- Email: [email protected]
Event Specific Transgene Detection in Bt11 Corn by Quantitative PCR at the Integration Site
Lebensm.-Wiss. u.-Technol., 33, 210}216 (2000)
Event Speci"c Transgene Detection in Bt11 Corn by Quantitative PCR at the Integration Site Andreas Zimmermann, JuK rg LuK thy and Urs Pauli*
Swiss Federal O$ce of Public Health, 3003 Bern (Switzerland) (Received November 23, 1999, accepted January 19, 2000)
The genetically modixed corn Bt11 from Novartis is widely cultivated for production of foodstuws or fodder. Due to the insertion and expression of a 6.3 kb sequence containing a Bacillus thuringiensis (Bt)-transgene coding for a synthetic cryIA(b) d-endotoxin, the Bt11-corn is resistant against lepidopteran insects, especially against the European corn borer. As labelling of genetically modixed foodstuws is mandatory in many European countries, several methods to detect genetically modixed organisms (GMOs) qualitatively have been described. Since these *conventional+ detection systems are all based on the polymerase chain reaction (PCR) amplifying unique sequences within the integrated transgenic constructs, they may lead to ambiguous results in qualitative and especially in quantitative analysis of GMOs in foodstuws and fodder. In this study, we report the characterization of the genomic sequence at the 5' -site of the integrated transgenic sequence in the Bt11-corn genome using inverse PCR. The integration border was subsequently used to develop a novel and unambiguous PCR detection system covering the integration border at the 5' site of the transgene. The genomic sequence showed high similarities with a corn-specixc 180 bp knob-associated repeat region. By using one primer annealing exactly at the integration border between the transgenic construct and the corn genome and the other within the vector sequence of the transgenic construct, a 207 bp product was amplixed. After insertion of a 22 bp fragment, the amplixcation product was subsequently used as a competitor in quantitative competitive PCR (qcPCR). Finally, the qcPCR-system was calibrated to an equivalence point of 1% Bt11-DNA.
2000 Academic Press Keywords: Genetically Modi"ed Organism (GMO); Bt11 corn; integration site; quantitative PCR; inverse PCR (iPCR)
Introduction Over 30 di!erent genetically modi"ed crops have been approved by the U.S.A. and Europe in recent years (1), and the development of crops with new genetic traits is still one of the main activities of the agro-industry. In western Europe, the marketing and labelling of genetically modi"ed organisms (GMOs) for food use is regulated by the Novel Food Directive (EC) No 258/97 (2) or by national Food Ordinances. The Swiss Food Ordinance, for example, requires labelling of foodstu!s, food components and food processing aids if they include any ingredient consisting of more than 1% of an approved GMO (3). Although no methodology is provided by the Swiss decrees, the detection and labelling of GMOs are mainly based on the detectability of the inserted constructs by the polymerase chain reaction (PCR). Based on the ampli"cation of unique sequences within the inserted
* Author to whom correspondence should be addressed. Fax: 41 31 322 95 74; E-mail: [email protected]
0023-6438/00/030210#07 $35.00/0 2000 Academic Press
constructs, this method o!ers very high sensitivity and speci"city. Many speci"c PCR-systems for di!erent GMOs have been described (4}7), but only a few of them are quantitative. Quantitative PCR-systems are generally based either on competitive coampli"cation of a known amount of competitor DNA with the target DNA (8, 9) or on real-time PCR using the TaqMan2+, LightCycler2+ or iCycler2+ technology. We have developed an extended quantitative PCR-system for the genetically modi"ed Bt11 corn that overcomes two di$culties of &conventional' PCR-systems used in GMO analysis published so far. Firstly, di!erent copy numbers of integrated constructs in di!erent GMOs; and secondly, di!erent GMOs containing identical transgenic constructs. Since integration of a &foreign' DNA sequence into the genome of a plant is unlikely to occur twice at the same genomic locus, the use of a PCRsystem covering the integration border between the construct and the host genome will lead to an unambiguous identi"cation of the GMO, because it is speci"c for the transgenic construct and the integration site. Furthermore, only one integrated construct will be used as ampli"cation target in PCR, leading to a high accuracy in
doi:10.1006/fstl.2000.0637 All articles available online at http://www.idealibrary.com on
210
lwt/vol. 33 (2000) No. 3
quanti"cation independent of how many constructs are integrated in the genome. This work describes the development of a novel PCRsystem for transgenic Bt11-corn using the integration border between the 5 site of the transgenic construct and the corn genome as target for ampli"cation. The genomic DNA was characterized using inverse PCR (iPCR), sequenced and subsequently used to design the unambiguous Bt11 PCR-system. Next, a competitor used for quantitative analysis was constructed by insertion of a 22 bp fragment into the ampli"cation product. The quantitative competitive (qc) PCR-system was "nally tested and calibrated to a equivalence point which corresponds to 1% GMO.
Materials and Methods DNA extraction Kernels of Bt11-corn were germinated for several days, cut into small pieces with a sterile surgical blade and subsequently frozen to !20 3C until further use. DNA extraction was carried out according to the protocol of the NucleonPhytopure-method (Scotlab Biosience, U.S.A.): 100}200 mg of frozen sample tissue was ground in liquid nitrogen to yield a "ne powder and subsequently mixed with 600 kL Reagent 1, 10 kL RNase A (10 mg/mL) and, after vortexing, with 200 kL Reagent 2. The samples were inverted several times and incubated at 65 3C in a waterbath or thermoshaker for 10 min. The samples were then put on ice for 20 min before adding 500 kL chloroform and 100 kL NucleonPhytopure DNA Extraction Silica Suspension. After incubation at room temperature for 10 min on a shaker and centrifugation for another 10 min at 1,300;g, the upper phase was transferred to a 1.5 mL Eppendorf tube. DNA was precipitated with 800 kL cold (!20 3C) isopropanol for 30 min at room temperature. The samples were inverted several times and centrifuged for 5 min at 6,000;g (4 3C). The supernatant was discarded and the pellet was washed once with 500 kL cold (!20 3C) ethanol (70 g/L). The pellet was dried at room temperature for approximately 15 min, dissolved in 50 kL TE (10 mmol/L Tris, pH 8.5; 1 mmol/L EDTA), quanti"ed using GeneQuant II (Pharmacia, Switzerland) and stored until use at !20 3C.
Digestion and ligation of genomic DNA Digestion and ligation of genomic corn DNA was carried out according to (10): 5 kg genomic Bt11 DNA were digested using 20 units of HindIII (Boehringer Mannheim, Switzerland) in a total volume of 25 kL for 2 h at 37 3C. Then, 20 units of HindIII were added and the reaction was extended for 1 h. After digestion, samples were phenol-extracted by adding 150 kL of H O and 200 kL of equilibrated phenol, mixed and brie#y centrifuged in a table centrifuge for phase separation. The upper phase was transferred to a Eppendorf tube, mixed with 200 kL chloroform : isoamylalcohol (24 : 1) and brie#y centrifuged. Then, 150 kL of the upper phase was
transferred to a Eppendorf tube and subsequently precipitated with 15 kL 3 mol/L Na-acetate (pH 5.3) and 300 kL 100 g/L ethanol for at least 1 h at !20 3C. Finally, DNA was centrifuged at 14,000 rpm for 20 min, washed once with 500 kL 70 g/L ethanol, air dried at room temperature for 15 min and dissolved in 50 kL H O. The concentration of the digested Bt11-DNA was determined using GeneQuant II. The e$ciency of digestion was visually controlled by comparing digested and undigested Bt11-DNA on a 1 g/L agarose gel. In the ligation step, 950 ng digested Bt11-DNA was ligated with 0.05 units T4 DNA ligase (Boehringer Mannheim, Switzerland). The ligation was carried out in a waterbath at 14 3C for 18 h in a total volume of 100 kL. The ligase was subsequently heat inactivated at 75 3C for 15 min and the DNA was phenol-extracted as described above. The pellet was resuspended in 10 kL TE (10 mmol/L Tris, pH 8.5; 1 mmol/L EDTA).
Polymerase chain reaction (PCR) An iPCR system for the characterization of the genomic sequence adjacent to the integration site of the transgenic construct in Bt11-corn and a qcPCR system for the quanti"cation of Bt11-corn was developed. All PCRs were carried out on a RoboCycler Gradient 40 thermal cycler (Stratagene, Germany) with hot top assembly. The ampli"cation products (20 kL) were separated using a 2 g/L agarose gel (MS-agarose, Boehringer Mannheim Switzerland) in 1;TBE bu!er (45 mmol/L Tris-borate; 1 mmol/L EDTA, pH 8.3), and visualized by UV after staining for 10 min in a 1 kg/mL ethidium bromide solution. All primers used in this work were designed using the primer analysis software &Oligo 5.0' (NBI, Plymouth, U.S.A.). Primers (Microsynth GmbH, Switzerland) were diluted to 20 kmol/L and stored at !20 3C. Inverse PCR. All iPCR assays were performed in "nal volumes of 50 kL in 0.5 mL tubes containing 1;reaction bu!er (50 mmol/L KCl; 10 mmol/L Tris-HCl; pH 9); 1.5 mmol/L MgCl , 0.2 mmol/L each of dATP, dGTP, dTTP and dCTP; 0.5 kmol/L of each primer, 1.5 units of Taq polymerase (Pharmacia Biotech, Switzerland), 4 kL template in the "rst iPCR and 1 kL in the nested iPCR. Primers were used in the ampli"cation reactions under the following conditions: OuterA/outerB. First denaturation 10 min at 95 3C; 35 cycles (1 min 20 s at 95 3C, 1 min 30 s at 56 3C, 2 min 30 s at 72 3C), terminal elongation 4 min 30 s at 72 3C. InnerA/innerB. First denaturation 3 min 30 s at 95 3C; 30 cycles (1 min 20 s at 95 3C, 1 min 30 s at 56 3C, 2 min 30 s at 72 3C), terminal elongation 4 min 30 s at 72 3C. Quantitative competitive PCR. All qcPCR assays were performed in "nal volumes of 50 kL in 0.5 mL tubes containing 1;reaction bu!er (50 mmol/L KCl; 10 mmol/L Tris-HCl; pH 9); 2.5 mmol/L MgCl , 2 kg/mL BSA, 0.2 mmol/L each of dATP, dGTP, dTTP and dCTP; 0.5 kmol/L of each primer, 1.5 units of Taq
211
lwt/vol. 33 (2000) No. 3
polymerase (Pharmacia Biotech) and 200 ng template DNA. For con"rmation of the optimized protocol, the qcPCR assays using primers Bt11-1, Bt11-2 and Bt11-3 were additionally carried out on a PTC 200 cycler (MJ Research, Massachusetts U.S.A.). Primers were used in the ampli"cation reactions under the following conditions:
Bt11-1 and Bt11-2. Due to the insertion of an EcoRI restriction site into the complementary tail sequences, the ampli"cation product was controlled by digesting with 20 units of EcoRI (Boehringer Mannheim) in a total volume of 25 kL at 37 3C for 2 h and subsequently separated on a 2 g/L agarose gel.
Bt11-1/muta1 and Bt11-2/muta2. First denaturation 3 min 30 s at 95 3C; 40 cycles (1 min 20 s at 95 3C, 1 min 30 s at 58 3C, 2 min 30 s at 72 3C), terminal elongation 4 min 30 s at 72 3C.
Cloning of the competitor Cloning of competitor into plasmid pCR2.1 TOPO (Invitrogen, Netherlands) was carried out according to the protocol of the kit. After transformation, the TOP10 E.coli cells were selected by blue/white screening and grown overnight in 25 mL LB (10 g/L tryptone, 5 g/L yeast-extract, 10 g/L NaCl, pH 7.5) containing 100 kg/mL ampicillin. Plasmid extraction was carried out using the Qiagen Plasmid Midi Kit (Qiagen, Switzerland). The plasmid was con"rmed as containing the correct competitor sequence by cycle sequencing (Microsynth GmbH, Switzerland), named pBt11 and subsequently linearized using 20 units EcoRV in a total volume of 200 kL at 37 3C for 2 h. After phenol extraction using "rst an equal volume of phenol : chloroform : isoamylalcohol (25 : 24 : 1) and then an equal volume of chloroform, the linearized pBt11 was ethanol precipitated, quanti"ed with the GeneQuant II (Pharmacia Biotech) and used for calibration of the qcPCR-system.
Bt11-1/Bt11-2 and Bt11-1/Bt11-3. (a) RoboCycler : Gradient cycler: "rst denaturation 3 min 30 s at 95 3C; 40 cycles (1 min 20 s at 95 3C, 1 min 30 s at 58 3C, 2 min 30 s at 72 3C), terminal elongation 4 min 30 s at 72 3C. (b) PTC 200 cycler: "rst denaturation 3 min at 95 3C; 40 cycles (30 s at 95 3C, 40 s at 58 3C, 1 min at 72 3C), terminal elongation 3 min 30 s at 72 3C.
Construction of the competitor Construction of the competitor was carried out according to (8). Two separate PCR assays were performed using the ampli"cation product of the Bt11-system using one of the original primers (Bt11-1 or Bt11-2) in combination with a new designed mutagenic primer (muta1 or muta2). Primers muta1 and muta2 both carry a complementary tail sequence at the 5 site (see Table 1) and anneal immediately adjacent to each other on the target DNA. The two ampli"cation products from Bt111/muta1 and Bt11-2/muta2 were separated on a 2 g/L agarose gel using MS-agarose (Boehringer Mannheim), excised from the gel using the &Agarose Gel DNA Extraction Kit' (Boehringer Mannheim) and resuspended in 50 kL H O. Then, 20 kL of each ampli"ed product was mixed with 10 nmol of each dNTP and with 5 kL 10;EcoPol bu!er (10 mmol/L Tris-HCl pH 7.5, 5 mmol/L MgCl , 7.5 mmol/L dithiothreitol) (BioCon cept, Switzerland), heated to 95 3C for 3 min and cooled down to 37 3C in a waterbath. Five units of Klenow polymerase (BioConcept) were added and the mixture was incubated at 37 3C for 1 h. Next, 10 kL of the elongated product was directly ampli"ed using primers
Calibration of qcPCR Calibration of pBt11 to an equivalence point which corresponds to 1% GMO was done by coamplifying 200 ng of DNA mixtures containing 1% of Bt11-DNA in conventional corn DNA with 50 fg, 40 fg, 30 fg, 20 fg, 10 fg or 1 fg of linearized pBt11. Conditions of ampli"cation were as described for primers Bt11-1 and Bt11-2. The ampli"cation product was separated on a 1.5% agarose gel, visualized by UV after staining for 10 min in a 1 kg/mL ethidium bromide solution and digitized using a CCD camera. The amounts of the ampli"ed products were determined using gel picture analysis software (ONEDscan, Scanalytics Inc., U.S.A.) and corrected with respect to their molecular weights. This was done by multiplying the calculated amount of the (shorter) target DNA signal with a factor of 1.11, which represents the ratio of
Table 1 Sequences and purposes of primers. The underlined regions in primers muta1 and muta2 represent the complementary tail sequences, whereas the underlined sequences in primers Bt11-1 and Bt11-3 depict the inverted parts (for details see text) Name
Sequence 5 P3
Purpose
innerA innerB outerA outerB muta1 muta2 Bt11-1 Bt11-2 Bt11-3
GGTCTGACGCTCAGTGGAAC CGGTCTTGCGATGATTATCA GCTCTTGATCCGGCAAACAA CAAGCGTTTTCACCCTTAGC TTAGCACGGAATTCTGAACGTCAAGGATCTCAAGAAGATCCT GACGTTCAGAATTCCGTGCTAATTTTTCTGCGCGTAATCTGC TATCATCGACTTCCATGACCA AGCCAGTTACCTTCGGAAAA TCAGCTACTATTCCATGACCA
212
inverse PCR inverse PCR inverse PCR inverse PCR int. standard int. standard qcPCR qcPCR qcPCR control
lwt/vol. 33 (2000) No. 3
the lengths of the competitor (227 bp) and from the target (207 bp). Furthermore, the amounts of the heteroduplexes were divided proportional to the corresponding ampli"cation signal according to their molecular weights as described above. Finally, the equivalence point was determined using a linear regression plot between the logarithm of the ratio of the amount of ampli"cation products (amount of ampli"ed target DNA divided by amount of ampli"ed competitor DNA) and the logarithm of the initial amount of competitor DNA (8).
Results and Discussion Characterization of the genomic sequence adjacent to the 5 site of the transgenic construct in Bt11-corn The inserted sequence in the Bt11-corn genome basically consists of a cryIA(b)-transgene mediating resistance against the European corn borer, a pat-transgene for herbicide tolerance and of an approximately 1.1 kb vector sequence (Novartis, personal communication). The aim of this work was to design a single PCR-system for quantitative analysis of Bt11-corn using the integration border between the genome and the 5 site of the integrated construct as ampli"cation target. By using this approach, an unambiguous identi"cation and quanti"cation of Bt11-corn would be achieved, even if other genetically modi"ed crops contained the same transgenic construct. Many di!erent strategies have been described to amplify and subsequently characterize unknown DNA sequences adjacent to a known sequence (for a review see 11). Inverse PCR as a universally applicable and relatively fast method has been chosen. This is an extension of conventional PCR which allows the ampli"cation of unknown sequences without the need for cloning (10, 12). Its principle is delineated in Fig. 1. After digestion of genomic DNA from the target tissue with an appropriate digestion enzyme (step 1), the DNA fragments are subsequently self-ligated under conditions which favour the formation of monomeric circles (step 2). Within this circularized form of DNA, a nested PCR is used to amplify the junction region by primers in opposite directions of the known integrand sequence (step 3). Genomic DNA was extracted from Bt11-corn leaf tissue, quanti"ed, digested using HindIII and "nally religated. In order to favour intramolecular ligation (i.e. self-ligation), ligation reactions of digested Bt11-DNA were performed with di!erent amounts of DNA and T4 DNA ligase (data not shown). This step turned out to be critical, since too much DNA favours ligation of di!erent molecules and will lead to unspeci"c ampli"cation. On the other hand, too little DNA will not be ampli"ed in the subsequent PCR due to the low e$ciency of ligation (10). After ligation, DNA was ampli"ed using the nested iPCR-system and characterized on a 2% agarose gel. The ampli"cation product was excised from the gel and subsequently sequenced by cycle sequencing. The obtained sequence of the putative genomic integration border was then compared to the database of the National Center of Biotechnology Information (13) and turned
Fig. 1 Strategy used for inverse PCR. The bold bar indicates the known sequence of the construct, the thin line the unknown genomic corn sequence. The cross marks on the arrows indicate that no primer annealing will occur in circularized DNA in contrast to circularized DNA with 5 site of integrated DNA. For details see text (adapted from 9)
out to show high homology to a corn-speci"c 180 bp knob-speci"c repeat (data not shown). This repeat is postulated to be the major DNA sequence component of knob heterochromatin in corn (14).
Design of an unambiguous Bt11 PCR-system After characterization of the putative sequence at the integration border, an unambiguous Bt11 PCR-system covering the integration border of the transgenic construct and the corn genome was designed. Since the use of the 180 bp knob-speci"c repeat as target in the PCRsystem led to the formation of unspeci"c ampli"cation signals (data not shown), the primer annealing in the genome (Bt11-1) was designed to cover exactly the integration border between the transgenic construct and the corn genome, thereby containing a &genomic' and a &transgenic' part (Fig. 2). The &genomic' part of primer Bt11-1 contains 11 bases which bind to the genomic sequence directly adjacent of the integration site, whereas the 10 bases of the &transgenic' part anneal within the integrated construct of Bt11 corn. Both parts of primer Bt11-1 were separately compared against Genbank. The &genomic' part showed high similarities with corn-speci"c sequences whereas the &transgenic' part showed high
213
lwt/vol. 33 (2000) No. 3
Fig. 2 Map of the transgenic construct in the Bt11-corn genome including the cryIA(b)-cassette, the pat-cassette and the sequences derived from the transformation vector (top) and speci"c location of the primers used in the Bt11 PCR-system (bottom). The black 3 site of primer Bt11-1 represents the &transgenic' part whereas the grey 5 site represents the &genomic' part (for details see text)
similarities with arti"cial cloning vectors (data not shown). The second primer (Bt11-2) was designed to bind to a unique sequence within the transgenic construct. This way, a highly speci"c PCR-system yielding a 207 bp product was created avoiding the ampli"cation of the repeated DNA in the corn genome. The annealing temperature of the Bt11-system was optimized using a temperature range of 54}68 3C on a RoboCycler Gradient cycler. Good ampli"cation results were obtained with annealing temperatures between 54 and 60 3C (data not shown). In order to ascertain a robust, sensitive and speci"c detection method, an annealing temperature of 58 3C was chosen for further experiments.
Specixcity of the Bt11 PCR-system The speci"city of the Bt11-system towards the transgenic construct itself and the integration site of the construct in the Bt11-genome was veri"ed. This was done by amplifying DNA from conventional and di!erent genetically modi"ed corns with the Bt11 PCR-system. For that reason, DNA was extracted from genetically modi"ed corns such as Bt11 and Bt176 (Novartis), LibertyLink2+ T25 (AgrEvo, Germany), MaisGard2+ (Monsanto, U.S.A.) and from conventional, nonmodi"ed corn. DNA from each corn was then ampli"ed using the Bt11-system described above and analysed on an agarose gel (Fig. 3). Only ampli"cation of DNA obtained from Bt11-corn resulted in a PCR product at the expected size of 207 bp (Fig. 3, lane 2), whereas the conventional corn as well as the other genetically modi"ed corns tested did not produce ampli"cation products (Fig. 3, lanes 3}6). To check for putative PCR inhibitors, all corn DNA samples were further ampli"ed with a corn-speci"c system amplifying sequences of the high mobility group protein using primers hm3 and hm4 (4). The fact that all corn samples yielded the expected amplicon at 175 bp (Fig. 3, lanes 8}12) showed that the lack of the 207 bp amplicon in Fig. 3 (lanes 3}6) was not due to the presence of substances inhibiting PCR, thereby demonstrating the
Fig. 3 Speci"city of the Bt11 PCR-system for the transgenic construct: Bt11, Bt176, MaisGard2+, LibertyLink2+ T25 and conventional corn ampli"ed with the Bt11-system (lanes 2}6, respectively) and with the corn-speci"c hm-system (lanes 8}12, respectively). Lanes 1, 7 and 13: size marker VIII (Boehringer Mannheim): 1114, 900, 692, 501, 489, 404, 320, 242, 190, 147, 124, 110, 67 and 37/34/24/19 bp
speci"city of the Bt11 PCR-system for the genetically modi"ed Bt11-corn. To check the speci"city of the Bt11-system for the integration site of the transgenic construct (i.e. for the Bt11&event'), primer Bt11-3 was designed. Primer Bt11-3 contained the same 3 half (&transgenic' part) but an inverted 5 half (&genomic' part) as primer Bt11-1. This way, primers Bt11-1 and Bt11-3 have the same base composition and &transgenic' part but primer Bt11-3 lacks the correct &genomic' part to bind to the corn genome adjacent to the transgenic construct. This way, it could be tested if both parts of primer Bt11-1 (&transgenic' and &genomic') were needed for successful ampli"cation or if a correct &transgenic' half would be su$cient (as with primer Bt11-3). If only the &transgenic' part was needed for successful ampli"cation, the Bt11 PCR-system could not distinguish between various corns containing the identical construct at di!erent genomic loci. To check this, Bt11-DNA was ampli"ed with primers Bt111/Bt11-2, with primers Bt11-2/Bt11-3 or with all three primers (Fig. 4, lane 2}4, respectively). The fact that Bt11-DNA could only be successfully ampli"ed using both primers Bt11-1 and Bt11-2 (Fig. 4, lanes 2, 4) but not using primer Bt11-3 (Fig. 4, lane 3) clearly demonstrates that both parts of primer Bt11-1 are necessary for correct ampli"cation of the sequence. These data indicate that the novel Bt11 PCR-system is not only speci"c towards the transgenic construct but also towards the putative integration site of the construct in the Bt11 genome.
Detection limit of the Bt11 PCR system To evaluate the detection limit of the Bt11 PCR-system, DNA was extracted from the transgenic Bt11 corn, digested with RNase, quanti"ed using absorption at 260 nm and adjusted with TE to 50 kg/mL. Tenfold serial dilutions ranging from 500 ng DNA to 5 pg DNA per reaction were ampli"ed using the Bt11-system and subsequently analysed on an agarose gel. Ampli"cation products were clearly detected when as little as 500 pg DNA was ampli"ed with the Bt11-system (data not shown).
Use of the Bt11 PCR in quantitative analysis In order to use the Bt11 PCR-system for quantitative analysis of Bt11-corn in food samples, the Bt11-system
214
lwt/vol. 33 (2000) No. 3
Fig. 4 Speci"city of the Bt11 PCR-system: Bt11-corn ampli"ed with primers Bt11-1/Bt11-2 (Bt11-system, lane 2); with primers Bt11-2/Bt11-3 (lane 3); and (as a positive control) with all three primers Bt11-1/Bt11-2/Bt11-3 (lane 4). Lanes 1 and 5: size marker as in Fig. 3
was expanded to a qcPCR-system by construction of a competitor DNA. The competitor DNA di!ers from the DNA ampli"ed with the Bt11 PCR-system only in length but not in the primer sequences used for ampli"cation. By coampli"cation of an unknown amount of sequence to be quanti"ed with a known amount of competitor DNA (using the same pair of primers), the ratio of the products remains constant through the ampli"cation process and can be readily used for quantitation. This technology was "rst described in 1990 (15) and is widely used today (16, 17). The 229 bp competitor used for quantitation of Bt11 corn was constructed by insertion of a 22 bp fragment into the 207 bp ampli"cation product of the Bt11 PCR-system. This was done using the primers muta1 and muta2 (see Table 1) according to (8). The inserted sequence contains an EcoRI restriction site for subsequent identi"cation. After construction, the competitor was sequenced by cycle sequencing using Bt11-1 and Bt11-2 as sequencing primers. In particular, primer binding sequences and the EcoRI recognition site were controlled and found to be unchanged. The competitor was then cloned into plasmid pCR2.1 to produce the recombinant plasmid pBt11. Plasmid pBt11 was grown in E. coli cells, extracted and linearized with the restriction enzyme EcoRV. The linearized pBt11 containing the 229 bp competitor sequence was then used for calibration of the qcPCR-system. Calibration of the competitor was done by adjusting the amount of linearized pBt11 such that the equivalence point (i.e. the amount of pBt11 at which the molar ratio of target vs. standard equals one) represented a Bt11content of 1% in total corn DNA. For this purpose, DNA was extracted from Bt11 and from conventional corn, quanti"ed using GeneQuant II and mixed to obtain a mixture containing 1% Bt11DNA. Then, di!erent amounts of the linearized competitor pBt11 (from 50}1 fg) were coampli"ed with 200 ng DNA containing 1% Bt11-DNA, separated on a 1.5% agarose gel (Fig. 5a) and analysed using gel analysis software and linear regression (Fig. 5b) as described in Materials and Methods section. In addition to the two ampli"cation products (target at 207 bp and competitor at 229 bp), a third band at approximately 275 bp can be observed on the gel (Fig. 5a). This additional band rep-
Fig. 5 Calibration of the Bt11 system to a 1% GMO content. (a), coampli"cation of 200 ng DNA containing 1% Bt11-DNA with primers Bt11-1/Bt11-2 using 50 fg (lane 2), 40 fg (lane 3), 30 fg (lane 4), 20 fg (lane 5), 10 fg (lane 6) and 1 fg (lane 7) of competitor. (b), linear regression plot to calculate the exact equivalence point of the Bt11-system (calculations as described in Materials and Methods section)
resents a heteroduplex DNA consisting of DNA strands from both the target and the competitor. The formation of such a complex can sometimes be observed when performing qcPCR, and the conditions preventing it are not yet well understood. The 1% equivalence point for linearised pBt11 was calculated to be 10.8 fg by a linear regression plot (Fig. 5b). This value was "nally con"rmed in a control experiment (data not shown). Alternatively, this Bt11 PCR-system could be adapted for use in a realtime PCR assay using TaqMan2+, LightCycler2+ or iCycler2+ technology.
Conclusions In summary, this work describes the design and development of a novel and unambiguous PCR-system used for the quantitative detection of the genetically modi"ed corn Bt11. By sequencing the genomic sequence adjacent to the 5 site of the integrated construct and subsequently using this sequence as ampli"cation target, the PCRsystem is not only speci"c for the transgenic construct but also for the integration site of the construct, i.e. the transfection event. This quantitative PCR, which can readily be used for labelling and control in GMO surveillance, is able to distinguish between di!erent genetically modi"ed crops even if they contain the same integrated construct.
Acknowledgements We would like to thank Dr Patricia Ahl Goy (Novartis) for providing information about Bt11-corn, Dr Martin Schrott for carefully reading the manuscript and MarieLuise Zahno for doing the cloning work. This work was
215
lwt/vol. 33 (2000) No. 3
supported by a grant from the Swiss Federal O$ce for Education and Science (C96.0253) and was part of a research project of the European Union (CSMT4-CT962072).
References 1 HEMMER, W. Foods derived from genetically modi"ed organisms and detection methods. BA¹S Report 2, BATS, Clarastrasse 13, CH-4058 Basel, ISSN 1420-228X (1997) 2 O.cial Journal of the European Communities, No L 43/1-5 Regulation (EC) No 258/97 of the European Parliament and of the Council of 27 January 1997 concerning novel foods and novel food ingredients. (1997) 3 &Lebensmittelverordnung' (Swiss Food Ordinance) of 1 March 1995 and 14 June 1999, SR 817.02. EidgenoK ssische Drucksachen und Materialzentrale, CH-3003 Bern 4 ZIMMERMANN, A., HEMMER, W., LINIGER, M., LUG THY, J. AND PAULI, U. A sensitive detection method for genetically modi"ed Maisgard2+ corn using a nested PCR-system. ¸ebensmittel-=issenschaft und-¹echnologie, 31, 664}667 (1998) 5 MEYER, R. Detection of genetically engineered plants by polymerase chain reaction (PCR) using the FLAVR SAVR tomato as an example. Zeitschrift fu( r ¸ebensmittel-;ntersuchung und-Forschung A, 201, 583}586 (1995) 6 KOG PPEL, E., STADLER, M., LUG THY, J. AND HUG BNER, P. Sensitive Nachweismethode fuK r die gentechnisch veraK nderte Sojabohne &Roundup Ready2+'. Mitteilungen aus dem Gebiet der ¸ebensmittel und Hygiene, 88, 164}175 (1997) 7 STUDER, E., DAHINDEN, I., LUG THY, J. AND HUG BNER, P. Nachweis des gentechnisch veraK nderten &Maximizer'-Mais mittels der Polymerase-Kettenreaktion (PCR). Mitteilungen aus dem Gebiet der ¸ebensmittel und Hygiene, 88, 515}524 (1997)
8 STUDER, E., RHYNER, C., LUG THY, J. AND HUG BNER, P. Quantitative competitive PCR for the detection of genetically modi"ed soybean and maize. Zeitschrift fu( r ¸ebensmittel-;ntersuchung und-Forschung A, 207, 207}213 (1998) 9 HARDEGGER, M., BRODMANN, P. AND HERRMANN, A. Quantitative detection of the 35S promoter and the NOS terminator using quantitative competitive PCR. Zeitschrift fu( r ¸ebensmittel-;ntersuchung und-Forschung A, 209, 83}87 (1999) 10 HARTL, D. L. AND OCHMAN, H. Inverse Polymerase Chain Reaction. Methods in Molecular Biology, 58, 293}301 (1996) 11 HUI, E. K.-W., WANG, P.-C. AND LO, S. J. Strategies for cloning cellular #anking DNA sequences from foreign integrants. Cellular and Molecular ¸ife Science, 54, 1403}1411 (1998) 12 OCHMANN, H., AJIOKA, J. W., GARZA, D., HARTL, D. L. Inverse Polymerase Chain Reaction. In: EHRLICH, H. S. (Ed.) PCR ¹echnology: Principles and Applications for DNA Ampli,cation. New York: Stockton Press, pp. 759}760 (1989) 13 Internet site of the National Center of Biotechnology Information: www.ncbi.nlm.nih.gov/blast/blast.cgi 14 DENNIS, E. S. AND PEACOCK, W. J. Knob heterochromatin homology in maize and its relatives. Journal of Molecular Evolution, 20, 341}350 (1984) 15 GILLILAND, G., PERRIN, S., BLANCHARD, K. AND BUNN, H. F. Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction. Proceedings of the National Academy of Sciences ;SA, 87, 2725}2729 (1990) 16 MOLLER, A. AND JANSSON, J. K. Quanti"cation of genetically tagged cyanobacteria in Baltic Sea sediment by competitive PCR. Biotechniques 22, 512}518 (1997) 17 BRICHACEK, B. AND STEVENSON, M. Quantitative competitive RNA PCR for quantitation of virion-associated HIV-1 RNA. Methods 12, 294}299 (1997)
216
Event Speci"c Transgene Detection in Bt11 Corn by Quantitative PCR at the Integration Site Andreas Zimmermann, JuK rg LuK thy and Urs Pauli*
Swiss Federal O$ce of Public Health, 3003 Bern (Switzerland) (Received November 23, 1999, accepted January 19, 2000)
The genetically modixed corn Bt11 from Novartis is widely cultivated for production of foodstuws or fodder. Due to the insertion and expression of a 6.3 kb sequence containing a Bacillus thuringiensis (Bt)-transgene coding for a synthetic cryIA(b) d-endotoxin, the Bt11-corn is resistant against lepidopteran insects, especially against the European corn borer. As labelling of genetically modixed foodstuws is mandatory in many European countries, several methods to detect genetically modixed organisms (GMOs) qualitatively have been described. Since these *conventional+ detection systems are all based on the polymerase chain reaction (PCR) amplifying unique sequences within the integrated transgenic constructs, they may lead to ambiguous results in qualitative and especially in quantitative analysis of GMOs in foodstuws and fodder. In this study, we report the characterization of the genomic sequence at the 5' -site of the integrated transgenic sequence in the Bt11-corn genome using inverse PCR. The integration border was subsequently used to develop a novel and unambiguous PCR detection system covering the integration border at the 5' site of the transgene. The genomic sequence showed high similarities with a corn-specixc 180 bp knob-associated repeat region. By using one primer annealing exactly at the integration border between the transgenic construct and the corn genome and the other within the vector sequence of the transgenic construct, a 207 bp product was amplixed. After insertion of a 22 bp fragment, the amplixcation product was subsequently used as a competitor in quantitative competitive PCR (qcPCR). Finally, the qcPCR-system was calibrated to an equivalence point of 1% Bt11-DNA.
2000 Academic Press Keywords: Genetically Modi"ed Organism (GMO); Bt11 corn; integration site; quantitative PCR; inverse PCR (iPCR)
Introduction Over 30 di!erent genetically modi"ed crops have been approved by the U.S.A. and Europe in recent years (1), and the development of crops with new genetic traits is still one of the main activities of the agro-industry. In western Europe, the marketing and labelling of genetically modi"ed organisms (GMOs) for food use is regulated by the Novel Food Directive (EC) No 258/97 (2) or by national Food Ordinances. The Swiss Food Ordinance, for example, requires labelling of foodstu!s, food components and food processing aids if they include any ingredient consisting of more than 1% of an approved GMO (3). Although no methodology is provided by the Swiss decrees, the detection and labelling of GMOs are mainly based on the detectability of the inserted constructs by the polymerase chain reaction (PCR). Based on the ampli"cation of unique sequences within the inserted
* Author to whom correspondence should be addressed. Fax: 41 31 322 95 74; E-mail: [email protected]
0023-6438/00/030210#07 $35.00/0 2000 Academic Press
constructs, this method o!ers very high sensitivity and speci"city. Many speci"c PCR-systems for di!erent GMOs have been described (4}7), but only a few of them are quantitative. Quantitative PCR-systems are generally based either on competitive coampli"cation of a known amount of competitor DNA with the target DNA (8, 9) or on real-time PCR using the TaqMan2+, LightCycler2+ or iCycler2+ technology. We have developed an extended quantitative PCR-system for the genetically modi"ed Bt11 corn that overcomes two di$culties of &conventional' PCR-systems used in GMO analysis published so far. Firstly, di!erent copy numbers of integrated constructs in di!erent GMOs; and secondly, di!erent GMOs containing identical transgenic constructs. Since integration of a &foreign' DNA sequence into the genome of a plant is unlikely to occur twice at the same genomic locus, the use of a PCRsystem covering the integration border between the construct and the host genome will lead to an unambiguous identi"cation of the GMO, because it is speci"c for the transgenic construct and the integration site. Furthermore, only one integrated construct will be used as ampli"cation target in PCR, leading to a high accuracy in
doi:10.1006/fstl.2000.0637 All articles available online at http://www.idealibrary.com on
210
lwt/vol. 33 (2000) No. 3
quanti"cation independent of how many constructs are integrated in the genome. This work describes the development of a novel PCRsystem for transgenic Bt11-corn using the integration border between the 5 site of the transgenic construct and the corn genome as target for ampli"cation. The genomic DNA was characterized using inverse PCR (iPCR), sequenced and subsequently used to design the unambiguous Bt11 PCR-system. Next, a competitor used for quantitative analysis was constructed by insertion of a 22 bp fragment into the ampli"cation product. The quantitative competitive (qc) PCR-system was "nally tested and calibrated to a equivalence point which corresponds to 1% GMO.
Materials and Methods DNA extraction Kernels of Bt11-corn were germinated for several days, cut into small pieces with a sterile surgical blade and subsequently frozen to !20 3C until further use. DNA extraction was carried out according to the protocol of the NucleonPhytopure-method (Scotlab Biosience, U.S.A.): 100}200 mg of frozen sample tissue was ground in liquid nitrogen to yield a "ne powder and subsequently mixed with 600 kL Reagent 1, 10 kL RNase A (10 mg/mL) and, after vortexing, with 200 kL Reagent 2. The samples were inverted several times and incubated at 65 3C in a waterbath or thermoshaker for 10 min. The samples were then put on ice for 20 min before adding 500 kL chloroform and 100 kL NucleonPhytopure DNA Extraction Silica Suspension. After incubation at room temperature for 10 min on a shaker and centrifugation for another 10 min at 1,300;g, the upper phase was transferred to a 1.5 mL Eppendorf tube. DNA was precipitated with 800 kL cold (!20 3C) isopropanol for 30 min at room temperature. The samples were inverted several times and centrifuged for 5 min at 6,000;g (4 3C). The supernatant was discarded and the pellet was washed once with 500 kL cold (!20 3C) ethanol (70 g/L). The pellet was dried at room temperature for approximately 15 min, dissolved in 50 kL TE (10 mmol/L Tris, pH 8.5; 1 mmol/L EDTA), quanti"ed using GeneQuant II (Pharmacia, Switzerland) and stored until use at !20 3C.
Digestion and ligation of genomic DNA Digestion and ligation of genomic corn DNA was carried out according to (10): 5 kg genomic Bt11 DNA were digested using 20 units of HindIII (Boehringer Mannheim, Switzerland) in a total volume of 25 kL for 2 h at 37 3C. Then, 20 units of HindIII were added and the reaction was extended for 1 h. After digestion, samples were phenol-extracted by adding 150 kL of H O and 200 kL of equilibrated phenol, mixed and brie#y centrifuged in a table centrifuge for phase separation. The upper phase was transferred to a Eppendorf tube, mixed with 200 kL chloroform : isoamylalcohol (24 : 1) and brie#y centrifuged. Then, 150 kL of the upper phase was
transferred to a Eppendorf tube and subsequently precipitated with 15 kL 3 mol/L Na-acetate (pH 5.3) and 300 kL 100 g/L ethanol for at least 1 h at !20 3C. Finally, DNA was centrifuged at 14,000 rpm for 20 min, washed once with 500 kL 70 g/L ethanol, air dried at room temperature for 15 min and dissolved in 50 kL H O. The concentration of the digested Bt11-DNA was determined using GeneQuant II. The e$ciency of digestion was visually controlled by comparing digested and undigested Bt11-DNA on a 1 g/L agarose gel. In the ligation step, 950 ng digested Bt11-DNA was ligated with 0.05 units T4 DNA ligase (Boehringer Mannheim, Switzerland). The ligation was carried out in a waterbath at 14 3C for 18 h in a total volume of 100 kL. The ligase was subsequently heat inactivated at 75 3C for 15 min and the DNA was phenol-extracted as described above. The pellet was resuspended in 10 kL TE (10 mmol/L Tris, pH 8.5; 1 mmol/L EDTA).
Polymerase chain reaction (PCR) An iPCR system for the characterization of the genomic sequence adjacent to the integration site of the transgenic construct in Bt11-corn and a qcPCR system for the quanti"cation of Bt11-corn was developed. All PCRs were carried out on a RoboCycler Gradient 40 thermal cycler (Stratagene, Germany) with hot top assembly. The ampli"cation products (20 kL) were separated using a 2 g/L agarose gel (MS-agarose, Boehringer Mannheim Switzerland) in 1;TBE bu!er (45 mmol/L Tris-borate; 1 mmol/L EDTA, pH 8.3), and visualized by UV after staining for 10 min in a 1 kg/mL ethidium bromide solution. All primers used in this work were designed using the primer analysis software &Oligo 5.0' (NBI, Plymouth, U.S.A.). Primers (Microsynth GmbH, Switzerland) were diluted to 20 kmol/L and stored at !20 3C. Inverse PCR. All iPCR assays were performed in "nal volumes of 50 kL in 0.5 mL tubes containing 1;reaction bu!er (50 mmol/L KCl; 10 mmol/L Tris-HCl; pH 9); 1.5 mmol/L MgCl , 0.2 mmol/L each of dATP, dGTP, dTTP and dCTP; 0.5 kmol/L of each primer, 1.5 units of Taq polymerase (Pharmacia Biotech, Switzerland), 4 kL template in the "rst iPCR and 1 kL in the nested iPCR. Primers were used in the ampli"cation reactions under the following conditions: OuterA/outerB. First denaturation 10 min at 95 3C; 35 cycles (1 min 20 s at 95 3C, 1 min 30 s at 56 3C, 2 min 30 s at 72 3C), terminal elongation 4 min 30 s at 72 3C. InnerA/innerB. First denaturation 3 min 30 s at 95 3C; 30 cycles (1 min 20 s at 95 3C, 1 min 30 s at 56 3C, 2 min 30 s at 72 3C), terminal elongation 4 min 30 s at 72 3C. Quantitative competitive PCR. All qcPCR assays were performed in "nal volumes of 50 kL in 0.5 mL tubes containing 1;reaction bu!er (50 mmol/L KCl; 10 mmol/L Tris-HCl; pH 9); 2.5 mmol/L MgCl , 2 kg/mL BSA, 0.2 mmol/L each of dATP, dGTP, dTTP and dCTP; 0.5 kmol/L of each primer, 1.5 units of Taq
211
lwt/vol. 33 (2000) No. 3
polymerase (Pharmacia Biotech) and 200 ng template DNA. For con"rmation of the optimized protocol, the qcPCR assays using primers Bt11-1, Bt11-2 and Bt11-3 were additionally carried out on a PTC 200 cycler (MJ Research, Massachusetts U.S.A.). Primers were used in the ampli"cation reactions under the following conditions:
Bt11-1 and Bt11-2. Due to the insertion of an EcoRI restriction site into the complementary tail sequences, the ampli"cation product was controlled by digesting with 20 units of EcoRI (Boehringer Mannheim) in a total volume of 25 kL at 37 3C for 2 h and subsequently separated on a 2 g/L agarose gel.
Bt11-1/muta1 and Bt11-2/muta2. First denaturation 3 min 30 s at 95 3C; 40 cycles (1 min 20 s at 95 3C, 1 min 30 s at 58 3C, 2 min 30 s at 72 3C), terminal elongation 4 min 30 s at 72 3C.
Cloning of the competitor Cloning of competitor into plasmid pCR2.1 TOPO (Invitrogen, Netherlands) was carried out according to the protocol of the kit. After transformation, the TOP10 E.coli cells were selected by blue/white screening and grown overnight in 25 mL LB (10 g/L tryptone, 5 g/L yeast-extract, 10 g/L NaCl, pH 7.5) containing 100 kg/mL ampicillin. Plasmid extraction was carried out using the Qiagen Plasmid Midi Kit (Qiagen, Switzerland). The plasmid was con"rmed as containing the correct competitor sequence by cycle sequencing (Microsynth GmbH, Switzerland), named pBt11 and subsequently linearized using 20 units EcoRV in a total volume of 200 kL at 37 3C for 2 h. After phenol extraction using "rst an equal volume of phenol : chloroform : isoamylalcohol (25 : 24 : 1) and then an equal volume of chloroform, the linearized pBt11 was ethanol precipitated, quanti"ed with the GeneQuant II (Pharmacia Biotech) and used for calibration of the qcPCR-system.
Bt11-1/Bt11-2 and Bt11-1/Bt11-3. (a) RoboCycler : Gradient cycler: "rst denaturation 3 min 30 s at 95 3C; 40 cycles (1 min 20 s at 95 3C, 1 min 30 s at 58 3C, 2 min 30 s at 72 3C), terminal elongation 4 min 30 s at 72 3C. (b) PTC 200 cycler: "rst denaturation 3 min at 95 3C; 40 cycles (30 s at 95 3C, 40 s at 58 3C, 1 min at 72 3C), terminal elongation 3 min 30 s at 72 3C.
Construction of the competitor Construction of the competitor was carried out according to (8). Two separate PCR assays were performed using the ampli"cation product of the Bt11-system using one of the original primers (Bt11-1 or Bt11-2) in combination with a new designed mutagenic primer (muta1 or muta2). Primers muta1 and muta2 both carry a complementary tail sequence at the 5 site (see Table 1) and anneal immediately adjacent to each other on the target DNA. The two ampli"cation products from Bt111/muta1 and Bt11-2/muta2 were separated on a 2 g/L agarose gel using MS-agarose (Boehringer Mannheim), excised from the gel using the &Agarose Gel DNA Extraction Kit' (Boehringer Mannheim) and resuspended in 50 kL H O. Then, 20 kL of each ampli"ed product was mixed with 10 nmol of each dNTP and with 5 kL 10;EcoPol bu!er (10 mmol/L Tris-HCl pH 7.5, 5 mmol/L MgCl , 7.5 mmol/L dithiothreitol) (BioCon cept, Switzerland), heated to 95 3C for 3 min and cooled down to 37 3C in a waterbath. Five units of Klenow polymerase (BioConcept) were added and the mixture was incubated at 37 3C for 1 h. Next, 10 kL of the elongated product was directly ampli"ed using primers
Calibration of qcPCR Calibration of pBt11 to an equivalence point which corresponds to 1% GMO was done by coamplifying 200 ng of DNA mixtures containing 1% of Bt11-DNA in conventional corn DNA with 50 fg, 40 fg, 30 fg, 20 fg, 10 fg or 1 fg of linearized pBt11. Conditions of ampli"cation were as described for primers Bt11-1 and Bt11-2. The ampli"cation product was separated on a 1.5% agarose gel, visualized by UV after staining for 10 min in a 1 kg/mL ethidium bromide solution and digitized using a CCD camera. The amounts of the ampli"ed products were determined using gel picture analysis software (ONEDscan, Scanalytics Inc., U.S.A.) and corrected with respect to their molecular weights. This was done by multiplying the calculated amount of the (shorter) target DNA signal with a factor of 1.11, which represents the ratio of
Table 1 Sequences and purposes of primers. The underlined regions in primers muta1 and muta2 represent the complementary tail sequences, whereas the underlined sequences in primers Bt11-1 and Bt11-3 depict the inverted parts (for details see text) Name
Sequence 5 P3
Purpose
innerA innerB outerA outerB muta1 muta2 Bt11-1 Bt11-2 Bt11-3
GGTCTGACGCTCAGTGGAAC CGGTCTTGCGATGATTATCA GCTCTTGATCCGGCAAACAA CAAGCGTTTTCACCCTTAGC TTAGCACGGAATTCTGAACGTCAAGGATCTCAAGAAGATCCT GACGTTCAGAATTCCGTGCTAATTTTTCTGCGCGTAATCTGC TATCATCGACTTCCATGACCA AGCCAGTTACCTTCGGAAAA TCAGCTACTATTCCATGACCA
212
inverse PCR inverse PCR inverse PCR inverse PCR int. standard int. standard qcPCR qcPCR qcPCR control
lwt/vol. 33 (2000) No. 3
the lengths of the competitor (227 bp) and from the target (207 bp). Furthermore, the amounts of the heteroduplexes were divided proportional to the corresponding ampli"cation signal according to their molecular weights as described above. Finally, the equivalence point was determined using a linear regression plot between the logarithm of the ratio of the amount of ampli"cation products (amount of ampli"ed target DNA divided by amount of ampli"ed competitor DNA) and the logarithm of the initial amount of competitor DNA (8).
Results and Discussion Characterization of the genomic sequence adjacent to the 5 site of the transgenic construct in Bt11-corn The inserted sequence in the Bt11-corn genome basically consists of a cryIA(b)-transgene mediating resistance against the European corn borer, a pat-transgene for herbicide tolerance and of an approximately 1.1 kb vector sequence (Novartis, personal communication). The aim of this work was to design a single PCR-system for quantitative analysis of Bt11-corn using the integration border between the genome and the 5 site of the integrated construct as ampli"cation target. By using this approach, an unambiguous identi"cation and quanti"cation of Bt11-corn would be achieved, even if other genetically modi"ed crops contained the same transgenic construct. Many di!erent strategies have been described to amplify and subsequently characterize unknown DNA sequences adjacent to a known sequence (for a review see 11). Inverse PCR as a universally applicable and relatively fast method has been chosen. This is an extension of conventional PCR which allows the ampli"cation of unknown sequences without the need for cloning (10, 12). Its principle is delineated in Fig. 1. After digestion of genomic DNA from the target tissue with an appropriate digestion enzyme (step 1), the DNA fragments are subsequently self-ligated under conditions which favour the formation of monomeric circles (step 2). Within this circularized form of DNA, a nested PCR is used to amplify the junction region by primers in opposite directions of the known integrand sequence (step 3). Genomic DNA was extracted from Bt11-corn leaf tissue, quanti"ed, digested using HindIII and "nally religated. In order to favour intramolecular ligation (i.e. self-ligation), ligation reactions of digested Bt11-DNA were performed with di!erent amounts of DNA and T4 DNA ligase (data not shown). This step turned out to be critical, since too much DNA favours ligation of di!erent molecules and will lead to unspeci"c ampli"cation. On the other hand, too little DNA will not be ampli"ed in the subsequent PCR due to the low e$ciency of ligation (10). After ligation, DNA was ampli"ed using the nested iPCR-system and characterized on a 2% agarose gel. The ampli"cation product was excised from the gel and subsequently sequenced by cycle sequencing. The obtained sequence of the putative genomic integration border was then compared to the database of the National Center of Biotechnology Information (13) and turned
Fig. 1 Strategy used for inverse PCR. The bold bar indicates the known sequence of the construct, the thin line the unknown genomic corn sequence. The cross marks on the arrows indicate that no primer annealing will occur in circularized DNA in contrast to circularized DNA with 5 site of integrated DNA. For details see text (adapted from 9)
out to show high homology to a corn-speci"c 180 bp knob-speci"c repeat (data not shown). This repeat is postulated to be the major DNA sequence component of knob heterochromatin in corn (14).
Design of an unambiguous Bt11 PCR-system After characterization of the putative sequence at the integration border, an unambiguous Bt11 PCR-system covering the integration border of the transgenic construct and the corn genome was designed. Since the use of the 180 bp knob-speci"c repeat as target in the PCRsystem led to the formation of unspeci"c ampli"cation signals (data not shown), the primer annealing in the genome (Bt11-1) was designed to cover exactly the integration border between the transgenic construct and the corn genome, thereby containing a &genomic' and a &transgenic' part (Fig. 2). The &genomic' part of primer Bt11-1 contains 11 bases which bind to the genomic sequence directly adjacent of the integration site, whereas the 10 bases of the &transgenic' part anneal within the integrated construct of Bt11 corn. Both parts of primer Bt11-1 were separately compared against Genbank. The &genomic' part showed high similarities with corn-speci"c sequences whereas the &transgenic' part showed high
213
lwt/vol. 33 (2000) No. 3
Fig. 2 Map of the transgenic construct in the Bt11-corn genome including the cryIA(b)-cassette, the pat-cassette and the sequences derived from the transformation vector (top) and speci"c location of the primers used in the Bt11 PCR-system (bottom). The black 3 site of primer Bt11-1 represents the &transgenic' part whereas the grey 5 site represents the &genomic' part (for details see text)
similarities with arti"cial cloning vectors (data not shown). The second primer (Bt11-2) was designed to bind to a unique sequence within the transgenic construct. This way, a highly speci"c PCR-system yielding a 207 bp product was created avoiding the ampli"cation of the repeated DNA in the corn genome. The annealing temperature of the Bt11-system was optimized using a temperature range of 54}68 3C on a RoboCycler Gradient cycler. Good ampli"cation results were obtained with annealing temperatures between 54 and 60 3C (data not shown). In order to ascertain a robust, sensitive and speci"c detection method, an annealing temperature of 58 3C was chosen for further experiments.
Specixcity of the Bt11 PCR-system The speci"city of the Bt11-system towards the transgenic construct itself and the integration site of the construct in the Bt11-genome was veri"ed. This was done by amplifying DNA from conventional and di!erent genetically modi"ed corns with the Bt11 PCR-system. For that reason, DNA was extracted from genetically modi"ed corns such as Bt11 and Bt176 (Novartis), LibertyLink2+ T25 (AgrEvo, Germany), MaisGard2+ (Monsanto, U.S.A.) and from conventional, nonmodi"ed corn. DNA from each corn was then ampli"ed using the Bt11-system described above and analysed on an agarose gel (Fig. 3). Only ampli"cation of DNA obtained from Bt11-corn resulted in a PCR product at the expected size of 207 bp (Fig. 3, lane 2), whereas the conventional corn as well as the other genetically modi"ed corns tested did not produce ampli"cation products (Fig. 3, lanes 3}6). To check for putative PCR inhibitors, all corn DNA samples were further ampli"ed with a corn-speci"c system amplifying sequences of the high mobility group protein using primers hm3 and hm4 (4). The fact that all corn samples yielded the expected amplicon at 175 bp (Fig. 3, lanes 8}12) showed that the lack of the 207 bp amplicon in Fig. 3 (lanes 3}6) was not due to the presence of substances inhibiting PCR, thereby demonstrating the
Fig. 3 Speci"city of the Bt11 PCR-system for the transgenic construct: Bt11, Bt176, MaisGard2+, LibertyLink2+ T25 and conventional corn ampli"ed with the Bt11-system (lanes 2}6, respectively) and with the corn-speci"c hm-system (lanes 8}12, respectively). Lanes 1, 7 and 13: size marker VIII (Boehringer Mannheim): 1114, 900, 692, 501, 489, 404, 320, 242, 190, 147, 124, 110, 67 and 37/34/24/19 bp
speci"city of the Bt11 PCR-system for the genetically modi"ed Bt11-corn. To check the speci"city of the Bt11-system for the integration site of the transgenic construct (i.e. for the Bt11&event'), primer Bt11-3 was designed. Primer Bt11-3 contained the same 3 half (&transgenic' part) but an inverted 5 half (&genomic' part) as primer Bt11-1. This way, primers Bt11-1 and Bt11-3 have the same base composition and &transgenic' part but primer Bt11-3 lacks the correct &genomic' part to bind to the corn genome adjacent to the transgenic construct. This way, it could be tested if both parts of primer Bt11-1 (&transgenic' and &genomic') were needed for successful ampli"cation or if a correct &transgenic' half would be su$cient (as with primer Bt11-3). If only the &transgenic' part was needed for successful ampli"cation, the Bt11 PCR-system could not distinguish between various corns containing the identical construct at di!erent genomic loci. To check this, Bt11-DNA was ampli"ed with primers Bt111/Bt11-2, with primers Bt11-2/Bt11-3 or with all three primers (Fig. 4, lane 2}4, respectively). The fact that Bt11-DNA could only be successfully ampli"ed using both primers Bt11-1 and Bt11-2 (Fig. 4, lanes 2, 4) but not using primer Bt11-3 (Fig. 4, lane 3) clearly demonstrates that both parts of primer Bt11-1 are necessary for correct ampli"cation of the sequence. These data indicate that the novel Bt11 PCR-system is not only speci"c towards the transgenic construct but also towards the putative integration site of the construct in the Bt11 genome.
Detection limit of the Bt11 PCR system To evaluate the detection limit of the Bt11 PCR-system, DNA was extracted from the transgenic Bt11 corn, digested with RNase, quanti"ed using absorption at 260 nm and adjusted with TE to 50 kg/mL. Tenfold serial dilutions ranging from 500 ng DNA to 5 pg DNA per reaction were ampli"ed using the Bt11-system and subsequently analysed on an agarose gel. Ampli"cation products were clearly detected when as little as 500 pg DNA was ampli"ed with the Bt11-system (data not shown).
Use of the Bt11 PCR in quantitative analysis In order to use the Bt11 PCR-system for quantitative analysis of Bt11-corn in food samples, the Bt11-system
214
lwt/vol. 33 (2000) No. 3
Fig. 4 Speci"city of the Bt11 PCR-system: Bt11-corn ampli"ed with primers Bt11-1/Bt11-2 (Bt11-system, lane 2); with primers Bt11-2/Bt11-3 (lane 3); and (as a positive control) with all three primers Bt11-1/Bt11-2/Bt11-3 (lane 4). Lanes 1 and 5: size marker as in Fig. 3
was expanded to a qcPCR-system by construction of a competitor DNA. The competitor DNA di!ers from the DNA ampli"ed with the Bt11 PCR-system only in length but not in the primer sequences used for ampli"cation. By coampli"cation of an unknown amount of sequence to be quanti"ed with a known amount of competitor DNA (using the same pair of primers), the ratio of the products remains constant through the ampli"cation process and can be readily used for quantitation. This technology was "rst described in 1990 (15) and is widely used today (16, 17). The 229 bp competitor used for quantitation of Bt11 corn was constructed by insertion of a 22 bp fragment into the 207 bp ampli"cation product of the Bt11 PCR-system. This was done using the primers muta1 and muta2 (see Table 1) according to (8). The inserted sequence contains an EcoRI restriction site for subsequent identi"cation. After construction, the competitor was sequenced by cycle sequencing using Bt11-1 and Bt11-2 as sequencing primers. In particular, primer binding sequences and the EcoRI recognition site were controlled and found to be unchanged. The competitor was then cloned into plasmid pCR2.1 to produce the recombinant plasmid pBt11. Plasmid pBt11 was grown in E. coli cells, extracted and linearized with the restriction enzyme EcoRV. The linearized pBt11 containing the 229 bp competitor sequence was then used for calibration of the qcPCR-system. Calibration of the competitor was done by adjusting the amount of linearized pBt11 such that the equivalence point (i.e. the amount of pBt11 at which the molar ratio of target vs. standard equals one) represented a Bt11content of 1% in total corn DNA. For this purpose, DNA was extracted from Bt11 and from conventional corn, quanti"ed using GeneQuant II and mixed to obtain a mixture containing 1% Bt11DNA. Then, di!erent amounts of the linearized competitor pBt11 (from 50}1 fg) were coampli"ed with 200 ng DNA containing 1% Bt11-DNA, separated on a 1.5% agarose gel (Fig. 5a) and analysed using gel analysis software and linear regression (Fig. 5b) as described in Materials and Methods section. In addition to the two ampli"cation products (target at 207 bp and competitor at 229 bp), a third band at approximately 275 bp can be observed on the gel (Fig. 5a). This additional band rep-
Fig. 5 Calibration of the Bt11 system to a 1% GMO content. (a), coampli"cation of 200 ng DNA containing 1% Bt11-DNA with primers Bt11-1/Bt11-2 using 50 fg (lane 2), 40 fg (lane 3), 30 fg (lane 4), 20 fg (lane 5), 10 fg (lane 6) and 1 fg (lane 7) of competitor. (b), linear regression plot to calculate the exact equivalence point of the Bt11-system (calculations as described in Materials and Methods section)
resents a heteroduplex DNA consisting of DNA strands from both the target and the competitor. The formation of such a complex can sometimes be observed when performing qcPCR, and the conditions preventing it are not yet well understood. The 1% equivalence point for linearised pBt11 was calculated to be 10.8 fg by a linear regression plot (Fig. 5b). This value was "nally con"rmed in a control experiment (data not shown). Alternatively, this Bt11 PCR-system could be adapted for use in a realtime PCR assay using TaqMan2+, LightCycler2+ or iCycler2+ technology.
Conclusions In summary, this work describes the design and development of a novel and unambiguous PCR-system used for the quantitative detection of the genetically modi"ed corn Bt11. By sequencing the genomic sequence adjacent to the 5 site of the integrated construct and subsequently using this sequence as ampli"cation target, the PCRsystem is not only speci"c for the transgenic construct but also for the integration site of the construct, i.e. the transfection event. This quantitative PCR, which can readily be used for labelling and control in GMO surveillance, is able to distinguish between di!erent genetically modi"ed crops even if they contain the same integrated construct.
Acknowledgements We would like to thank Dr Patricia Ahl Goy (Novartis) for providing information about Bt11-corn, Dr Martin Schrott for carefully reading the manuscript and MarieLuise Zahno for doing the cloning work. This work was
215
lwt/vol. 33 (2000) No. 3
supported by a grant from the Swiss Federal O$ce for Education and Science (C96.0253) and was part of a research project of the European Union (CSMT4-CT962072).
References 1 HEMMER, W. Foods derived from genetically modi"ed organisms and detection methods. BA¹S Report 2, BATS, Clarastrasse 13, CH-4058 Basel, ISSN 1420-228X (1997) 2 O.cial Journal of the European Communities, No L 43/1-5 Regulation (EC) No 258/97 of the European Parliament and of the Council of 27 January 1997 concerning novel foods and novel food ingredients. (1997) 3 &Lebensmittelverordnung' (Swiss Food Ordinance) of 1 March 1995 and 14 June 1999, SR 817.02. EidgenoK ssische Drucksachen und Materialzentrale, CH-3003 Bern 4 ZIMMERMANN, A., HEMMER, W., LINIGER, M., LUG THY, J. AND PAULI, U. A sensitive detection method for genetically modi"ed Maisgard2+ corn using a nested PCR-system. ¸ebensmittel-=issenschaft und-¹echnologie, 31, 664}667 (1998) 5 MEYER, R. Detection of genetically engineered plants by polymerase chain reaction (PCR) using the FLAVR SAVR tomato as an example. Zeitschrift fu( r ¸ebensmittel-;ntersuchung und-Forschung A, 201, 583}586 (1995) 6 KOG PPEL, E., STADLER, M., LUG THY, J. AND HUG BNER, P. Sensitive Nachweismethode fuK r die gentechnisch veraK nderte Sojabohne &Roundup Ready2+'. Mitteilungen aus dem Gebiet der ¸ebensmittel und Hygiene, 88, 164}175 (1997) 7 STUDER, E., DAHINDEN, I., LUG THY, J. AND HUG BNER, P. Nachweis des gentechnisch veraK nderten &Maximizer'-Mais mittels der Polymerase-Kettenreaktion (PCR). Mitteilungen aus dem Gebiet der ¸ebensmittel und Hygiene, 88, 515}524 (1997)
8 STUDER, E., RHYNER, C., LUG THY, J. AND HUG BNER, P. Quantitative competitive PCR for the detection of genetically modi"ed soybean and maize. Zeitschrift fu( r ¸ebensmittel-;ntersuchung und-Forschung A, 207, 207}213 (1998) 9 HARDEGGER, M., BRODMANN, P. AND HERRMANN, A. Quantitative detection of the 35S promoter and the NOS terminator using quantitative competitive PCR. Zeitschrift fu( r ¸ebensmittel-;ntersuchung und-Forschung A, 209, 83}87 (1999) 10 HARTL, D. L. AND OCHMAN, H. Inverse Polymerase Chain Reaction. Methods in Molecular Biology, 58, 293}301 (1996) 11 HUI, E. K.-W., WANG, P.-C. AND LO, S. J. Strategies for cloning cellular #anking DNA sequences from foreign integrants. Cellular and Molecular ¸ife Science, 54, 1403}1411 (1998) 12 OCHMANN, H., AJIOKA, J. W., GARZA, D., HARTL, D. L. Inverse Polymerase Chain Reaction. In: EHRLICH, H. S. (Ed.) PCR ¹echnology: Principles and Applications for DNA Ampli,cation. New York: Stockton Press, pp. 759}760 (1989) 13 Internet site of the National Center of Biotechnology Information: www.ncbi.nlm.nih.gov/blast/blast.cgi 14 DENNIS, E. S. AND PEACOCK, W. J. Knob heterochromatin homology in maize and its relatives. Journal of Molecular Evolution, 20, 341}350 (1984) 15 GILLILAND, G., PERRIN, S., BLANCHARD, K. AND BUNN, H. F. Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction. Proceedings of the National Academy of Sciences ;SA, 87, 2725}2729 (1990) 16 MOLLER, A. AND JANSSON, J. K. Quanti"cation of genetically tagged cyanobacteria in Baltic Sea sediment by competitive PCR. Biotechniques 22, 512}518 (1997) 17 BRICHACEK, B. AND STEVENSON, M. Quantitative competitive RNA PCR for quantitation of virion-associated HIV-1 RNA. Methods 12, 294}299 (1997)
216