pos Neg Pos Pos
570 6 5700 57
2.7 0.78 3.7 1.7
0.54
570 57
2.7 1.7
5700 57
3.7 1.7
Pos Neg Pos Pos Neg Pos Pos Neg Pos Pos
Pos Neg Pos Pos Neg Pos Neg Neg Pos Pos
15K Neg 55K 9K Neg 14K Neg Neg 34K 42K
Pos Neg Pos Pos Neg Pos Pos Neg Pos Pos
36 Neg 31 41 Neg 35 37 Neg 27 34
4.56 BCO/BCO 1.78 BCO/BCO 8.42 197
Cop = copies; MOTA = Method Other Than Acceleration; Pos = positive; Wk pos = weak positive; Neg = negative.
LOD for the BD ProbeTec assay was 33 copies/reaction (Table 2). The BD ProbeTec, Abbott m2000, and in-house assay failed to detect QCMD CTA-02 with 6 CT copies/vial. The BD ProbeTec assay also failed to detect the urine sample 7 with 57 CT copies/vial (Table 3). 3.2. Clinical trial A total of 618 clinical samples from 411 patients were analyzed. An overview of the sample results using the BD ProbeTec and Abbott m2000 assays is shown in Table 4. No inhibition was detected in either assay. Seven clinical samples (2 male urine, 4 endocervical swabs, and 1 female urine) tested negative using the BD ProbeTec and positive using the Abbott m2000 (Table 5). Five of the samples gave DC values b2.0, and 2 samples were BCO on initial and repeat testing, suggesting that these samples had a very low chlamydial load. Of the 2 male urine samples, 1 of the samples tested positive using the Amplicor and was therefore considered a true positive. The remaining 6 samples were further analyzed using the in-house assay. Two of the 6 samples tested positive using the in-house assay and were therefore considered true positives. Of the remaining 4 samples, 1 male urine sample and 2 endocervical swabs were further analyzed using nested PCR and automated DNA
Table 4 Overview of the results obtained with BD ProbeTec and Abbott m2000 from a total of 618 clinical samples: male urine samples (n = 204), female urine samples (n = 207), and paired endocervical swab (n = 207) BD ProbeTec assay
Abbott m2000 assay
Male urine Total Endocervical swab Total Female urine Total
Positive Negative Positive Negative Positive Negative
Positive
Negative
Total
24 0 24 28 0 28 26 0 26
2 178 180 4 175 179 1 180 181
26 178 204 32 175 207 27 180 207
sequencing. A BLAST N search demonstrated sequence homology with maximum identity to numerous CT cryptic plasmid sequences in the GenBank database. The sample volume of the remaining swab was insufficient to perform nested PCR. The sensitivity and 95% confidence intervals (CIs), specificity, and positive and negative predictive values of the Abbott m2000 and BD ProbeTec assays were calculated for each specimen type (Table 6). These performance characteristics were calculated on the basis that the 1 unresolved discrepant swab result was not included in the statistics. For the in-house validation, a total of 24 clinical samples were analyzed. Ten samples, which tested negative using the Abbott m2000, also tested negative using the inhouse assay. Of 2 samples that were deemed to be BCO (grey zone) using the Abbott m2000, 1 sample was not detected using the in-house assay. The remaining 12 Abbott m2000 positive samples gave concordant results when tested using the in-house assay. The detection rates of endocervical swabs and female urine samples were also analyzed. Of the 207 endocervical swabs and matched female urine samples, 31 endocervical swabs and 27 female urine samples were confirmed positives using the Abbott m2000 (Table 4, 1 swab was insufficient and could not be confirmed a true positive). A total of 5 patients were swab+/urine−, and 1 patient was urine+/swab −, giving a total of 32 positive patients. These 6 discrepant CT positive samples had very low chlamydial loads with DC values of BCO—1.05. The rate of detection of CT infection testing endocervical swabs was 96.8% (31/32) by comparison with a detection rate of 84% (27/32) for female urine. The single vCT positive extract was detected using the BD ProbeTec, Abbott m2000, and in-house assay. 3.3. Workflow analysis The total time required to test 1 batch of specimens (93 samples and 3 controls) was 6 h and 20 min, with a hands-on time of 1 h and 15 min. Two batches of samples may be processed in 8 h with an estimated 2 h of hands-on time (Table 7). However, results from the 2nd batch of
A. Walsh et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 13–19
17
Table 5 Comparison of the results obtained using the BD ProbeTec, Abbott m2000, Amplicor, and in-house and nested PCR assays for samples showing discordant results Specimen type
Male urine Endocervical swab Female urine Male urine Endocervical swab Endocervical swab Endocervical swab
Assays results BD ProbeTec
Abbott m2000
Amplicor
In-house
Nested PCR
Negative Negative Negative Negative Negative Negative Negative
Positive (DC 1.9) Positive (BCO, BCO) Positive (DC 0.11) Positive (DC 0.04) Positive (BCO, BCO) Positive (DC 0.14) Positive (DC 0.56)
Positive Negative Negative Negative Negative Negative Negative
N/T Positive Positive Negative Negative Negative Negative
N/T N/T N/T Positive Positive Positive Insufficient
N/T = not tested; DC = Decision cycle; BCO = Beyond the cutoff.
samples will not be available for reporting until the following day.
4. Discussion The diagnosis of chlamydial genital infections has been greatly enhanced by the introduction of NAATs, providing a dramatic improvement in assay sensitivity and specificity (Chernesky et al., 2006; Gaydos et al., 2004). Because of increasing workloads and the requirement of greater throughput in our laboratory, we evaluated the newly revised, automated, real-time PCR Abbott m2000 assay. This study confirmed that the sensitivity and specificity of the Abbott m2000 was satisfactory, and consequently, the assay is currently in use in our laboratory. Although the BD ProbeTec and Abbott m2000 assays demonstrated adequate analytic sensitivity, the study demonstrates that the BD ProbeTec assay was 3.7% to 9.7% less sensitive than the Abbott m2000 depending on the specimen type. The sensitivity of the BD assay for male urine, endocervical swabs, and female urine was estimated to be 92.3%, 90.3%, and 96.3%, respectively, whereas the sensitivity of the Abbott m2000 assay testing the same specimen types was 100%. However, because the 95% CI of the sensitivity values for both assays overlap, there is little evidence to support the difference in the assay sensitivities. More positive specimens would need to be tested to confirm these findings. Another factor that could bias assay
sensitivity is the variation in the quality of the specimen. However, in this study, sampling error is unlikely to be a factor because the endocervical swabs tested using the BD Probe Tec assay were the first to be collected. In addition, because PCR inhibitors were not detected in either assay, the quality of both specimens was assured. The limit of detection of the Abbott m2000 as determined by testing the 3 dilution series was estimated to be 22 cryptic plasmid copies/reaction and is comparable with the study by Marshall et al. (2007), which demonstrated an analytic sensitivity of 20 plasmid copies/PCR reaction using the Abbott m2000 assay, equivalent to the detection of 2 elementary bodies (EBs). The BD ProbeTec assay achieved a detection limit of 33 cryptic plasmid copies/reaction; this is slightly lower than the Abbott m2000 assay, but the difference in these levels of detection equates to approximately 3 and 5 organisms (EBs) and is clinically insignificant. Regarding QCMD, the Abbott m2000 failed to detect QCMD CTA-02 with 6 CT copies/vial. Analysis of the QCMD final report indicated that of the total number of laboratories (n = 43) using commercial real-time PCR technologies, only 9.3% (n = 4) were successful in detecting QCMD sample 2. The overall results obtained using the QCMD panel demonstrated that the Abbott m2000 and the in-house assays were able to detect a lower CT copy number and were therefore shown to be more sensitive than the BD ProbeTec assay. Both the BD ProbeTec and the Abbott m2000 assays displayed 100% specificity. No false positives were found in this study, which reflects “good laboratory
Table 6 Comparison of the results from clinical sample using the Abbott m2000 and BD ProbeTec assay (sensitivity, 95% CIs, specificity, and positive and negative predictive value) Specimen type
Assay type
Sensitivity (%)
Specificity (%)
Positive predictive value (%)
Negative predictive value (%)
Male urine
BD ProbeTec Abbott m2000 BD ProbeTec Abbott m2000 BD ProbeTec Abbott m2000
92.3 (74.8–99.0) 100 (86.7–100) 90.3 (74.2–97.9) 100 (88.78–100) 96.3 (81.03–99.91) 100 (87.2–100)
100 100 100 100 100 100
100 100 100 100 100 100
98.8 100 98.3 100 99.4 100
Endocervical swab Female urine 95% CIs in parenthesis.
18
A. Walsh et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 13–19
Table 7 A breakdown of the time required to process samples using the Abbott RealTime™ CT assay
Step 1. Daily maintenance of m2000sp, vortexing and loading of batch 1 samples, preparation and loading of batch 1 reagents. Step 2. Extraction and PCR setup of batch 1 samples, recapping of batch 1 samples, replacement of tips and preparation of batch 2 reagents. Step 3. Transfer of batch 1 to m2000rt for amplification and detection, loading batch 2 samples and reagents on m2000sp. Step 4. Extraction and PCR setup of batch 2 samples, recapping of batch 2 samples, replacement of tips. Step 5. Transfer of batch 2 to m2000rt for amplification and detection. m2000sp = Abbott m2000 sample preparation instrument. m2000rt = Abbott m2000 real-time PCR instrument.
practice” and the improved design of assays and analytic platforms that reduce the risk of cross-contamination. No inhibitors were detected using the Abbott m2000 assay as determined by the inclusion of IC; however, earlier poster presentations have described inhibition rates of 0.6% to 1.5% when testing urine samples using the Abbott m2000 (Persson 2006; Luijt and Schirm, 2007). Previous studies have shown that the Abbott m2000 performed well when compared with the other commonly used NAATs. Levett et al. (2008) compared the GenProbe Aptima Combo 2 (Tigress), BD ProbeTec (Viper platform), and Abbott CT/NG assay (m2000) and estimated the sensitivities and specificities to range from 95.8% to 100% and 99.5% to 100%, respectively. A study by Marshall et al. (2007) found an overall agreement of 98.8% and 98.6% with swab and urine samples tested using the Abbott m2000 and BD ProbeTec assays and concluded that the Abbott m2000 demonstrated satisfactory analytic and clinical performance. Marshall et al. (2007) also reported that the Abbott m2000 assay also demonstrated good reproducibility. This study also found that the endocervical swab was the specimen of choice for increased diagnosis of CT infection in females and demonstrated a lower rate of detection of 12.8% in the female urine by comparison with the endocervical swabs. However, it must be acknowledged that the number of samples tested in this study is limited, and further validation is required to substantiate this difference. This finding is similar to that of Marshall et al. (2007) who found
that female urine gave a N10% lower sensitivity rate than cervical swabs. A further study using real-time quantitative PCR and estimating chlamydial loads at matched anatomic sites found that the mean chlamydial load in 73 CT-infected women were 2231 EBs/100 μL for endocervical swabs and 47 EBs /100 μL for FVU (Claude-Edouard et al., 2007). Clinicians and other sexual health workers must be aware of this limitation when interpreting results. Detection of the vCT strain in this study, CE mark certification for the newly revised Abbott RealTime™ CT assay for detection of new vCT (January 2008), and published reports from Sweden provide evidence that the Abbott m2000 assay is capable of detecting the vCT (Lynagh et al., 2007; Schirm and Ripa, 2007). However, it should be noted that the Abbott m2000 PCR-based prototype assay developed by Abbott Molecular and evaluated in the study by Marshall et al. (2007) was unable to detect the vCT strain. The discrepant analysis approach was used to resolve discordant results obtained using the Abbott m2000 and BD ProbeTec assays. This method of comparison is not ideal and introduces bias when defining specimen status. However, in the absence of a “gold standard” reference method, difficulties arise in the interpretation of performance characteristics when evaluating assays, with newer and more sensitive assays proving even more difficult to interpret (Schachter et al., 2005; Skidmore et al., 2006). It was hoped that the sensitivity of one of the assays used for discrepant analysis would have given sufficient sensitivity to allow its use as a confirmatory assay. The results of this study show that neither the Amplicor assay nor the in-house assay has a higher sensitivity than the Abbott m2000 assay, and furthermore, the Amplicor assay is unsuitable because it does not detect the vCT. The use of one of these assays would also have fulfilled the requirement to use a different molecular target for confirmation of positive samples, consistent with Center for Disease Control and Prevention guidelines (Johnson et al., 2002), because the patient cohorts routinely tested at SJH include low prevalence populations. Because this is not possible, positive samples are currently confirmed by repeat testing (including sample reextraction) on the Abbott m2000 assay, in accordance with the Health Protection Agency, UK, minimum testing algorithm for detection of CT using NAATs. The nested PCR assay, although sufficiently sensitive, is laborious and could be reserved for resolving major discrepancies. The increasing demand for CT testing requires the use of an automated high-throughput assay. Using the Abbott m2000 assay, it is possible to process 2 batches of 96 samples per 8-h shift; this equates to approximately 2 h hands-on time and 6 h walk-away time. A further reduction in hands-on time will be achieved when the lengthy job of removing and replacing caps before and after testing is avoided with the introduction of the pierceable sealed multi-Collect tube cap (except if positive specimens are retained and frozen). The Abbott m2000 assay thus combines high throughput with minimal labor and supports a procedure that is easily learned, but as with all molecular assays, care must be taken to avoid
A. Walsh et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 13–19
the risk of contamination. Based on the current CT workload, the new fully automated Abbott m2000 assay has cost implications for our laboratory; however, these are negated by the high throughput. Although not investigated in this study, the Abbott m2000 System offers a combined assay that permits the simultaneous detection of CT and Neisseria gonorrhoeae (NG) (Abbott RealTime™ CT/NG assay). Numerous studies have shown that NAATs offer significantly increased detection rates for NG (Geraats-Peters et al., 2005; Levett et al., 2008; Whiley and Sloots, 2005). These improved rates of detection may be of particular importance in the detection of NG from pharyngeal swabs where lower bacterial loads are observed (Palmer et al., 2003; Page-Shafter et al., 2002) In summary, the study results show that the Abbott m2000 assay is a highly sensitive and specific assay for the detection of CT. This study also indicates that identification of CT infection in women is best achieved by testing cervical swabs and not urine samples. Other attributes include high throughput and the ease of interpretation of results. We recommend the use of the Abbott m2000 as a clinical diagnostic assay. Acknowledgments The authors would like to thank Abbott for supplying the Abbott RealTime™ CT Assay kits at an evaluation rate. They also thank Ms Yvonne Lynagh for testing and sequencing the vCT. References Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhnag Z, Miller W, Lipman DL (1997) Gapped BLAST and PSI-Blast: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402. Chernesky M, Jang D, Luinstra K, Chong S, Smieja M, Cai W, Hayhoe B, Portillo E, Maccritchie C, Main C, Ewert R (2006) High analytical sensitivity and low rates of inhibition may contribute to detection of Chlamydia trachomatis in significantly more women by the APTIMA Combo 2 assay. J Clin Microbiol 44:400–405. Claude-Edouard MC, Sonnex MC, Carne CA, White JA, Magbanua JPV, Nadala Jr ECB, Lee HH (2007) Chlamydia trachomatis load at matched anatomic sites: implications for screening strategies. J Clin Microbiol 45:1395–1402. Gaydos CA, Theodore M, Dalesio N, Wood BJ, Qiunn TC (2004) Comparison of three nucleic acid amplification tests for detection of Chlamydia trachomatis in urine specimens. J Clin Microbiol 42:3041–3045. Geraats-Peters CWM, Brouwers M, Schneeberger PM, van der Zanden AGM, Bruisten SM, Weers-Pothoff G, Boel CHE, van der Brule AJC, Harmsen HG, Hermans MHA (2005) Specific and sensitive detection of Neisseria gonorrhoeae in clinical specimens by real-time PCR. J Clin Microbiol 43:5653–5659. Johnson R E, Newhall W J, Papp J R, Knapp J S, Black C M, Gift T L, Steece R, Markowitz L E, Devine O J, Walsh C M, Wang S, Gunter D C, Irwin K L, DeLisle S, Berman S M. (2002) Screening tests to detect Chlamydia trachomatis and Neisseria gonorrhoeae infections. Morb Mortal Wkly Rep Recomm Rep 51:1–38;CE1–CE4. Levett PN, Brandt K, Olenius K, Brown C, Montgomery K, Horsman GB (2008) Evaluation of three automated nucleic acid amplification systems
19
for detection of Chlamydia trachomatis and Neisseria gonorrhoeae in first-void urine specimens. J Clin Microbiol 46:2109–2111. Little MC, Andrews J, Moore R, Bustos S, Jones L, Embres C, Durmowicz G, Harris J, Berger D, Yanson K, Rostkowski C, Yursis D, Price J, Fort T, Walters A, Collis M, Llorin O, Wood J, Failing F, O'Keefe C, Scrivens B, Pope B, Hansen T, Marino K, Williams K, Boenisch M (1999) BD ProbeTec ET. Clin Chem 45:777–784. Luijt DS, Schirm J (2007) Evaluation of the Abbott m2000 sp/rt real-time PCR Chlamydia trachomatis and Neisseria gonorrhoeae assays using urine samples, and comparison with the Roche COBAS Amplicor Chlamydia trachomatis and Neisseria gonorrhoeae PCR tests. Poster session II: 17th ECCMID Munich Germany. Lynagh Y, Crowley B, Walsh A (2007) Investigation to determine if newlydiscovered variant of Chlamydia trachomatis is present in Ireland. Euro Surveill 12:E070201.2. Manavi M (2006) A review on infection with Chlamydia trachomatis. Best Pract Res Clin Obstet Gynaecol 20:941–951. Marshall R, Chernesky M, Jang D, Hook EW, Cartwright CP, HowellAdams B, Ho S, Welk J, Lai-Zhang J, Brashear J, Diedrich JB, Otis K, Webb E, Robinson J, Yu H (2007) Characteristics of the m2000 automated sample preparation and multiplex real-time PCR system for detection of Chlamydia trachomatis and Neisseria gonorrhoeae. J Clin Microbiol 45:747–751. Martin DH, Nsuami M, Schachter J, Hook III EW, Ferrero D, Quinn TC, Gaydos C (2004) Use of multiple nucleic acid amplification tests to define the infected-patient “gold standard” in clinical trials of new diagnostic tests for Chlamydia trachomatis infections. J Clin Microbiol 42:4749–4758. Page-Shafter K, Graves A, Kent C, Balls JE, Zapitz VM, Klausner JD (2002) Increased sensitivity of DNA amplification testing for the detection of pharyngeal gonorrhoea in men who have sex with men. Clin Infect Dis 34:173–176. Pa mer H, Mallinson H, Wood RL (2003) Evaluation of the specificities of five DNA amplification methods for the detection of Neisseria gonorrhoeae. J Clin Microbiol 41:835–837. Persson K (2006) Clinical comparison of the m2000 system (Abbott) and the Cobas Amplicor (Roche) for the diagnosis of Chlamydia trachomatis in urine samples. Poster presentation IUSTI, Paris. Pickett MA, Everson JS, Pead PJ, Clarke IN (2005) The plasmids of Chlamydia trachomatis and Chlamydia pneumoniae (N16): accurate determination of copy number and the paradoxical effect of plasmidcuring agents. Microbiology 151:893–903. Ray K (2006) Chlamydia trachomatis and infertility. Indian J Med Res 123: 730–734. Ripa T, Nilsson PA (2007) A Chlamydia trachomatis strain with a 377-bp deletion in the cryptic plasmid causing false-negative nucleic acid amplification tests. Sex Transm Dis 34:255–256. Rozen S, Skaletsky HJ (1998) Primer3. Available from http://primer3. sourceforge.net. Schachter J, Hook EW, Martin DH, Willis D, Fine P, Fuller D, Jordan J, Janda WM, Chernesky M (2005) Confirming positive results of nucleic acid amplification tests (NAATs) for Chlamydia trachomatis: all NAATs are not created equal. J Clin Microbiol 43:1372–1373. Schirm J, Ripa T (2007) Real-time PCR assays for the detection of gonorrhoea and of wild type and mutant chlamydia. Hosp Healthc Eur [2007/8]. Skidmore S, Horner P, Mallinson H (2006) Testing specimens for Chlamydia trachomatis. Sex Transm Infec) 82(4):272–275. Tavakoli M, Craig AM, Malek M (2002) An econometric analysis of screening and treatment of patients with suspected Chlamydia trachomatis. Health Care Manag Sci 5:33–39. Whiley DM, Sloots TP (2005) Comparison of three in-house multiplex PCR assays for the detection of Neisseria gonorrhoeae and Chlamydia trachomatis using real-time and conventional detection methodologies. Pathology 37:364–370.
Diagnostic Microbiology and Infectious Disease 64 (2009) 13 – 19 www.elsevier.com/locate/diagmicrobio
Evaluation of the Abbott RealTime™ CT assay with the BD ProbeTec™ ET assay for the detection of Chlamydia trachomatis in a clinical microbiology laboratory☆ Anne Walsh⁎, Fiona O. Rourke, Bairbre Ní Laoi, Brendan Crowley Microbiology Department, St. James's Hospital, James St., Dublin 8, Ireland Received 30 October 2008; accepted 23 January 2009
Abstract The Abbott RealTime™ CT assay (Abbott Molecular, Des Plaines, IL) was evaluated by testing male urine samples (n = 204) and female urine samples (n = 207) with matched endocervical swabs (n = 207) collected from patients attending the Genito-Urinary Infectious Disease Clinic, St. James's Hospital, Dublin, Ireland. Results were compared with the BD ProbeTec™ ET assay (Becton Dickinson, Sparks, MD). Both assays were performed within 3 days of specimen collection. Samples positive with 1 or other assay were subjected to discrepant-based analysis using 2 additional assays, an “in house real-time polymerase chain reaction [PCR]” and a “nested PCR with amplicon sequence detection”. After resolution of discordant results, the Abbott RealTime™ CT assay demonstrated greater clinical sensitivity than the BD ProbeTec™ ET assay for the detection of Chlamydia trachomatis (CT) in all sample types. Both assays demonstrated acceptable analytic sensitivity with detection limits of 22 and 33 cryptic plasmid copies/reaction, respectively. The sensitivity of the Abbott RealTime™ CT assay combined with automated throughput establishes this assay as a quality diagnostic tool. © 2009 Elsevier Inc. All rights reserved. Keywords: C. trachomatis; Abbott RealTime CT assay; Performance characteristics; Throughput
1. Introduction Chlamydia trachomatis (CT) is the most common cause of bacterial sexually transmitted infections and therefore represents a major public health concern with significant financial costs to health services. Control of CT infection is complicated by the “silent nature” of the infection because approximately 75% of women and 50% of men remain asymptomatic, thus forming a large unrecognized reservoir of infected persons (Tavakoli et al., 2002). Women especially endure the clinical sequelae of untreated CT infection; these complications include pelvic inflammatory disease, ectopic pregnancy, and infertility (Manavi, 2006; Ray, 2006). Rapid early detection and treatment of CT-infected individuals and their sexual partners are required to control transmission. At ☆
The findings in this article were presented at ESSTI Collaborative Group Meeting Hotel Phoenicia, Malta, October 8 to 9, 2008, by Anne Walsh. ⁎ Corresponding author. Department of Clinical Microbiology, St. James's Hospital, James St., 8 Dublin, Ireland. Tel.: +353-14162977. E-mail address: [email protected] (A. Walsh). 0732-8893/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2009.01.021
present, there are several nucleic acid amplification tests (NAATs) available for the qualitative detection of CT. These tests are based on the amplification of specific DNA and RNA targets, and all demonstrate high sensitivity, specificity, and reproducibility (Marshall et al., 2007; Martin et al., 2004). The clinical diagnostic laboratory at St. James's Hospital (SJH), Dublin, Ireland, provides a diagnostic service for its Genito-Urinary Infectious Disease Clinic (GUIDE) and general practitioners in the local catchment area. Before this study, screening of specimens was performed using the semi-automated Becton Dickinson (BD) ProbeTec™ ET System (BD ProbeTec assay; BD, Sparks, MD), and positives were confirmed using the Roche COBAS® Amplicor CT Assay (Amplicor assay; Roche Diagnostics, Mannheim, Germany). Because of an increased demand for CT testing combined with decreasing resources within the pathology service, the laboratory required a more automated system. The new automated Conformité Européenne (CE)marked, dual-target Abbott RealTime™ CT Assay (Abbott m2000 assay; Abbott Molecular, Des Plaines, IL) was evaluated by comparing it with the BD ProbeTec assay. The
14
A. Walsh et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 13–19
evaluation assessed the performance characteristics of the Abbott m2000 assay and the ability of the assay to improve laboratory workflow and throughput.
amplification control is optional for PCR inhibition testing. The BD ProbeTec assay uses a 96-microwell tray format in a closed amplification system. 2.2. Abbott m2000 assay
2. Materials and methods Specimens were collected from male and female patients (symptomatic and asymptomatic) attending the GUIDE clinic at SJH (n = 411) for routine diagnostic testing for a 3-month period. Patients were instructed not to urinate for 1 h before collection and to provide 20 to 30 mL of first-void urine (FVU) into a sterile sealed container. Two endocervical swabs and 1 FVU were collected from each female patient (n = 207). The first swab was taken into a BD Culturette Direct kit, so as not to compromise the diagnostic result; the second swab was taken into the Abbott multi-Collect Specimen Collection kit (multi-Collect). One FVU (n = 204) was collected from each male patient. Specimens were refrigerated within 4 h of collection and tested within 3 days. Both female and male urine samples and all endocervical swabs collected in BD Culturette tubes were tested using the BD ProbeTec system. An aliquot of each urine sample (sufficient volume to fall within the clear fill window) was transferred to Abbott multi-Collect tubes and subsequently tested alongside the second endocervical swab using the Abbott m2000 system. All urine and swab samples testing positive using the BD ProbeTec and/or the Abbott m2000 assays were subsequently tested for confirmation using the Amplicor assay. Samples yielding discordant results were resolved using an “in-house real-time polymerase chain reaction [PCR] assay” (in-house assay) and a “nested PCR assay with amplicon sequence detection” (nested PCR). Using this discrepant analysis approach, we defined a result as “true positive” when a positive result was obtained in at least 2 of the 5 assays tested—BD ProbeTec, Abbott m2000, Amplicor, in-house and nested PCR assays. All commercial assays were performed according to the manufacturer's instructions. 2.1. BD ProbeTec assay The BD ProbeTec assay is based on strand displacement amplification technology and real-time homogeneous detection. The assay amplifies a single target region in the CT chromosomal DNA cryptic plasmid and detects both the CT wild-type and the Swedish chlamydial variant (vCT) strains (Little et al., 1999; Ripa and Nilsson, 2007). A separate
The Abbott m2000 System consists of the automated m2000sp for sample preparation and the m2000rt closed platform for simultaneous real-time PCR amplification and detection. The homogenous triplex assay targets 2 separate regions in the CT cryptic plasmid for the detection of wildtype CT and vCT (proprietary sequence). Both hydrolysis probes are labeled with 5′ FAM (6-carboxyfluorescein fluorescent dye); therefore, it is not possible to differentiate the 2 CT strains. An internal control (IC) is added preextraction to each patient sample to monitor the process from extraction through to amplification and detection and to detect potential PCR inhibition. The Abbott m2000 System has a 96-microtiter tray well format, processing 93 samples and 3 controls per run. The numerical result is reported as a decision cycle (DC) value. This is obtained by calculating the mean cycle number (CN) of 2 “cutoff” calibrators, plus the addition of 4.4 cycles (predetermined number) to generate the DC “cutoff” (CO). A sample with a valid cycle number less than or equal to the CO is deemed positive. A sample with a valid CN greater than the CO sample is deemed to be in the “grey zone”. This sample result is termed “beyond the cutoff” (BCO), and the sample must be retested. If this equivocal sample is positive or BCO on retesting, it is considered a true positive. If the equivocal sample is negative on retesting, it is interpreted as a true negative. A sample with no signal is negative. Positive samples are given a numerical DC value ≥0, which corresponds to the difference in CN between the CO and the sample CN. This DC value is proportional to the starting copy number of target DNA. 2.3. In-house assay The in-house assay was designed as a singleplex real-time PCR assay for the detection of CT using the primers and probe as previously described by Pickett et al. (2005) (Table 1). These primers were selected from the cryptic plasmid gene sequence because of the high degree of sequence conservation between CT genotypes. After automated extraction of nucleic acid from clinical samples on the m2000sp, amplification and real-time PCR detection were
Table 1 Nucleic acid sequence of the primer and probes used in the in-house real-time CT PCR and nested PCR assays Primer/probe CT-F CT-R CT-R CT-R1F CT-R1R
Sense Antisense Probe Sense Antisense
Sequence
Reference
5′ CAGCTTGTAGTCCTGCTTGAGAGAG 3′ 5′ CAAGAGTACATCGGTCAACGAAGA 3′ 5′ FAM CCCCACCATTTTTCCGGAGCGA TAMRA 3′ 5′ GCGGGGTTATCTTAAAAGG 3′ 5′ GAGGATTATTATAACTTATCCTCAGAAG 3′
(Pickett et al., 2005) (Pickett et al., 2005) (Pickett et al., 2005) This study This study
FAM = 6-carboxyfluorescein fluorescent dye; TAMRA = tetramethyl-6-carboxyrhodamine dye.
A. Walsh et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 13–19
performed on the ABI Prism® 7500 sequence detection system (Applied Biosystems, Foster City, CA). The final 50-μL PCR reaction mixture contained TaqMan® Universal PCR Mastermix (Applied Biosystems), CT-F, CT-R primer (300 nmol/L), CT-P probe (250 nmol/L), and 20 μL of extracted DNA. Real-time PCR amplification was performed using Universal Thermal Cycling Conditions. The thermal cycling protocol was composed of 2 min at 50 °C (uracil-Nglycosylase activation), 10 min at 95 °C (AmpliTaq Gold® enzyme activation), and 45 cycles of 15 s at 95 °C (denaturation) and 1 min at 60 °C (combined annealing and primer extension). Real-time PCR results are expressed as cycle threshold (Ct) values. The Ct is the PCR cycle at which the sample crosses the threshold level of detection set during the exponential phase of the PCR reaction. A negative specimen and nontemplate control was included in each run. 2.4. Nested PCR assay Primers for round 1 PCR (CT-R1F, CT-R1R) were designed external to the primers described by Pickett (Table 1) using Primer3 software (Rozen and Skaletsky et al., 1998). The CT primers of Pickett were used for round 2 PCR (CT-F, CT-R) (Pickett et al., 2005). The template DNA extracted on the m2000sp was amplified using the HotStar Hi Fidelity Polymerase kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions, using the GeneAmp® PCR System 9700 thermal cycler (Applied Biosystems). Each reaction contained 20 μL of extracted DNA on round 1 and 10 μL DNA on round 2 in a final volume of 50 μL. A negative specimen and nontemplate control was included in each run. The amplified products were electrophoresed through a 2% agarose gel containing ethidium bromide and visualized using ultraviolet illumination. The cryptic plasmid nested PCR primer sets were designed to generate a 185-bp product. The specific PCR products were purified using the QIAquick® PCR Purification kit (QIAGEN, Hilden, Germany). Purified products were sequenced using 10 μmol/L of each corresponding round 2 primer and BigDye terminator v3.1 Cycle Sequencing kit (Applied Biosystems) according to the manufacturer's instructions. Automated DNA sequencing was performed on the ABI Prism® 3130xl DNA analyzer (Applied Biosystems). Sequence analysis was carried out using DNASTAR® Lasergene (DNASTAR, Madison, WI). A consensus sequence was assembled and edited using SeqMan sequence analysis software. The BLAST N sequence alignment tool
15
was used to confirm the identification by comparing sequence homology in the GenBank (Altschul et al., 1997). 2.5. Assay performance 2.5.1. Analytic sensitivity The limits of detection (LODs) of the Abbott m2000, BD ProbeTec, and in-house PCR assays were determined by analyzing in duplicate 3 pre-sample preparation dilution series of CT quantitated DNA control (Autogen Bioclear, Wiltshire, UK), covering a range from 5.5 to 700 cryptic plasmid copies/reaction (50-μL PCR reaction). The LOD was defined as the lowest concentration to give a reproducible positive result. A Quality Control for Molecular Diagnostics (QCMD) CT DNA 08A Proficiency Panel consisting of 8 vials containing various quantitated freeze-dried positive samples and 2 vials containing freeze-dried negative samples were analyzed using the Abbott m2000, BD ProbeTec, and inhouse PCR assays. The concentrations of CT in the QCMD panel ranged from 6 to 5700 CT copies /vial. QCMD samples were tested in accordance with QCMD instructions. 2.5.2. CT clinical trial The performance of the BD ProbeTec and Abbott m2000 assays were analyzed using samples from patients attending the GUIDE clinic at SJH (n = 411). This involved testing male urine samples (n = 204), female urine samples (n = 207), and paired endocervical swabs (n = 207) on both diagnostic systems. Statistical analysis was performed on the results. The performance of the in-house assay was also validated using 24 clinical samples consisting of negative samples (n = 10), weak positive samples with DC b 2.0 (n = 11), and positive samples with DC N 2.0 (n = 3). One vCT positive sample was analyzed using the Abbott m2000, BD ProbeTec, and in-house PCR assays. A workflow analysis of the Abbott m2000 was conducted during the clinical trial.
3. Results 3.1. Analytic sensitivity Using 3 dilution series of a CT quantitated DNA control (Autogen Bioclear) ranging from 5.5 to 700 cryptic plasmid copies/reaction, the Abbott m2000 and in-house assay demonstrated an LOD of 22 copies/reaction, whereas the
Table 2 Analytic sensitivity results of 3 dilution series using the Abbott m2000, BD ProbeTec, and in-house assays Dilution series (presample preparation)
Range plasmid copies/reaction
No. of dilutions per series
BD ProbeTec assay LOD
Abbott m2000 assay LOD
In-house assay LOD
1 2 3
5.5–99 25–300 40–700
10 7 5
33 50 40
22 25 40
22 25 40
16
A. Walsh et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 13–19
Table 3 QCMD CT DNA 08A proficiency panel results using the Abbott m2000, BD ProbeTec, and in-house assays QCMD 2008
QCMD CT result
Abbott m2000 assay
BD ProbeTec assay
In-house assay
CT
Cop/vial
Log cop/vial
CT
CT DC
CT
MOTA
CT
CT Ct
CTA08-01 CTA08-02 CTA08-03 CTA08-04 CTA08-05 CTA08-06 CTA08-07 CTA08-08 CTA08-09 CTA08-10
Pos Wk pos Pos Wk pos Neg Pos Wk pos Neg Pos Pos
570 6 5700 57
2.7 0.78 3.7 1.7
0.54
570 57
2.7 1.7
5700 57
3.7 1.7
Pos Neg Pos Pos Neg Pos Pos Neg Pos Pos
Pos Neg Pos Pos Neg Pos Neg Neg Pos Pos
15K Neg 55K 9K Neg 14K Neg Neg 34K 42K
Pos Neg Pos Pos Neg Pos Pos Neg Pos Pos
36 Neg 31 41 Neg 35 37 Neg 27 34
4.56 BCO/BCO 1.78 BCO/BCO 8.42 197
Cop = copies; MOTA = Method Other Than Acceleration; Pos = positive; Wk pos = weak positive; Neg = negative.
LOD for the BD ProbeTec assay was 33 copies/reaction (Table 2). The BD ProbeTec, Abbott m2000, and in-house assay failed to detect QCMD CTA-02 with 6 CT copies/vial. The BD ProbeTec assay also failed to detect the urine sample 7 with 57 CT copies/vial (Table 3). 3.2. Clinical trial A total of 618 clinical samples from 411 patients were analyzed. An overview of the sample results using the BD ProbeTec and Abbott m2000 assays is shown in Table 4. No inhibition was detected in either assay. Seven clinical samples (2 male urine, 4 endocervical swabs, and 1 female urine) tested negative using the BD ProbeTec and positive using the Abbott m2000 (Table 5). Five of the samples gave DC values b2.0, and 2 samples were BCO on initial and repeat testing, suggesting that these samples had a very low chlamydial load. Of the 2 male urine samples, 1 of the samples tested positive using the Amplicor and was therefore considered a true positive. The remaining 6 samples were further analyzed using the in-house assay. Two of the 6 samples tested positive using the in-house assay and were therefore considered true positives. Of the remaining 4 samples, 1 male urine sample and 2 endocervical swabs were further analyzed using nested PCR and automated DNA
Table 4 Overview of the results obtained with BD ProbeTec and Abbott m2000 from a total of 618 clinical samples: male urine samples (n = 204), female urine samples (n = 207), and paired endocervical swab (n = 207) BD ProbeTec assay
Abbott m2000 assay
Male urine Total Endocervical swab Total Female urine Total
Positive Negative Positive Negative Positive Negative
Positive
Negative
Total
24 0 24 28 0 28 26 0 26
2 178 180 4 175 179 1 180 181
26 178 204 32 175 207 27 180 207
sequencing. A BLAST N search demonstrated sequence homology with maximum identity to numerous CT cryptic plasmid sequences in the GenBank database. The sample volume of the remaining swab was insufficient to perform nested PCR. The sensitivity and 95% confidence intervals (CIs), specificity, and positive and negative predictive values of the Abbott m2000 and BD ProbeTec assays were calculated for each specimen type (Table 6). These performance characteristics were calculated on the basis that the 1 unresolved discrepant swab result was not included in the statistics. For the in-house validation, a total of 24 clinical samples were analyzed. Ten samples, which tested negative using the Abbott m2000, also tested negative using the inhouse assay. Of 2 samples that were deemed to be BCO (grey zone) using the Abbott m2000, 1 sample was not detected using the in-house assay. The remaining 12 Abbott m2000 positive samples gave concordant results when tested using the in-house assay. The detection rates of endocervical swabs and female urine samples were also analyzed. Of the 207 endocervical swabs and matched female urine samples, 31 endocervical swabs and 27 female urine samples were confirmed positives using the Abbott m2000 (Table 4, 1 swab was insufficient and could not be confirmed a true positive). A total of 5 patients were swab+/urine−, and 1 patient was urine+/swab −, giving a total of 32 positive patients. These 6 discrepant CT positive samples had very low chlamydial loads with DC values of BCO—1.05. The rate of detection of CT infection testing endocervical swabs was 96.8% (31/32) by comparison with a detection rate of 84% (27/32) for female urine. The single vCT positive extract was detected using the BD ProbeTec, Abbott m2000, and in-house assay. 3.3. Workflow analysis The total time required to test 1 batch of specimens (93 samples and 3 controls) was 6 h and 20 min, with a hands-on time of 1 h and 15 min. Two batches of samples may be processed in 8 h with an estimated 2 h of hands-on time (Table 7). However, results from the 2nd batch of
A. Walsh et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 13–19
17
Table 5 Comparison of the results obtained using the BD ProbeTec, Abbott m2000, Amplicor, and in-house and nested PCR assays for samples showing discordant results Specimen type
Male urine Endocervical swab Female urine Male urine Endocervical swab Endocervical swab Endocervical swab
Assays results BD ProbeTec
Abbott m2000
Amplicor
In-house
Nested PCR
Negative Negative Negative Negative Negative Negative Negative
Positive (DC 1.9) Positive (BCO, BCO) Positive (DC 0.11) Positive (DC 0.04) Positive (BCO, BCO) Positive (DC 0.14) Positive (DC 0.56)
Positive Negative Negative Negative Negative Negative Negative
N/T Positive Positive Negative Negative Negative Negative
N/T N/T N/T Positive Positive Positive Insufficient
N/T = not tested; DC = Decision cycle; BCO = Beyond the cutoff.
samples will not be available for reporting until the following day.
4. Discussion The diagnosis of chlamydial genital infections has been greatly enhanced by the introduction of NAATs, providing a dramatic improvement in assay sensitivity and specificity (Chernesky et al., 2006; Gaydos et al., 2004). Because of increasing workloads and the requirement of greater throughput in our laboratory, we evaluated the newly revised, automated, real-time PCR Abbott m2000 assay. This study confirmed that the sensitivity and specificity of the Abbott m2000 was satisfactory, and consequently, the assay is currently in use in our laboratory. Although the BD ProbeTec and Abbott m2000 assays demonstrated adequate analytic sensitivity, the study demonstrates that the BD ProbeTec assay was 3.7% to 9.7% less sensitive than the Abbott m2000 depending on the specimen type. The sensitivity of the BD assay for male urine, endocervical swabs, and female urine was estimated to be 92.3%, 90.3%, and 96.3%, respectively, whereas the sensitivity of the Abbott m2000 assay testing the same specimen types was 100%. However, because the 95% CI of the sensitivity values for both assays overlap, there is little evidence to support the difference in the assay sensitivities. More positive specimens would need to be tested to confirm these findings. Another factor that could bias assay
sensitivity is the variation in the quality of the specimen. However, in this study, sampling error is unlikely to be a factor because the endocervical swabs tested using the BD Probe Tec assay were the first to be collected. In addition, because PCR inhibitors were not detected in either assay, the quality of both specimens was assured. The limit of detection of the Abbott m2000 as determined by testing the 3 dilution series was estimated to be 22 cryptic plasmid copies/reaction and is comparable with the study by Marshall et al. (2007), which demonstrated an analytic sensitivity of 20 plasmid copies/PCR reaction using the Abbott m2000 assay, equivalent to the detection of 2 elementary bodies (EBs). The BD ProbeTec assay achieved a detection limit of 33 cryptic plasmid copies/reaction; this is slightly lower than the Abbott m2000 assay, but the difference in these levels of detection equates to approximately 3 and 5 organisms (EBs) and is clinically insignificant. Regarding QCMD, the Abbott m2000 failed to detect QCMD CTA-02 with 6 CT copies/vial. Analysis of the QCMD final report indicated that of the total number of laboratories (n = 43) using commercial real-time PCR technologies, only 9.3% (n = 4) were successful in detecting QCMD sample 2. The overall results obtained using the QCMD panel demonstrated that the Abbott m2000 and the in-house assays were able to detect a lower CT copy number and were therefore shown to be more sensitive than the BD ProbeTec assay. Both the BD ProbeTec and the Abbott m2000 assays displayed 100% specificity. No false positives were found in this study, which reflects “good laboratory
Table 6 Comparison of the results from clinical sample using the Abbott m2000 and BD ProbeTec assay (sensitivity, 95% CIs, specificity, and positive and negative predictive value) Specimen type
Assay type
Sensitivity (%)
Specificity (%)
Positive predictive value (%)
Negative predictive value (%)
Male urine
BD ProbeTec Abbott m2000 BD ProbeTec Abbott m2000 BD ProbeTec Abbott m2000
92.3 (74.8–99.0) 100 (86.7–100) 90.3 (74.2–97.9) 100 (88.78–100) 96.3 (81.03–99.91) 100 (87.2–100)
100 100 100 100 100 100
100 100 100 100 100 100
98.8 100 98.3 100 99.4 100
Endocervical swab Female urine 95% CIs in parenthesis.
18
A. Walsh et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 13–19
Table 7 A breakdown of the time required to process samples using the Abbott RealTime™ CT assay
Step 1. Daily maintenance of m2000sp, vortexing and loading of batch 1 samples, preparation and loading of batch 1 reagents. Step 2. Extraction and PCR setup of batch 1 samples, recapping of batch 1 samples, replacement of tips and preparation of batch 2 reagents. Step 3. Transfer of batch 1 to m2000rt for amplification and detection, loading batch 2 samples and reagents on m2000sp. Step 4. Extraction and PCR setup of batch 2 samples, recapping of batch 2 samples, replacement of tips. Step 5. Transfer of batch 2 to m2000rt for amplification and detection. m2000sp = Abbott m2000 sample preparation instrument. m2000rt = Abbott m2000 real-time PCR instrument.
practice” and the improved design of assays and analytic platforms that reduce the risk of cross-contamination. No inhibitors were detected using the Abbott m2000 assay as determined by the inclusion of IC; however, earlier poster presentations have described inhibition rates of 0.6% to 1.5% when testing urine samples using the Abbott m2000 (Persson 2006; Luijt and Schirm, 2007). Previous studies have shown that the Abbott m2000 performed well when compared with the other commonly used NAATs. Levett et al. (2008) compared the GenProbe Aptima Combo 2 (Tigress), BD ProbeTec (Viper platform), and Abbott CT/NG assay (m2000) and estimated the sensitivities and specificities to range from 95.8% to 100% and 99.5% to 100%, respectively. A study by Marshall et al. (2007) found an overall agreement of 98.8% and 98.6% with swab and urine samples tested using the Abbott m2000 and BD ProbeTec assays and concluded that the Abbott m2000 demonstrated satisfactory analytic and clinical performance. Marshall et al. (2007) also reported that the Abbott m2000 assay also demonstrated good reproducibility. This study also found that the endocervical swab was the specimen of choice for increased diagnosis of CT infection in females and demonstrated a lower rate of detection of 12.8% in the female urine by comparison with the endocervical swabs. However, it must be acknowledged that the number of samples tested in this study is limited, and further validation is required to substantiate this difference. This finding is similar to that of Marshall et al. (2007) who found
that female urine gave a N10% lower sensitivity rate than cervical swabs. A further study using real-time quantitative PCR and estimating chlamydial loads at matched anatomic sites found that the mean chlamydial load in 73 CT-infected women were 2231 EBs/100 μL for endocervical swabs and 47 EBs /100 μL for FVU (Claude-Edouard et al., 2007). Clinicians and other sexual health workers must be aware of this limitation when interpreting results. Detection of the vCT strain in this study, CE mark certification for the newly revised Abbott RealTime™ CT assay for detection of new vCT (January 2008), and published reports from Sweden provide evidence that the Abbott m2000 assay is capable of detecting the vCT (Lynagh et al., 2007; Schirm and Ripa, 2007). However, it should be noted that the Abbott m2000 PCR-based prototype assay developed by Abbott Molecular and evaluated in the study by Marshall et al. (2007) was unable to detect the vCT strain. The discrepant analysis approach was used to resolve discordant results obtained using the Abbott m2000 and BD ProbeTec assays. This method of comparison is not ideal and introduces bias when defining specimen status. However, in the absence of a “gold standard” reference method, difficulties arise in the interpretation of performance characteristics when evaluating assays, with newer and more sensitive assays proving even more difficult to interpret (Schachter et al., 2005; Skidmore et al., 2006). It was hoped that the sensitivity of one of the assays used for discrepant analysis would have given sufficient sensitivity to allow its use as a confirmatory assay. The results of this study show that neither the Amplicor assay nor the in-house assay has a higher sensitivity than the Abbott m2000 assay, and furthermore, the Amplicor assay is unsuitable because it does not detect the vCT. The use of one of these assays would also have fulfilled the requirement to use a different molecular target for confirmation of positive samples, consistent with Center for Disease Control and Prevention guidelines (Johnson et al., 2002), because the patient cohorts routinely tested at SJH include low prevalence populations. Because this is not possible, positive samples are currently confirmed by repeat testing (including sample reextraction) on the Abbott m2000 assay, in accordance with the Health Protection Agency, UK, minimum testing algorithm for detection of CT using NAATs. The nested PCR assay, although sufficiently sensitive, is laborious and could be reserved for resolving major discrepancies. The increasing demand for CT testing requires the use of an automated high-throughput assay. Using the Abbott m2000 assay, it is possible to process 2 batches of 96 samples per 8-h shift; this equates to approximately 2 h hands-on time and 6 h walk-away time. A further reduction in hands-on time will be achieved when the lengthy job of removing and replacing caps before and after testing is avoided with the introduction of the pierceable sealed multi-Collect tube cap (except if positive specimens are retained and frozen). The Abbott m2000 assay thus combines high throughput with minimal labor and supports a procedure that is easily learned, but as with all molecular assays, care must be taken to avoid
A. Walsh et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 13–19
the risk of contamination. Based on the current CT workload, the new fully automated Abbott m2000 assay has cost implications for our laboratory; however, these are negated by the high throughput. Although not investigated in this study, the Abbott m2000 System offers a combined assay that permits the simultaneous detection of CT and Neisseria gonorrhoeae (NG) (Abbott RealTime™ CT/NG assay). Numerous studies have shown that NAATs offer significantly increased detection rates for NG (Geraats-Peters et al., 2005; Levett et al., 2008; Whiley and Sloots, 2005). These improved rates of detection may be of particular importance in the detection of NG from pharyngeal swabs where lower bacterial loads are observed (Palmer et al., 2003; Page-Shafter et al., 2002) In summary, the study results show that the Abbott m2000 assay is a highly sensitive and specific assay for the detection of CT. This study also indicates that identification of CT infection in women is best achieved by testing cervical swabs and not urine samples. Other attributes include high throughput and the ease of interpretation of results. We recommend the use of the Abbott m2000 as a clinical diagnostic assay. Acknowledgments The authors would like to thank Abbott for supplying the Abbott RealTime™ CT Assay kits at an evaluation rate. They also thank Ms Yvonne Lynagh for testing and sequencing the vCT. References Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhnag Z, Miller W, Lipman DL (1997) Gapped BLAST and PSI-Blast: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402. Chernesky M, Jang D, Luinstra K, Chong S, Smieja M, Cai W, Hayhoe B, Portillo E, Maccritchie C, Main C, Ewert R (2006) High analytical sensitivity and low rates of inhibition may contribute to detection of Chlamydia trachomatis in significantly more women by the APTIMA Combo 2 assay. J Clin Microbiol 44:400–405. Claude-Edouard MC, Sonnex MC, Carne CA, White JA, Magbanua JPV, Nadala Jr ECB, Lee HH (2007) Chlamydia trachomatis load at matched anatomic sites: implications for screening strategies. J Clin Microbiol 45:1395–1402. Gaydos CA, Theodore M, Dalesio N, Wood BJ, Qiunn TC (2004) Comparison of three nucleic acid amplification tests for detection of Chlamydia trachomatis in urine specimens. J Clin Microbiol 42:3041–3045. Geraats-Peters CWM, Brouwers M, Schneeberger PM, van der Zanden AGM, Bruisten SM, Weers-Pothoff G, Boel CHE, van der Brule AJC, Harmsen HG, Hermans MHA (2005) Specific and sensitive detection of Neisseria gonorrhoeae in clinical specimens by real-time PCR. J Clin Microbiol 43:5653–5659. Johnson R E, Newhall W J, Papp J R, Knapp J S, Black C M, Gift T L, Steece R, Markowitz L E, Devine O J, Walsh C M, Wang S, Gunter D C, Irwin K L, DeLisle S, Berman S M. (2002) Screening tests to detect Chlamydia trachomatis and Neisseria gonorrhoeae infections. Morb Mortal Wkly Rep Recomm Rep 51:1–38;CE1–CE4. Levett PN, Brandt K, Olenius K, Brown C, Montgomery K, Horsman GB (2008) Evaluation of three automated nucleic acid amplification systems
19
for detection of Chlamydia trachomatis and Neisseria gonorrhoeae in first-void urine specimens. J Clin Microbiol 46:2109–2111. Little MC, Andrews J, Moore R, Bustos S, Jones L, Embres C, Durmowicz G, Harris J, Berger D, Yanson K, Rostkowski C, Yursis D, Price J, Fort T, Walters A, Collis M, Llorin O, Wood J, Failing F, O'Keefe C, Scrivens B, Pope B, Hansen T, Marino K, Williams K, Boenisch M (1999) BD ProbeTec ET. Clin Chem 45:777–784. Luijt DS, Schirm J (2007) Evaluation of the Abbott m2000 sp/rt real-time PCR Chlamydia trachomatis and Neisseria gonorrhoeae assays using urine samples, and comparison with the Roche COBAS Amplicor Chlamydia trachomatis and Neisseria gonorrhoeae PCR tests. Poster session II: 17th ECCMID Munich Germany. Lynagh Y, Crowley B, Walsh A (2007) Investigation to determine if newlydiscovered variant of Chlamydia trachomatis is present in Ireland. Euro Surveill 12:E070201.2. Manavi M (2006) A review on infection with Chlamydia trachomatis. Best Pract Res Clin Obstet Gynaecol 20:941–951. Marshall R, Chernesky M, Jang D, Hook EW, Cartwright CP, HowellAdams B, Ho S, Welk J, Lai-Zhang J, Brashear J, Diedrich JB, Otis K, Webb E, Robinson J, Yu H (2007) Characteristics of the m2000 automated sample preparation and multiplex real-time PCR system for detection of Chlamydia trachomatis and Neisseria gonorrhoeae. J Clin Microbiol 45:747–751. Martin DH, Nsuami M, Schachter J, Hook III EW, Ferrero D, Quinn TC, Gaydos C (2004) Use of multiple nucleic acid amplification tests to define the infected-patient “gold standard” in clinical trials of new diagnostic tests for Chlamydia trachomatis infections. J Clin Microbiol 42:4749–4758. Page-Shafter K, Graves A, Kent C, Balls JE, Zapitz VM, Klausner JD (2002) Increased sensitivity of DNA amplification testing for the detection of pharyngeal gonorrhoea in men who have sex with men. Clin Infect Dis 34:173–176. Pa mer H, Mallinson H, Wood RL (2003) Evaluation of the specificities of five DNA amplification methods for the detection of Neisseria gonorrhoeae. J Clin Microbiol 41:835–837. Persson K (2006) Clinical comparison of the m2000 system (Abbott) and the Cobas Amplicor (Roche) for the diagnosis of Chlamydia trachomatis in urine samples. Poster presentation IUSTI, Paris. Pickett MA, Everson JS, Pead PJ, Clarke IN (2005) The plasmids of Chlamydia trachomatis and Chlamydia pneumoniae (N16): accurate determination of copy number and the paradoxical effect of plasmidcuring agents. Microbiology 151:893–903. Ray K (2006) Chlamydia trachomatis and infertility. Indian J Med Res 123: 730–734. Ripa T, Nilsson PA (2007) A Chlamydia trachomatis strain with a 377-bp deletion in the cryptic plasmid causing false-negative nucleic acid amplification tests. Sex Transm Dis 34:255–256. Rozen S, Skaletsky HJ (1998) Primer3. Available from http://primer3. sourceforge.net. Schachter J, Hook EW, Martin DH, Willis D, Fine P, Fuller D, Jordan J, Janda WM, Chernesky M (2005) Confirming positive results of nucleic acid amplification tests (NAATs) for Chlamydia trachomatis: all NAATs are not created equal. J Clin Microbiol 43:1372–1373. Schirm J, Ripa T (2007) Real-time PCR assays for the detection of gonorrhoea and of wild type and mutant chlamydia. Hosp Healthc Eur [2007/8]. Skidmore S, Horner P, Mallinson H (2006) Testing specimens for Chlamydia trachomatis. Sex Transm Infec) 82(4):272–275. Tavakoli M, Craig AM, Malek M (2002) An econometric analysis of screening and treatment of patients with suspected Chlamydia trachomatis. Health Care Manag Sci 5:33–39. Whiley DM, Sloots TP (2005) Comparison of three in-house multiplex PCR assays for the detection of Neisseria gonorrhoeae and Chlamydia trachomatis using real-time and conventional detection methodologies. Pathology 37:364–370.