- Email: [email protected]
EVI-1 modulates arsenic trioxide induced apoptosis through JNK signalling pathway in leukemia cells
Author’s Accepted Manuscript EVI-1 Modulates Arsenic Trioxide induced Apoptosis through JNK signaling pathway in Leukemia Cells Wenjing Lang, Jianyi Zhu, Fangyuan Chen, Jiayi Cai, Jihua Zhong www.elsevier.com/locate/yexcr
PII: DOI: Reference:
S0014-4827(18)30852-8 https://doi.org/10.1016/j.yexcr.2018.11.018 YEXCR11244
To appear in: Experimental Cell Research Received date: 4 September 2018 Revised date: 20 November 2018 Accepted date: 21 November 2018 Cite this article as: Wenjing Lang, Jianyi Zhu, Fangyuan Chen, Jiayi Cai and Jihua Zhong, EVI-1 Modulates Arsenic Trioxide induced Apoptosis through JNK signaling pathway in Leukemia Cells, Experimental Cell Research, https://doi.org/10.1016/j.yexcr.2018.11.018 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
EVI-1 Modulates Arsenic Trioxide induced Apoptosis through JNK signaling pathway in Leukemia Cells Wenjing Lang, MD1, Jianyi Zhu, MD1, Fangyuan Chen, MD*, Jiayi Cai, MD, Jihua Zhong, MD Department of Hematology, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, 160 Pujian Road, Shanghai 200127, China.
*
Corresponding author. Dr. Fangyuan Chen Department of Hematology, Ren Ji Hospital, School of
Medicine, Shanghai Jiao Tong University, 160 Pujian Road, Shanghai, China Tel.: 86-21-68383301; fax: 86-21-58395057. [email protected]
Abstract High expression of the oncogene ecotropic viral integration site-1 (EVI-1) is an independent negative prognostic indicator of survival in leukemia patients. This study aimed to examine the effects of arsenic trioxide (ATO) on EVI-1 in acute myeloid leukemia (AML). Mononuclear cells were isolated from the bone marrow and peripheral blood of AML patients and healthy donors. EVI-1 expression in hematopoietic cells was evaluated by RT-qPCR and Western blot analysis. EVI-1 was highly expressed in both primary AML and leukemia cell lines (THP-1 and K562). ATO down-regulated EVI-1 mRNA in zebrafish in vivo as well as in primary leukemia cells and THP-1 and K562 cells in vitro. Additionally, ATO treatment induced apoptosis, down-regulated both EVI-1 mRNA and oncoprotein expression, increased the expression of pro-apoptosis proteins, and decreased the expression of anti-apoptotic proteins in leukemia cells in vitro. EVI-1 expression in leukemia cells (THP-1 and K562) transduced with EVI-1 siRNA was significantly reduced. Silencing EVI-1 had a significant effect on the activation of the JNK pathway and the induction of leukemia cell apoptosis. ATO may downregulate EVI-1 mRNA and oncoprotein levels and block the inhibitory effects of EVI-1 on the JNK pathway, which activates the JNK apoptotic pathway, thereby leading to the apoptosis of EVI-1 in AML patients.
1
These authors contributed equally to this study. 1
β-actin; AL, acute leukemia; AML, acute myeloid leukemia; APL, acute promyelocytic leukemia; ATO, arsenic trioxide; BCA, bicinchoninic acid; BMMNCs, bone marrow mononuclear cells; BSA, albumin from bovine serum; caspase, cysteinyl aspartate specific proteinase; CCK8, cell counting kit-8; cDNA, complementary deoxyribonucleic acid; d, day; DEPC, Diethypyrocarbonate; DMSO, Dimethylsulfoxide; ECL, Electro-Chemiluminescence; EGFP, enhanced green fluorescent protein; EVI-1, ecotropic viral integration site-1; FACS, fluorescence-activated cell sorting ; FBS, fetal bovine serum; FCM, flow cytometry; Hpf, hour post fertilization; HRP, horseradish peroxidase; HSC, hematopoietic stem cell; IACUC, Institutional Animal Care and Use Committee; JNK, c-Jun N-terminal kinase; M5, acute monocytic leukemia; MAPK, mitogen-activated protein kinases; MDS, myelodysplastic syndromes; min, minute; MM, multiple myeloma; mRNA, messenger ribonucleic acid; NCBI, National Center for Biomedical Information; PBS, optical density buffered saline; PCR, polymerase chain reaction; PI, propidium iodide; PVDF, polyvinylidene difluoride; RT-qPCR, quantitative reverse transcription polymerase chain reaction; RIPA, radio immunoprecipitation assay; PBMCs, peripheral blood mononuclear cells; p-JNK, phosphate c-Jun N-terminal kinase; p-P53, phosphorylated-P53; PUMA, P53 up-regulated modulator of apoptosis; rpm, revolutions per minute; RT-PCR, reverse transcript polymerase chain reaction; sec, second
Abbreviations: ALL, acute lymphocytic leukemia acute leukemia; ACTB,
Keywords: EVI-1, arsenic trioxide, acute leukemia, apoptosis, c-Jun N-terminal kinase. 1. Introduction Acute leukemia is a hematological malignancy with profound heterogeneity and mortality. The pathogenesis and development of acute leukemia is closely associated with certain genetic and chromosomal abnormalities [1]. Accumulated evidence suggests that aberrant transcription machinery could be a key driver for the development of acute leukemia [2]. Ecotropic viral integration site-1 (EVI-1) was first identified as the integration site of the ecotropic retrovirus in a mouse model of acute myeloid leukemia (AML) [3]. EVI-1，since then, has been considered an oncogenic transcription factor in human leukemia. EVI-1 is located on chromosome 3q26. Chromosome 3q26 rearrangements can activate the expression of EVI-1 in myeloid malignancies [4]. Despite the presence of 3q26 rearrangements, overexpression of EVI-1 has become an independent poor prognostic indicator of survival in leukemia patients [5]. The expression of EVI-1 is high in about 10% of patients with AML. In addition, the over-expression of EVI-1 is also identified in other hematologic malignancies and solid tumours [6]. In experimental models, aberrant proto-oncogene EVI-1 expression contributes to leukemogenic potential and resistance 2
to cell apoptosis in hematologic malignancies. Mechanistic studies indicate that the EVI-1 oncoprotein can inhibit c-Jun NH2-terminal kinase (JNK) signalling and prevent stress-induced cell death [7]. However, few studies have pursued the discovery and screening of drugs targeting EVI-1 in AML patients. Arsenic trioxide (As2O3, ATO) is an oldest therapeutic agent used in both traditional Chinese and Western medicine [8]. ATO is one kind of the effective anticancer drugs, particularly for both newly diagnosed and relapsed patients with acute promyelocytic leukemia (APL) [9]. ATO is also a promising general anticancer therapy for other malignancies (e.g., lymphoma, hepatocellular carcinoma and myelodysplastic syndrome [MDS]) [10-12]. ATO may induce malignant cell apoptosis by activating the mitochondria-mediated intrinsic apoptotic pathway. Some former studies suggested that the sustained activation of JNK is crucial in ATO-induced apoptosis [13]. Japanese researchers introduced human EVI-1 gene into mouse fibroblasts and bone marrow cells and found that ATO selectively targets the EVI-1 protein without affecting EVI-1 mRNA [14]. Zebrafish (Danio rerio) is a vertebrate animal model commonly used to examine hematopoiesis and myeloid malignancies [15]. The model is widely implemented to investigate conserved cancer pathways in human malignancies [16] and is a practical and efficient method for screening drugs targeting distinct molecules. To clarify the genetic pathways of oncogenesis related to EVI-1, we previously introduced the human EVI-1 gene into zebrafish one-cell embryos through a heat-shock promoter. Moreover, we established the stable germ-line Tg (AML1-EVI-1: HSE: EGFP) zebrafish [17]. Since its identification in a retroviral site in myeloid leukemia, EVI-1 has been intensely studied for its functions in the regulation of hematologic malignancies [18]. However, few studies have examined targeted medicine screening for EVI-1. We thus targeted at exploring the anticancer functions of ATO and the underlying functions associated with EVI-1 in an in vivo zebrafish model and in AML cells in vitro. 2. Methods 2.1 Ethics statement This work was approved by the Institutional Animal Care and Use Committee of Shanghai Research Centre for Model Organisms (Shanghai, China) (approval ID: 2010-0010). The clinical investigation using primary human material from leukemia patients and healthy volunteers was conducted according to the principles of the 1996 Declaration of Helsinki and was approved by the Joint Committee on Clinical Investigation of Ren Ji Hospital. Written informed consent was obtained from the volunteers and the patients before their inclusion in the study. 2.2 Cells, cell culture, and treatment of cells 3
The cell lines derived from human AML (THP-1) were obtained from ATCC (Manassas, VA, USA) and grown in RPMI containing 10% foetal bovine serum (FBS) (Invitrogen, Carlsbad, CA, USA). The K562, HL-60, U937 and MV4-11 cell lines were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Fresh bone marrow or peripheral blood samples from healthy donors and patients with AML were collected. Isolated primary cells were resuspended to 2.0 × 106/ml in RPMI 1640 medium containing 20% FBS. 2.3 Chemicals and reagents ATO was purchased from Beijing SL Pharmaceutical Co., Ltd. (Beijing, China). Dimethyl sulfoxide (DMSO), SP600125 (a specific inhibitor of JNK), FBS, and bovine serum albumin (BSA) were purchased from Sigma-Aldrich (St. Louis, MO, USA). SP600125 was dissolved in DMSO; for control samples, diluent (0.1% DMSO) was added to the medium. An Annexin V-fluorescein isothiocyanate Apoptosis Detection kit and TRIzol reagent were purchased from Invitrogen Life Technologies (Carlsbad, CA, USA). A first-strand cDNA QuantScript RT kit and Taq DNA Polymerase were purchased from Tiangen Biotech Co., Ltd. (Beijing, China). The Cell Counting kit-8 (CCK-8) was purchased from Dojindo Laboratories (Kumamoto, Japan). An SDS-PAGE (sodium dodecyl sulfate polyacrylamide electrophoresis) gel quick preparation kit, RIPA (radio immunoprecipitation assay) lysis buffer and an enhanced BCA (bicinchoninic acid) protein assay kit were purchased from Beyotime Institute of Biotechnology (Shanghai, China). Anti-EVI-1, anti-JNK, anti-phosphorylated-JNK (p-JNK), anti-phosphorylated-P53 (p-P53), anti-PUMA, anti-Bax, anti-Bcl-2, anti-Bcl-xL, anti-caspase-9, and anti-caspase-3 antibodies were obtained from Cell Signaling Technology, Inc. (Danvers, MA, USA). Anti-β-actin antibody was purchased from Abmart (Arlington, MA, USA). Horseradish peroxidase-conjugated secondary antibodies were purchased from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA, USA). Lipofectamine 2000 (lipo 2000), trypsin, Opti-MEM, and penicillin-streptomycin were purchased from Invitrogen Corporation (Carlsbad, CA, USA). 2.4 Zebrafish embryo collection and drug treatment Tg (AML1-EVI-1: HSE: EGFP) transgenic zebrafish embryos were generated by natural pair-wise mating and were raised at 28.5°C in embryo water. The embryos were heat shocked at 38°C for 1 h once between 14 to 18 hpf to induce EGFP expression and EVI-1 phenotypes. EGFP-positive embryos were screened under a fluorescence microscope at 24 hpf. Healthy, hatched zebrafish embryos were selected at 24 hpf and treated with different concentrations of ATO (diluted in embryo water directly); the embryos were then incubated in 6-well plates (10 embryos/well) at 28.5°C from 24 to 72 hpf. During this period, the larvae were observed for survival and morphology under an inverted microscope (Olympus Corporation, Tokyo, Japan) (at both 10× magnification and 100× magnification). LC50 was defined as the concentration that 4
resulted in the 50% mortality of zebrafish embryos treated with ATO. The assay was repeated three times independently with 40 embryos per group. 2.5 Reverse transcription polymerase chain reaction (RT- PCR) and quantitative RT-PCR (RT-qPCR) Total RNA was extracted from bone marrow mononuclear cells (BMMNCs) or peripheral blood mononuclear cells (PBMCs) from patients or cell lines using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). RNA was reverse-transcribed with Superscript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). Primer sequences were synthesized by Shanghai Sangon Biological Engineering Co., Ltd. The expression of EVI-1 was examined by gene-specific RT-qPCR (Applied Biosystems, Foster City, CA, USA). B-actin (ACTB) was used as the internal control. PCR products from the zebrafish model were electrophoresed through agarose gel electrophoresis (containing nucleic acid dye) and detected for signals using a gel imaging analysis system. Grey ratio = EVI‐1 grey value/β‐ actin grey value. Expression (%) = (experimental group grey ratio/control group grey ratio) ×100%, and the relative mRNA expression level of EVI‐ 1 in the control group was designated 100%. The PCR primers used are listed in Table 1. 2.6 Cell viability assay and cell morphology Cell suspensions (100 μl) of THP-1 and K562 (2×105 cells/ml), supplemented with different concentrations of ATO, were seeded in 96‐ well plates for 24, 48 and 72 h. Cell viability was determined by CCK‐ 8 following the manufacturer's instructions with a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA) at 490 and 630 nm. Three independent experiments were performed in triplicate. For morphological observations, the cells were centrifuged onto slides by cytospin and stained with haematoxylin and eosin. Images were captured using a light microscope (1000× magnification). 2.7 Flow cytometric analysis Cells were treated with reagents in six-well culture plates (2×105 cells/ml), washed twice in phosphate-buffered saline (PBS), resuspended in binding buffer, and then stained with annexin V-FITC and propidium iodide (PI) according to the manufacturer’s instruction. Next, the samples were immediately evaluated by flow cytometry using a FACS Calibur system (BD Biosciences, Franklin Lakes, NJ, USA) followed by analysis with CellQuest Pro software (BD Biosciences, Franklin Lakes, NJ, USA). The proportion of apoptotic cells was expressed as annexin V+/PIstaining of early apoptotic cells plus annexin V+/PI + staining of late apoptotic cells. 2.8 siRNA transfection THP-1 and K562 cells were transfected while growing in the log phase at 48 h after splitting. Prior to transfection, 2 ml of complete medium was added to each well of a six-well plate. For transfection, 200 nmol/l of EVI-1 small interfering RNA (siRNA) #1, EVI-1 siRNA#2 or the 5
negative control (a “scrambled” sequence with no significant homology to any known gene sequences from human cell lines) was added (GenePharma, Shanghai, China) (Table 1). The transfection regents for leukemia cells were obtained from Invitrogen (RNAiMax reagent and Stealth RNAiTM). The non-targeting scramble-sequence siRNA was used as a negative control. Cultured THP-1 and K562 cells were transfected according to the manufacturer’s protocol (Invitrogen). 2.9 Western blotting Equal amounts of protein extract were electrophoresed and then transferred from the SDS-PAGE gel onto polyvinylidene difluoride (PVDF) membranes (Millipore Corporation, Billerica, MA, USA). The membranes were then incubated with primary antibodies followed by the incubation of secondary antibodies conjugated to horseradish peroxidase (HRP). Protein bands were visualized using electrochemiluminescence, and the peak grey value of each band was analysed with ImageJ software. 2.10 Statistical analysis All the experiments were repeated at least three times, and the data are expressed as the mean ± standard deviation. The treatment groups were compared using analysis of variance followed by the Student‐ Newman‐ Keul's multiple comparison tests with SPSS 13.0 software (SPSS, Inc., Chicago, IL, USA). Curves and histograms were constructed using GraphPad Prism 5.0 software (GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered statistically significant.
3. Results 3.1 The EVI-1 gene is highly expressed in primary AML cells and leukemia cell lines In an initial screen, we first determined the EVI-1 mRNA in the BMMNCs samples from AML patients (n=11) and healthy donors (n=11) using RT-qPCR. EVI-1 expression was increased in the almost AML patients’ BMMNC samples. However, in normal BMMNCs, EVI-1 expression was at a low level or nearly absent (P<0.0001) (Fig 1A). We implemented gene sequencing analysis and compared with the GenBank data. Then, we confirmed that the patients’ primary myeloid leukemia cells embody the full length EVI-1 gene. When using PBMCs from a healthy donor as a control, we detected the mRNA expression level of EVI-1 in five leukemia cell lines (K562, HL-60, U937, THP-1 and MV4-11) using RT-qPCR (Fig 1B). By Western blot, EVI-1 expression was detected in these five leukemia cell lines and PBMC from a healthy donor (Fig 1C). These findings indicated that compared with control, the presence of the EVI-1 protein was over-expressed in leukemia cell lines. Among 6
these five leukemia cell lines, EVI-1 was highly expressed in two leukemia cell lines (THP-1 and K562). And THP-1 has the highest EVI-1 expression. Thus, we used the THP-1 and K562 cell lines for further mechanistic studies. The leukemia cell lines were confirmed by gene sequencing analysis to include the identical full length EVI-1 gene with 21 exons as in the patient samples (data not shown). 3.2 ATO inhibits EVI-1 expression in primary leukemia cells, THP-1 and K562 cells and the zebrafish model Primary acute monocytic leukemia cells from one patient with high expression of EVI-1 were treated with 0 or 1 μM ATO for 12 h, 24 h, or 48 h. Subsequently, the EVI-1 expression level was measured by RT-qPCR. ATO distinctly reduced the EVI-1 mRNA expression (compared with 0 µM ATO at the same duration, P<0.05, Fig 2A). To identify whether the EVI-1 gene is the molecular target of ATO in vitro, the THP-1 cell line and K562 cell lines were used. Total RNA was isolated from diverse drug concentration groups and then reversed transcribed to single-stranded cDNA. We used RT-qPCR to determine the relative gene expression and Western blotting to further verify whether ATO changed the protein level of EVI-1 in THP-1 and K562 cells. Between the ATO-treated groups and the normal control group, both of the expression levels of EVI-1 mRNA and protein were significantly reduced in the leukemia cell lines (Fig 2B). The results suggested that the EVI-1 gene was the molecular target of ATO in vitro, which was consistent with the results of our previous study [19]. To examine the mechanisms by which ATO affects EVI-1 in vivo, we examined the inhibitory effects of ATO on EVI-1 transgenic zebrafish. To clarify its toxicity in vivo, we first determined the toxic effects of ATO on zebrafish. The median lethal concentration (LC50) of ATO treatment on zebrafish embryos at 72 hpf was 110.76 ± 5.23 μM. We evaluated the EVI-1 expression in Tg(AML1-EVI-1: HSE; EGFP) transgenic zebrafish embryos over dose courses of ATO exposure (Fig 2C). By contrast to our in vitro study, these two results coincide with each other well. We found ATO could decrease EVI-1 expression in a dose-dependent manner after 72 h (Fig 2C). Taken together, our in vivo and in vitro studies indicate that ATO is an inhibitor of EVI-1 expression. 3.3 ATO induces apoptosis in the leukemia cell lines by activating the JNK signalling pathway To investigate whether the viability reduction of THP-1 and K562 cell lines is because of apoptosis, apoptotic cells were visualized using light microscopy. In the exponential growing phase, THP-1 and K562 cells were incubated with 3 µM of ATO for 48 hours. As observed in the light microscopy images, leukemia cells showed typical apoptotic features. Most of the THP-1 and K562 cells exhibited cell morphology including substantial vacuoles in the cytoplasm, a 7
higher intensity of nuclear staining, karyopyknosis and the formation of crescents and apoptotic bodies (Fig 3A). The apoptotic cells percentage was symbolized as early apoptotic cells (annexin V+/PIstaining, the lower right quadrant) plus late apoptotic cells (annexin V+/PI+ staining, the upper right quadrant) (Fig 3B). In cytometric analysis, the proportion of apoptotic THP-1 and K562 cells was distinctly rised by ATO in a dose-dependent manner. To elaborate the mechanism that underlies the apoptotic functions of ATO, our study determined changes in the JNK-mediated apoptotic signalling pathway, which is sited downstream of EVI-1. We found that ATO could raise the expressions of p-JNK, p-P53, PUMA, Bax, caspase-9 (including cleaved-9) and caspase-3 (including cleaved-3) to a great extent but reduced the expressions of Bcl-2 and Bcl-xl (Fig 4). ATO treatment did not significantly modify the level of total JNK and caspase-8 which is a caspase in the extrinsic pathway (Supplementary Fig1). Thus, ATO induced the apoptosis of THP-1 and K562 cells which are human monocytic leukemia cell line and human chronic myelogenous leukemia cell line via activation of the JNK signalling pathway. 3.4 Inhibition of JNK suppresses ATO-induced leukemia cell apoptosis To further delineate the mechanism of the JNK pathway in ATO-mediated leukemia cell apoptosis, we examined whether the inhibitor of JNK (SP600125) could reverse ATO-induced apoptosis in THP-1 cells. SP600125 is a potent, cell-permeable, selective and reversible inhibitor of the JNK pathway that inhibits JNK phosphorylation in a dose-dependent manner [20]. In preliminary experiments, we determined the appropriate method and concentration for treatment with the specific JNK inhibitor SP600125. Treatment with SP600125 10 µM did not affect the viability or apoptotic rate of normal THP-1 cells（Supplementary Fig2）. THP-1 cells were incubated with 10 µM SP600125 for 2 h before ATO treatment. SP600125 not only decreased the pro-apoptotic function of ATO in THP-1 cell line (Fig 5A and 5B) but also decreased the activation of the JNK-mediated apoptotic signalling pathway (Fig 5C). SP600125 silenced the activation of JNK by completely inhibiting the phosphorylation of JNK but had little effect on EVI-1 expression (Fig 5C). Thus, EVI-1 is located upstream of JNK. 3.5 EVI-1 knockdown in THP-1 and K562 cells induces apoptosis while regulating the JNK signalling pathway Given that the inhibition of the JNK signalling pathway could regulate THP-1 and K562 cell apoptosis without affecting EVI-1 expression, to test whether EVI-1 was located upstream of the JNK pathway and whether EVI-1 modulates apoptosis via the JNK signalling pathway, we transiently transfected THP-1 and K562 cells with siRNA against EVI-1 and a siRNA control. In these two human leukemia cell lines, the down-regulation of EVI-1 expression due to siRNA transfection was corroborated using RT-qPCR and Western blots at 48 and 72 h, respectively (Fig 8
6A, Fig 7A). In three independent experiments, EVI-1 knockdown induced cell apoptosis (Fig 6B, Fig 7B). To examine whether EVI-1 regulated apoptosis by affecting the JNK pathway, we measured phosphorylation of JNK in THP-1 and K562 cells transfected with control or EVI-1 siRNAs. Knocking down EVI-1 resulted in the suppression of Bcl-2 expression and the promotion of p-JNK, Bax, PUMA (Fig 6C, Fig 7C). Thus, silencing EVI-1 had profoundly affected the activation of JNK pathway and induction of the leukemia cell lines (THP-1 and K562) apoptosis. 4. Discussion Our results first demonstrated that EVI-1 regulated ATO-induced apoptosis through the JNK pathway. We found that the pro-apoptotic effect of ATO in AML cell lines was mediated by the expression of EVI-1. Furthermore, the JNK signal pathway activation was crucial in the ATO-induced apoptosis of EVI-1-positive AML cells. The application of ATO since the early 1990s has improved the clinical outcomes of APL [8]. Distinct pro-apoptotic effect is a significant characteristic of this drug. Initial researches indicated that ATO pro-apoptotic role is related to the suppression of Bcl-2 and regulation the protein levels of PML-RAR alpha/PML [21]. Our previous study demonstrated that ATO can downregulate EVI-1 expression in THP-1 cells [19]. In our in vitro and vivo research, we found that ATO can inhibit EVI-1 expression in human chronic myelogenous leukemia cell line (K562) and a zebrafish model. Murine bone marrow infection and transplantation experiments were performed by two independent groups and demonstrated that EVI-1 overexpression induces an MDS-like disease in recipient mice [22]. These animal models disclosed that in order to develop leukemia EVI-1 needs extra genetic events, such as overexpression of HoxA9/Meis1 and mutations of AML1/RUNX1 [23，24]. Leukemia is a malignant clonal disease from hemopoietic stem cells, suggesting a stem cell phenotype of leukemia cell lines. The EVI-1 aberrant expression was frequently found in patients with MDS and AML [25]. Our results found that PBMCs from healthy donors expressed an extremely low level of EVI-1 mRNA and protein; however, the five leukemia cell lines (MV4-11, K562, HL-60, U937 and THP-1) and primary acute myeloid leukaemic cells from patients had higher EVI-1 expression. Gene sequencing analysis corroborated that the patients’ primary cells and leukemia cells (THP-1 and K562) contained the same full length EVI-1 gene. In vitro evidence indicated that ATO can inhibit EVI-1 mRNA expression. In addition, the EVI-1 gene spliced forms encode three distinct proteins, leastways: EVI-1 (145 kDa), MDS1/EVI-1 (200 kDa) and EVI- 1Δ324 (88 kDa) [26]. Our Western blotting results showed that the THP-1 cell line expressed EVI-1 proteins encoded by the EVI-1 and EVI-1Δ324 variants but not the MDS1/EVI-1 splicing variant. ATO also down-regulated EVI-1 9
protein variants in the THP-1 cell line. A Japanese study cloned the human EVI-1 gene into NIH3T3 mouse fibroblasts and mouse bone marrow and found that ATO could degrade EVI-1 protein without affecting EVI-1 mRNA [14], which is inconsistent with the results of our study. The cause of this discrepancy may be the different gene regulation mechanisms present in humans versus mice. Our results found that ATO could induce apoptosis and decreased the EVI-1 expression (both mRNA and protein levels), however, ATO increased the expressions of p-JNK (the activated form of JNK) in THP-1 and K562 cell line. Our study suggested that ATO could induce apoptosis in leukemia cells by suppressing EVI-1 expression, thereby decreasing the suppressive influences of EVI-1 on JNK signalling. To further investigate the correlation between EVI-1 and the JNK pathway, the expression of EVI-1 was knocked down in leukemia cell lines with siRNA. The results of our experiments showed that EVI-1 knockdown activated the JNK pathway and induced cell apoptosis, indicating that EVI-1 expression is closely related to JNK signalling. Apoptotic activity and the expression levels of p-JNK, PUMA, Bax, and cleaved caspase 3, all of which are correlated with JNK signalling, were modified when EVI-1 was knocked down. Likewise, several studies demonstrated that the EVI-1 oncoprotein plays a role as an inhibitor of JNK, thereby suppressing apoptosis [7, 27, 28]. Our study demonstrated that the JNK signalling pathway was activated in ATO-treated leukemia cells. Downstream of pathway activation, p-JNK (activated form of JNK) translocates to the nucleus, where it phosphorylates and activates P53, which exerts anti-cancer activities (Fig 8) [29]. In the context of apoptosis, p-P53 (activated P53) can bind different sites of DNA and activate the pro-apoptotic genes expression, including PUMA, Bax, as well as caspase, while inactivating anti-apoptotic proteins, such as Bcl-2 and Bcl-xl (Fig 8) [30]. PUMA is a member of the BH3-only group of Bcl-2 family proteins, and it is one of the downstream targets of the tumour suppressor P53 [31, 32]. Under normal circumstances, the expression level of PUMA is very low, while its expression is significantly activated after the exposure of cells to DNA-damaging agents, such as chemotherapeutic drugs and ionizing radiation [33]. The activation of PUMA by DNA damage is dependent on P53 and occurs through the direct binding of p-P53 to the PUMA promoter region [34]. The apoptosis regulator Bcl-2 belongs to a family of evolutionarily related proteins. These proteins can be either pro-apoptotic (including Bax) or anti-apoptotic (including Bcl-2 and Bcl-xl). The anti-apoptotic proteins (e.g., Bcl-2 and Bcl-xL) inhibit apoptosis through heterodimerization with Bax [35]. PUMA initiates apoptosis in part by dissociating Bax and Bcl-2 or Bcl-xL, thereby promoting Bax multimerization and mitochondrial translocation [34, 36] (Fig 8). The caspase family of 13 aspartate-specific cysteine proteases plays an essential role in the execution of the apoptotic programme. Caspase-9 forms an apoptosome complex upon binding cytochrome c and Apaf-1 and activates the executive caspases 3, 6 and 7 10
[37]. Caspase-3 is a central terminator of apoptotic pathways [38]. The sequential activation of caspases plays a central role in the execution phase of apoptosis (Fig 8). These results indicate that the apoptosis of THP-1 and K562 cells could be induced by ATO in a dose-dependent manner. Using Western blot, our study found that ATO treatment distinctly upregulated the expressions of p-P53, PUMA, Bax, caspase-9 and caspase-3 (including cleaved caspase-9 and cleaved caspase-3) while downregulated the expressions of Bcl-2 and Bcl-xL. Nevertheless, in our study, there is no significant difference in the caspase-8 expression, which is the typical protein marker of the extrinsic apoptotic pathway. This finding suggests that ATO-induced apoptosis in THP-1 and K562 cells is mostly mediated through the mitochondrial apoptotic pathway. A similar observation was documented in APL cells with respect to ATO-mediated apoptosis through H2O2 accumulation, which is followed by changes in mitochondrial transmembrane permeability, cytochrome C release and caspase activation [39]. To further clarify the roles of EVI-1 and JNK in the apoptosis induced by ATO, we used the specific JNK inhibitor SP600125. SP600125 inhibited the p-JNK protein and decreased the level of apoptosis in leukemia cells induced by ATO. However, although SP600125 completely silenced the expression of p-JNK, it only partially reversed the apoptosis caused by ATO, suggesting that other mechanisms may be involved. In addition, SP600125 significantly affected the expression of p-JNK, whereas it had little effect on the expression of EVI-1. The results therefore suggest that EVI-1 is located upstream of JNK in this apoptotic signalling pathway. In conclusion, our study demonstrated that the apoptotic pathway in leukemia cells (THP-1 and K562) induced by ATO is closely associated with the oncogene EVI-1, the pro-apoptotic protein, p-JNK, p-P53, PUMA, Bax, caspase-9 and caspase-3 (including cleaved caspase-9 and cleaved caspase-3), and the anti-apoptotic proteins Bcl-2 and Bcl-xL. ATO can downregulate EVI-1 mRNA and oncoprotein and block the repression of EVI-1 in the JNK pathway. Moreover, the activated JNK signalling pathway modulated the apoptosis-associated proteins expressions, including p-P53, PUMA, Bax, Bcl‐ xL, Bcl‐ 2, caspase-9 and caspase-3. These findings may provide a novel theoretical basis for the development of personalized medical strategies for the treatment of EVI-1 positive AML patients. Acknowledgements The authors are very grateful to the members of the Leukemia Research Institute in Ren Ji Hospital and sincerely appreciate the Shanghai Institute of Hematology for excellent technical support. This manuscript has received Wiley's English Language Editing service. The study was partly supported by the National Natural Science Foundation of China Grant (No.81470312).
Conflict of interest 11
The authors declare that there are no conflicts of interest.
References 1. Liang R, Bai QX, Zhang YQ, et al. Reduced tumor lysis syndrome with low dose chemotherapy for hyperleukocytic acute leukemia prior to induction therapy. Asian Pac J Cancer Prev 2011; 12:1807-1811. 2. Wan H, Cai J, Chen F, Zhu J, Zhong J, Zhong H. SOX12: a novel potential target for acute myeloid leukaemia. Br J Haematol 2017; 176:421-430. 3. Mucenski ML, Taylor BA, Ihle JN, et al. Identification of a common ecotropic viral integration site, Evi-1, in the DNA of AKXD murine myeloid tumors. Mol Cell Biol 1988; 8:301-308. 4. Barjesteh van Waalwijk van Doorn-Khosrovani S, Erpelinck C, van Putten WL, et al. High EVI1 expression predicts poor survival in acute myeloid leukemia: a study of 319 de novo AML patients. Blood 2003; 101:837-845. 5. Yuan X, Wang X, Bi K, Jiang G. The role of EVI-1 in normal hematopoiesis and myeloid malignancies (Review). Int J Oncol 2015; 47:2028-2036. 6. Konantz M, André MC, Ebinger M, et al. EVI-1 modulates leukemogenic potential and apoptosis sensitivity in human acute lymphoblastic leukemia. Leukemia 2013; 27:56-65. 7. Kurokawa M, Mitani K, Yamagata T, et al. The evi-1 oncoprotein inhibits c-Jun N-terminal kinase and prevents stress-induced cell death. EMBO J 2000; 19:2958-2968. 8. Wang ZY, Chen Z. Acute promyelocytic leukemia: from highly fatal to highly curable. Blood 2008; 111:2505-2515. 9. Udupa K, Thomas J, Udupa CB, Binu VS, Sharan P. Treatment of Acute Promyelocytic Leukemia with Single Agent Arsenic Trioxide: Experience from a Tertiary Care Center in India. Indian J Hematol Blood Transfus 2017; 33:45-48. 10. Fox E, Razzouk BI, Widemann BC, et al. Phase 1 trial and pharmacokinetic study of arsenic trioxide in children and adolescents with refractory or relapsed acute leukemia, including acute promyelocytic leukemia or lymphoma. Blood 2008; 111:566-573. 11. Lin CC, Hsu C, Hsu CH, Hsu WL, Cheng AL, Yang CH. Arsenic trioxide in patients with hepatocellular carcinoma: a phase II trial. Invest New Drugs 2007; 25:77-84. 12. Schiller GJ, Slack J, Hainsworth JD, et al. Phase II multicenter study of arsenic trioxide in patients with myelodysplastic syndromes. J Clin Oncol 2006; 24:2456-2464. 13. Redondo-Muñoz J, Escobar-Díaz E, Hernández Del Cerro M, et al. Induction of B-chronic lymphocytic leukemia cell apoptosis by arsenic trioxide involves suppression of the phosphoinositide 3-kinase/Akt survival pathway via c-jun-NH2 terminal kinase activation and PTEN upregulation. Clin Cancer Res 2010; 16:4382-4391. 14. Shackelford D, Kenific C, Blusztajn A, Waxman S, Ren R. Targeted degradation of the AML1/MDS1/EVI1 oncoprotein by arsenic trioxide. Cancer Res 2006; 66:11360-11369. 15. Jing L, Zon LI. Zebrafish as a model for normal and malignant hematopoiesis. Dis Model Mech 2011; 4:433-438. 16. Amatruda JF, Shepard JL, Stern HM, Zon LI. Zebrafish as a cancer model system. Cancer Cell 2002; 1: 229-231. 17. Shen LJ, Chen FY, Zhang Y, et al. MYCN transgenic zebrafish model with the characterization of acute myeloid leukemia and altered hematopoiesis. PLoS One 2013; 8:e59070. 18. Goyama S, Yamamoto G, Shimabe M, et al. Evi-1 is a critical regulator for hematopoietic stem cells and transformed leukemic cells. Cell Stem Cell 2008; 3:207-220. 19. Zhou LY, Chen FY, Shen LJ, Wan HX, Zhong JH. Arsenic trioxide induces apoptosis in the THP1 cell line by downregulating EVI-1. Exp Ther Med 2014; 8:85-90. 20. Bennett BL, Sasaki DT, Murray BW, et al. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci U S A 2001; 98:13681-13686. 21. Chen GQ, Zhu J, Shi XG, et al. In vitro studies on cellular and molecular mechanisms of arsenic trioxide (As2O3) in the treatment of acute promyelocytic leukemia: As2O3 induces NB4 cell apoptosis with downregulation of Bcl-2 expression and modulation of PML-RAR alpha/PML proteins. Blood 1996; 88:1052-1061. 22. Buonamici S, Li D, Chi Y, et al. EVI1 induces myelodysplastic syndrome in mice. J Clin Invest 2004; 12
114:713-719. 23. Jin G, Yamazaki Y, Takuwa M, et al. Trib1 and Evi1 cooperate with Hoxa and Meis1 in myeloid leukemogenesis. Blood 2007; 109:3998-4005. 24. Watanabe-Okochi N, Kitaura J, Ono R, et al. AML1 mutations induced MDS and MDS/AML in a mouse BMT model. Blood 2008; 111:4297-4308. 25. Xu K, Wang L, Hao Y, et al. Evi-1 and MDS1-Evi-1 genes in pathogenesis of myelodysplastic syndromes and post-MDS acute myeloid leukemia. Chin Med J (Engl) 1999; 112:1112-1118. 26. Morishita K, Parganas E, Douglass EC, Ihle JN. Unique expression of the human Evi-1 gene in an endometrial carcinoma cell line: sequence of cDNAs and structure of alternatively spliced transcripts. Oncogene 1990; 5:963-971. 27. Mitani K. Molecular mechanisms of leukemogenesis by AML1/EVI-1. Oncogene 2004; 23: 4263-4269. 28. Shen L, Zhu J, Chen F, et al. RUNX1-Evi-1 fusion gene inhibited differentiation and apoptosis in myelopoiesis: an in vivo study. BMC Cancer 2015; 15:970. 29. Johnson GL, Nakamura K. The c-jun kinase/stress-activated pathway: regulation, function and role in human disease. Biochim Biophys Acta 2007; 1773: 1341-1348. 30. Lee TL, Yeh J, Friedman J, et al. A signal network involving coactivated NF-kappaB and STAT3 and altered p53 modulates BAX/BCL-XL expression and promotes cell survival of head and neck squamous cell carcinomas. Int J Cancer 2008; 122:1987-1998. 31. Nakano K, Vousden KH. PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell 2001; 7:683-694. 32. Raz L, Zhang QG, Han D, Dong Y, De Sevilla L, Brann DW. Acetylation of the pro-apoptotic factor, p53 in the hippocampus following cerebral ischemia and modulation by estrogen. PLoS One 2011; 6:e27039. 33. Tanaka Y, Nakamura A, Morioka MS, et al. Systems analysis of ATF3 in stress response and cancer reveals opposing effects on pro-apoptotic genes in p53 pathway. PLoS One 2011; 6:e26848. 34. Garrison SP, Phillips DC, Jeffers JR, et al. Genetically defining the mechanism of Puma- and Bim-induced apoptosis. Cell Death Differ 2012; 19:642-649. 35. Zhang Z, Lapolla SM, Annis MG, et al. Bcl-2 homodimerization involves two distinct binding surfaces, a topographic arrangement that provides an effective mechanism for Bcl-2 to capture activated Bax. J Biol Chem 2004; 279:43920-43928. 36. Zhang Y, Xing D, Liu L. PUMA promotes Bax translocation by both directly interacting with Bax and by competitive binding to Bcl-X L during UV-induced apoptosis. Mol Biol Cell 2009; 20:3077-3087. 37. Sun C, Guo XX, Zhu D, et al. Apoptosis is induced in cancer cells via the mitochondrial pathway by the novel xylocydine-derived compound JRS-15. Int J Mol Sci 2013; 14:850-870. 38. Yang B, Lu Y, Zhang A, et al. Doxycycline Induces Apoptosis and Inhibits Proliferation and Invasion of Human Cervical Carcinoma Stem Cells. PLoS One 2015; 10:e0129138. 39. Chou WC, Jie C, Kenedy AA, Jones RJ, Trush MA, Dang CV. Role of NADPH oxidase in arsenic-induced reactive oxygen species formation and cytotoxicity in myeloid leukemia cells. Proc Natl Acad Sci U S A 2004; 101:4578-4583.
Fig 1. EVI-1 gene expression levels in primary acute myeloid leukemia cells and leukemia cell lines. Fig 1A. EVI-1 expression in the BMMNCs of AML patients (n=11) and healthy donors. EVI-1 mRNA expression was higher in bone marrow mononuclear cells (BMMNCs) from the acute myeloid leukemia (AML) patients than in those from health donors. EVI-1, Ecotropic Viral Integration site-1. Fig 1B. Relative mRNA expression levels of EVI-1 in five leukemia cell lines and peripheral blood mononuclear cells (PBMC) from a healthy adult. Quantification of EVI-1 mRNA expression by quantitative real-time PCR, levels were normalized to an endogenous control, β-actin, by the 2-ΔCt method. The histogram shows mean ± SEM from at least three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 vs. healthy control group. Fig 1C. EVI-1 protein expression levels in five leukemia cell lines and PBMC from a healthy adult. Upper panel: Protein was extracted from each of the indicated cell lines and equal amounts of whole cell lysate were subjected to Western blotting and probed with anti-EVI-1 and anti-β-actin antibodies. Lower panel: Densitometry was performed to determine the expression of 13
EVI-1 protein in each of the cell lines. This was calculated by dividing the intensity of EVI-1 band over that of the loading control, β-actin. The histogram shows mean ± SEM from three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 vs. healthy control group. Fig 2 ATO down-regulated EVI-1 mRNA in primary acute monocytic leukemia cells, THP-1 and K562 cell lines and zebrafish model. Fig 2A. Relative mRNA expression levels of EVI-1 in primary acute monocytic leukemia treated with 0 or 1 μM ATO for 12h, 24h, 48h. Quantification of EVI-1 mRNA expression by quantitative real-time PCR, levels were normalized to an endogenous control, β-actin, by the 2-ΔCt method. The histogram shows mean ± SEM from at least three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control group. Fig 2B. (1) Relative mRNA expression levels of EVI-1 in THP-1 cell line and K562 cell line treated with 0,1,3,5μM ATO for 48h. Quantification of EVI-1 mRNA expression by quantitative real-time PCR, levels were normalized to an endogenous control, β-actin, by the 2-ΔCt method. The histogram shows mean ± SEM from at least three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control group. (2) EVI-1 protein expression levels in THP-1 and K562 cell lines after stimulation with different doses(0,1,3,5 μM) of ATO for 48h. Expression of EVI-1 in dose course stimulations were analyzed using Western blots. The histogram shows mean ± SEM from at least three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control group. Fig 2C. ATO down-regulated EVI-1 mRNA expression in EVI-1 transgenic zebrafish Representative RT-PCR results. EVI-1 CT, plasmid containing EVI-1 gene (positive control). Blank control without template. Quantitative results are expressed as the means ± standard deviation (n=3), *P<0.05 vs. control group; #P<0.05 vs. the previous concentration at the same time point. CT, control. Fig 3. Induction of apoptosis by ATO in THP-1 and K562 cell lines. Fig 3A. Morphological changes in the THP-1 and K562 cell line treated with ATO were observed using light microscopy (hematoxylin and eosin staining; magnification, ×1,000). Compared with the control group, cells treated with 0 or 3 µM ATO for 48h exhibited typical apoptotic characteristics, including a large number of bubbles in the cytoplasm, higher intensity of nuclear staining, karyopyknosis and the formation of crescents and apoptotic bodies Fig 3B. Flow cytometry analysis was conducted to analyze the apoptosis rate induced by ATO in THP-1 and K562 cells. Four subpopulations and their fractions are indicated: early apoptotic cells (lower right), late apoptotic cells (upper right), normal cells (lower left) and dead cells (upper left). The apoptotic index was expressed as the number of apoptotic cells/the total number of cells counted ×100%. Data are representatives of three independent experiments with similar results and expressed as the means ± standard deviation. *P<0.05, vs. control group; *P<0.05, vs. previous concentration at the same point. Fig 4. Altered levels of EVI-1, JNK, p-JNK, P-p53, PUMA, Bcl-2, Bcl-xL, Bax, full length caspase-9, cleaved caspase-9, full length caspase-3, cleaved caspase-3 proteins in THP-1 and K562 cell line treated with ATO. THP-1 and K562 cells were treated with 0,1,3μM ATO for 48 hours. Total lysates of the cells were subjected to SDS-PAGE electrophoresis and blotted with the antibodies against the molecules of apoptosis pathways. The data are representative of 3 experiments. Fig 5. Specific JNK inhibitor SP600125 not only decreased the pro-apoptotic effect of ATO in THP-1 cells but also suppressed the activation of JNK signal pathway Fig 5A. SP600125 decreased the pro-apoptotic effect of ATO in THP-1 cells. Morphological changes in the THP-1 cell line treated with or without ATO or SP600125 (hematoxylin and eosin staining; magnification, ×1,000). Fig 5B. Representative apoptotic ratio results detected using flow cytometry are shown. Four subpopulations and their fractions are indicated: early apoptotic cells (lower right), late apoptotic cells (upper right), normal cells (lower left) and dead cells (upper 14
left). The apoptotic index was expressed as the number of apoptotic cells/the total number of cells counted ×100%. Data are representatives of three independent experiments with similar results and expressed as the means ± standard deviation. *P<0.05, vs. control group; **P<0.01 vs. the ATO group. Fig 5C. Effect of SP600125 and ATO on JNK pathway. THP-1 were treated with 0μM，5μM ATO, 5μM ATO+10μM SP600125 for 48h respectively. Total lysates of the cells were subjected to SDS-PAGE electrophoresis and blotted with the antibodies against the molecules of JNK pathways. The data are representative of 3 experiments. Fig 6.EVI-1 knockdown in THP-1 cells induced cell apoptosis with regulating JNK signaling pathway Fig 6A Knockdown of EVI-1 was confirmed by RT-qPCR and western blots. Fig.6B EVI-1 knockdown induce cell apoptosis in culture. Morphological changes in the THP-1 cell line treated with scramble or EVI-1 siRNA after 72h (hematoxylin and eosin staining; magnification, ×1,000). Representative apoptotic ratio results detected using flow cytometry are shown. Four subpopulations and their fractions are indicated: early apoptotic cells (lower right), late apoptotic cells (upper right), normal cells (lower left) and dead cells (upper left). The apoptotic index was expressed as the number of apoptotic cells/the total number of cells counted ×100%. Data are representatives of three independent experiments with similar results and expressed as the means ± standard deviation. *P<0.05, **P<0.01, ***P < 0.001 vs. the control group. Fig 6C. Knockdown of EVI-1 regulated JNK pathway by promotion of p-JNK, Bax, Puma and suppression of Bcl-2. Protein was extracted from each of the indicated cell lines and equal amounts of whole cell lysate were subjected to Western blotting and probed with anti-EVI1 and anti- JNK pathway antibodies. Fig 7. EVI-1 knockdown in K562 cells induced cell apoptosis with regulating JNK signaling pathway Fig 7A Knockdown of EVI-1 was confirmed by RT-qPCR and western blots. Fig.7B EVI-1 knockdown induce cell apoptosis in culture. Morphological changes in the THP-1 cell line treated with scramble or EVI-1 siRNA after 72h (hematoxylin and eosin staining; magnification, ×1,000). Representative apoptotic ratio results detected using flow cytometry are shown. Four subpopulations and their fractions are indicated: early apoptotic cells (lower right), late apoptotic cells (upper right), normal cells (lower left) and dead cells (upper left). The apoptotic index was expressed as the number of apoptotic cells/the total number of cells counted ×100%. Data are representatives of three independent experiments with similar results and expressed as the means ± standard deviation. *P<0.05, **P<0.01, ***P < 0.001 vs. the control group. Fig 7C. Knockdown of EVI-1 regulated JNK pathway by promotion of p-JNK, Bax, Puma and suppression of Bcl-2. Protein was extracted from each of the indicated cell lines and equal amounts of whole cell lysate were subjected to Western blotting and probed with anti-EVI1 and anti- JNK pathway antibodies. Fig 8. A schematic model of EVI-1 modulating JNK signaling pathway in leukemia cell. Downregulation of EVI-1 could activate JNK pathway and induce cell apoptosis. Supplemental Fig 1. Altered level of caspase-8 protein in THP-1 and K562 cell line treated with ATO. THP-1 and K562 cells were treated with 0,1,3μM ATO for48 hours. Total lysates of the cells were subjected to SDS-PAGE electrophoresis and blotted with the antibodies against the molecules of apoptosis pathways. The data are representative of 3 experiments. Supplementary Fig 2. Treatment with specific JNK inhibitor SP600125 10 µM did not affect the apoptotic rate of normal THP-1 cells. Supplementary Fig 2A. Morphological changes in the THP-1 cell line treated with or without 10 µM SP600125 after 48 hours (hematoxylin and eosin staining; magnification, ×1,000). Supplementary Fig 2B. Representative apoptotic ratio results detected using flow cytometry are shown. Four subpopulations and their fractions are indicated: early apoptotic cells (lower right), late apoptotic cells (upper right), normal cells (lower left) and dead cells (upper left). The apoptotic index was expressed as the number of apoptotic cells/the total number of cells counted ×100%. Data are representatives of three independent experiments with similar results and expressed as the means ± standard deviation. Supplementary Fig 2C. 15
Effect of 10 µM SP600125 on JNK pathway for 48h. Total lysates of the cells were subjected to SDS-PAGE electrophoresis and blotted with the antibodies against the molecules of JNK pathways. The data are representative of 3 experiments. CT: Control group.
16
Fig. 1
17
Fig. 2
18
Fig. 3
19
Fig. 4
20
Fig. 5
21
Fig. 6
22
Fig. 7
23
Fig. 8
Graphical Abstract 24
Table I. Primer sequences Gene EVI-1 primer β-actin primer EVI-1 siRNA#1 EVI-1 siRNA#2 Scramble
Sequence Forward: CACATTCGCTCTCAGCATGT Reverse: GCTGTGGATGTGCTTGTGTT Forward: CATGTACGTTGCTATCCAGGC Reverse: CTCCTTAATGTCACGCACGAT Forward:GCUGAUUGCAGAACCCAAATT Reverse:UUUGGGUUCUGCAAUCAGCTT Forward:GGAAGCAACGUCGAAUCAATT Reverse:UUGAUUCGACGUUGCUUCCTT Forward:UUCUCCGAACGUGUCACGUTT Reverse:ACGUGACACGUUCGGAGAATT
EVI-1: ecotropic viral integration site-1 , siRNA: Small interfering RNA
25
PII: DOI: Reference:
S0014-4827(18)30852-8 https://doi.org/10.1016/j.yexcr.2018.11.018 YEXCR11244
To appear in: Experimental Cell Research Received date: 4 September 2018 Revised date: 20 November 2018 Accepted date: 21 November 2018 Cite this article as: Wenjing Lang, Jianyi Zhu, Fangyuan Chen, Jiayi Cai and Jihua Zhong, EVI-1 Modulates Arsenic Trioxide induced Apoptosis through JNK signaling pathway in Leukemia Cells, Experimental Cell Research, https://doi.org/10.1016/j.yexcr.2018.11.018 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
EVI-1 Modulates Arsenic Trioxide induced Apoptosis through JNK signaling pathway in Leukemia Cells Wenjing Lang, MD1, Jianyi Zhu, MD1, Fangyuan Chen, MD*, Jiayi Cai, MD, Jihua Zhong, MD Department of Hematology, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, 160 Pujian Road, Shanghai 200127, China.
*
Corresponding author. Dr. Fangyuan Chen Department of Hematology, Ren Ji Hospital, School of
Medicine, Shanghai Jiao Tong University, 160 Pujian Road, Shanghai, China Tel.: 86-21-68383301; fax: 86-21-58395057. [email protected]
Abstract High expression of the oncogene ecotropic viral integration site-1 (EVI-1) is an independent negative prognostic indicator of survival in leukemia patients. This study aimed to examine the effects of arsenic trioxide (ATO) on EVI-1 in acute myeloid leukemia (AML). Mononuclear cells were isolated from the bone marrow and peripheral blood of AML patients and healthy donors. EVI-1 expression in hematopoietic cells was evaluated by RT-qPCR and Western blot analysis. EVI-1 was highly expressed in both primary AML and leukemia cell lines (THP-1 and K562). ATO down-regulated EVI-1 mRNA in zebrafish in vivo as well as in primary leukemia cells and THP-1 and K562 cells in vitro. Additionally, ATO treatment induced apoptosis, down-regulated both EVI-1 mRNA and oncoprotein expression, increased the expression of pro-apoptosis proteins, and decreased the expression of anti-apoptotic proteins in leukemia cells in vitro. EVI-1 expression in leukemia cells (THP-1 and K562) transduced with EVI-1 siRNA was significantly reduced. Silencing EVI-1 had a significant effect on the activation of the JNK pathway and the induction of leukemia cell apoptosis. ATO may downregulate EVI-1 mRNA and oncoprotein levels and block the inhibitory effects of EVI-1 on the JNK pathway, which activates the JNK apoptotic pathway, thereby leading to the apoptosis of EVI-1 in AML patients.
1
These authors contributed equally to this study. 1
β-actin; AL, acute leukemia; AML, acute myeloid leukemia; APL, acute promyelocytic leukemia; ATO, arsenic trioxide; BCA, bicinchoninic acid; BMMNCs, bone marrow mononuclear cells; BSA, albumin from bovine serum; caspase, cysteinyl aspartate specific proteinase; CCK8, cell counting kit-8; cDNA, complementary deoxyribonucleic acid; d, day; DEPC, Diethypyrocarbonate; DMSO, Dimethylsulfoxide; ECL, Electro-Chemiluminescence; EGFP, enhanced green fluorescent protein; EVI-1, ecotropic viral integration site-1; FACS, fluorescence-activated cell sorting ; FBS, fetal bovine serum; FCM, flow cytometry; Hpf, hour post fertilization; HRP, horseradish peroxidase; HSC, hematopoietic stem cell; IACUC, Institutional Animal Care and Use Committee; JNK, c-Jun N-terminal kinase; M5, acute monocytic leukemia; MAPK, mitogen-activated protein kinases; MDS, myelodysplastic syndromes; min, minute; MM, multiple myeloma; mRNA, messenger ribonucleic acid; NCBI, National Center for Biomedical Information; PBS, optical density buffered saline; PCR, polymerase chain reaction; PI, propidium iodide; PVDF, polyvinylidene difluoride; RT-qPCR, quantitative reverse transcription polymerase chain reaction; RIPA, radio immunoprecipitation assay; PBMCs, peripheral blood mononuclear cells; p-JNK, phosphate c-Jun N-terminal kinase; p-P53, phosphorylated-P53; PUMA, P53 up-regulated modulator of apoptosis; rpm, revolutions per minute; RT-PCR, reverse transcript polymerase chain reaction; sec, second
Abbreviations: ALL, acute lymphocytic leukemia acute leukemia; ACTB,
Keywords: EVI-1, arsenic trioxide, acute leukemia, apoptosis, c-Jun N-terminal kinase. 1. Introduction Acute leukemia is a hematological malignancy with profound heterogeneity and mortality. The pathogenesis and development of acute leukemia is closely associated with certain genetic and chromosomal abnormalities [1]. Accumulated evidence suggests that aberrant transcription machinery could be a key driver for the development of acute leukemia [2]. Ecotropic viral integration site-1 (EVI-1) was first identified as the integration site of the ecotropic retrovirus in a mouse model of acute myeloid leukemia (AML) [3]. EVI-1，since then, has been considered an oncogenic transcription factor in human leukemia. EVI-1 is located on chromosome 3q26. Chromosome 3q26 rearrangements can activate the expression of EVI-1 in myeloid malignancies [4]. Despite the presence of 3q26 rearrangements, overexpression of EVI-1 has become an independent poor prognostic indicator of survival in leukemia patients [5]. The expression of EVI-1 is high in about 10% of patients with AML. In addition, the over-expression of EVI-1 is also identified in other hematologic malignancies and solid tumours [6]. In experimental models, aberrant proto-oncogene EVI-1 expression contributes to leukemogenic potential and resistance 2
to cell apoptosis in hematologic malignancies. Mechanistic studies indicate that the EVI-1 oncoprotein can inhibit c-Jun NH2-terminal kinase (JNK) signalling and prevent stress-induced cell death [7]. However, few studies have pursued the discovery and screening of drugs targeting EVI-1 in AML patients. Arsenic trioxide (As2O3, ATO) is an oldest therapeutic agent used in both traditional Chinese and Western medicine [8]. ATO is one kind of the effective anticancer drugs, particularly for both newly diagnosed and relapsed patients with acute promyelocytic leukemia (APL) [9]. ATO is also a promising general anticancer therapy for other malignancies (e.g., lymphoma, hepatocellular carcinoma and myelodysplastic syndrome [MDS]) [10-12]. ATO may induce malignant cell apoptosis by activating the mitochondria-mediated intrinsic apoptotic pathway. Some former studies suggested that the sustained activation of JNK is crucial in ATO-induced apoptosis [13]. Japanese researchers introduced human EVI-1 gene into mouse fibroblasts and bone marrow cells and found that ATO selectively targets the EVI-1 protein without affecting EVI-1 mRNA [14]. Zebrafish (Danio rerio) is a vertebrate animal model commonly used to examine hematopoiesis and myeloid malignancies [15]. The model is widely implemented to investigate conserved cancer pathways in human malignancies [16] and is a practical and efficient method for screening drugs targeting distinct molecules. To clarify the genetic pathways of oncogenesis related to EVI-1, we previously introduced the human EVI-1 gene into zebrafish one-cell embryos through a heat-shock promoter. Moreover, we established the stable germ-line Tg (AML1-EVI-1: HSE: EGFP) zebrafish [17]. Since its identification in a retroviral site in myeloid leukemia, EVI-1 has been intensely studied for its functions in the regulation of hematologic malignancies [18]. However, few studies have examined targeted medicine screening for EVI-1. We thus targeted at exploring the anticancer functions of ATO and the underlying functions associated with EVI-1 in an in vivo zebrafish model and in AML cells in vitro. 2. Methods 2.1 Ethics statement This work was approved by the Institutional Animal Care and Use Committee of Shanghai Research Centre for Model Organisms (Shanghai, China) (approval ID: 2010-0010). The clinical investigation using primary human material from leukemia patients and healthy volunteers was conducted according to the principles of the 1996 Declaration of Helsinki and was approved by the Joint Committee on Clinical Investigation of Ren Ji Hospital. Written informed consent was obtained from the volunteers and the patients before their inclusion in the study. 2.2 Cells, cell culture, and treatment of cells 3
The cell lines derived from human AML (THP-1) were obtained from ATCC (Manassas, VA, USA) and grown in RPMI containing 10% foetal bovine serum (FBS) (Invitrogen, Carlsbad, CA, USA). The K562, HL-60, U937 and MV4-11 cell lines were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Fresh bone marrow or peripheral blood samples from healthy donors and patients with AML were collected. Isolated primary cells were resuspended to 2.0 × 106/ml in RPMI 1640 medium containing 20% FBS. 2.3 Chemicals and reagents ATO was purchased from Beijing SL Pharmaceutical Co., Ltd. (Beijing, China). Dimethyl sulfoxide (DMSO), SP600125 (a specific inhibitor of JNK), FBS, and bovine serum albumin (BSA) were purchased from Sigma-Aldrich (St. Louis, MO, USA). SP600125 was dissolved in DMSO; for control samples, diluent (0.1% DMSO) was added to the medium. An Annexin V-fluorescein isothiocyanate Apoptosis Detection kit and TRIzol reagent were purchased from Invitrogen Life Technologies (Carlsbad, CA, USA). A first-strand cDNA QuantScript RT kit and Taq DNA Polymerase were purchased from Tiangen Biotech Co., Ltd. (Beijing, China). The Cell Counting kit-8 (CCK-8) was purchased from Dojindo Laboratories (Kumamoto, Japan). An SDS-PAGE (sodium dodecyl sulfate polyacrylamide electrophoresis) gel quick preparation kit, RIPA (radio immunoprecipitation assay) lysis buffer and an enhanced BCA (bicinchoninic acid) protein assay kit were purchased from Beyotime Institute of Biotechnology (Shanghai, China). Anti-EVI-1, anti-JNK, anti-phosphorylated-JNK (p-JNK), anti-phosphorylated-P53 (p-P53), anti-PUMA, anti-Bax, anti-Bcl-2, anti-Bcl-xL, anti-caspase-9, and anti-caspase-3 antibodies were obtained from Cell Signaling Technology, Inc. (Danvers, MA, USA). Anti-β-actin antibody was purchased from Abmart (Arlington, MA, USA). Horseradish peroxidase-conjugated secondary antibodies were purchased from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA, USA). Lipofectamine 2000 (lipo 2000), trypsin, Opti-MEM, and penicillin-streptomycin were purchased from Invitrogen Corporation (Carlsbad, CA, USA). 2.4 Zebrafish embryo collection and drug treatment Tg (AML1-EVI-1: HSE: EGFP) transgenic zebrafish embryos were generated by natural pair-wise mating and were raised at 28.5°C in embryo water. The embryos were heat shocked at 38°C for 1 h once between 14 to 18 hpf to induce EGFP expression and EVI-1 phenotypes. EGFP-positive embryos were screened under a fluorescence microscope at 24 hpf. Healthy, hatched zebrafish embryos were selected at 24 hpf and treated with different concentrations of ATO (diluted in embryo water directly); the embryos were then incubated in 6-well plates (10 embryos/well) at 28.5°C from 24 to 72 hpf. During this period, the larvae were observed for survival and morphology under an inverted microscope (Olympus Corporation, Tokyo, Japan) (at both 10× magnification and 100× magnification). LC50 was defined as the concentration that 4
resulted in the 50% mortality of zebrafish embryos treated with ATO. The assay was repeated three times independently with 40 embryos per group. 2.5 Reverse transcription polymerase chain reaction (RT- PCR) and quantitative RT-PCR (RT-qPCR) Total RNA was extracted from bone marrow mononuclear cells (BMMNCs) or peripheral blood mononuclear cells (PBMCs) from patients or cell lines using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). RNA was reverse-transcribed with Superscript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). Primer sequences were synthesized by Shanghai Sangon Biological Engineering Co., Ltd. The expression of EVI-1 was examined by gene-specific RT-qPCR (Applied Biosystems, Foster City, CA, USA). B-actin (ACTB) was used as the internal control. PCR products from the zebrafish model were electrophoresed through agarose gel electrophoresis (containing nucleic acid dye) and detected for signals using a gel imaging analysis system. Grey ratio = EVI‐1 grey value/β‐ actin grey value. Expression (%) = (experimental group grey ratio/control group grey ratio) ×100%, and the relative mRNA expression level of EVI‐ 1 in the control group was designated 100%. The PCR primers used are listed in Table 1. 2.6 Cell viability assay and cell morphology Cell suspensions (100 μl) of THP-1 and K562 (2×105 cells/ml), supplemented with different concentrations of ATO, were seeded in 96‐ well plates for 24, 48 and 72 h. Cell viability was determined by CCK‐ 8 following the manufacturer's instructions with a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA) at 490 and 630 nm. Three independent experiments were performed in triplicate. For morphological observations, the cells were centrifuged onto slides by cytospin and stained with haematoxylin and eosin. Images were captured using a light microscope (1000× magnification). 2.7 Flow cytometric analysis Cells were treated with reagents in six-well culture plates (2×105 cells/ml), washed twice in phosphate-buffered saline (PBS), resuspended in binding buffer, and then stained with annexin V-FITC and propidium iodide (PI) according to the manufacturer’s instruction. Next, the samples were immediately evaluated by flow cytometry using a FACS Calibur system (BD Biosciences, Franklin Lakes, NJ, USA) followed by analysis with CellQuest Pro software (BD Biosciences, Franklin Lakes, NJ, USA). The proportion of apoptotic cells was expressed as annexin V+/PIstaining of early apoptotic cells plus annexin V+/PI + staining of late apoptotic cells. 2.8 siRNA transfection THP-1 and K562 cells were transfected while growing in the log phase at 48 h after splitting. Prior to transfection, 2 ml of complete medium was added to each well of a six-well plate. For transfection, 200 nmol/l of EVI-1 small interfering RNA (siRNA) #1, EVI-1 siRNA#2 or the 5
negative control (a “scrambled” sequence with no significant homology to any known gene sequences from human cell lines) was added (GenePharma, Shanghai, China) (Table 1). The transfection regents for leukemia cells were obtained from Invitrogen (RNAiMax reagent and Stealth RNAiTM). The non-targeting scramble-sequence siRNA was used as a negative control. Cultured THP-1 and K562 cells were transfected according to the manufacturer’s protocol (Invitrogen). 2.9 Western blotting Equal amounts of protein extract were electrophoresed and then transferred from the SDS-PAGE gel onto polyvinylidene difluoride (PVDF) membranes (Millipore Corporation, Billerica, MA, USA). The membranes were then incubated with primary antibodies followed by the incubation of secondary antibodies conjugated to horseradish peroxidase (HRP). Protein bands were visualized using electrochemiluminescence, and the peak grey value of each band was analysed with ImageJ software. 2.10 Statistical analysis All the experiments were repeated at least three times, and the data are expressed as the mean ± standard deviation. The treatment groups were compared using analysis of variance followed by the Student‐ Newman‐ Keul's multiple comparison tests with SPSS 13.0 software (SPSS, Inc., Chicago, IL, USA). Curves and histograms were constructed using GraphPad Prism 5.0 software (GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered statistically significant.
3. Results 3.1 The EVI-1 gene is highly expressed in primary AML cells and leukemia cell lines In an initial screen, we first determined the EVI-1 mRNA in the BMMNCs samples from AML patients (n=11) and healthy donors (n=11) using RT-qPCR. EVI-1 expression was increased in the almost AML patients’ BMMNC samples. However, in normal BMMNCs, EVI-1 expression was at a low level or nearly absent (P<0.0001) (Fig 1A). We implemented gene sequencing analysis and compared with the GenBank data. Then, we confirmed that the patients’ primary myeloid leukemia cells embody the full length EVI-1 gene. When using PBMCs from a healthy donor as a control, we detected the mRNA expression level of EVI-1 in five leukemia cell lines (K562, HL-60, U937, THP-1 and MV4-11) using RT-qPCR (Fig 1B). By Western blot, EVI-1 expression was detected in these five leukemia cell lines and PBMC from a healthy donor (Fig 1C). These findings indicated that compared with control, the presence of the EVI-1 protein was over-expressed in leukemia cell lines. Among 6
these five leukemia cell lines, EVI-1 was highly expressed in two leukemia cell lines (THP-1 and K562). And THP-1 has the highest EVI-1 expression. Thus, we used the THP-1 and K562 cell lines for further mechanistic studies. The leukemia cell lines were confirmed by gene sequencing analysis to include the identical full length EVI-1 gene with 21 exons as in the patient samples (data not shown). 3.2 ATO inhibits EVI-1 expression in primary leukemia cells, THP-1 and K562 cells and the zebrafish model Primary acute monocytic leukemia cells from one patient with high expression of EVI-1 were treated with 0 or 1 μM ATO for 12 h, 24 h, or 48 h. Subsequently, the EVI-1 expression level was measured by RT-qPCR. ATO distinctly reduced the EVI-1 mRNA expression (compared with 0 µM ATO at the same duration, P<0.05, Fig 2A). To identify whether the EVI-1 gene is the molecular target of ATO in vitro, the THP-1 cell line and K562 cell lines were used. Total RNA was isolated from diverse drug concentration groups and then reversed transcribed to single-stranded cDNA. We used RT-qPCR to determine the relative gene expression and Western blotting to further verify whether ATO changed the protein level of EVI-1 in THP-1 and K562 cells. Between the ATO-treated groups and the normal control group, both of the expression levels of EVI-1 mRNA and protein were significantly reduced in the leukemia cell lines (Fig 2B). The results suggested that the EVI-1 gene was the molecular target of ATO in vitro, which was consistent with the results of our previous study [19]. To examine the mechanisms by which ATO affects EVI-1 in vivo, we examined the inhibitory effects of ATO on EVI-1 transgenic zebrafish. To clarify its toxicity in vivo, we first determined the toxic effects of ATO on zebrafish. The median lethal concentration (LC50) of ATO treatment on zebrafish embryos at 72 hpf was 110.76 ± 5.23 μM. We evaluated the EVI-1 expression in Tg(AML1-EVI-1: HSE; EGFP) transgenic zebrafish embryos over dose courses of ATO exposure (Fig 2C). By contrast to our in vitro study, these two results coincide with each other well. We found ATO could decrease EVI-1 expression in a dose-dependent manner after 72 h (Fig 2C). Taken together, our in vivo and in vitro studies indicate that ATO is an inhibitor of EVI-1 expression. 3.3 ATO induces apoptosis in the leukemia cell lines by activating the JNK signalling pathway To investigate whether the viability reduction of THP-1 and K562 cell lines is because of apoptosis, apoptotic cells were visualized using light microscopy. In the exponential growing phase, THP-1 and K562 cells were incubated with 3 µM of ATO for 48 hours. As observed in the light microscopy images, leukemia cells showed typical apoptotic features. Most of the THP-1 and K562 cells exhibited cell morphology including substantial vacuoles in the cytoplasm, a 7
higher intensity of nuclear staining, karyopyknosis and the formation of crescents and apoptotic bodies (Fig 3A). The apoptotic cells percentage was symbolized as early apoptotic cells (annexin V+/PIstaining, the lower right quadrant) plus late apoptotic cells (annexin V+/PI+ staining, the upper right quadrant) (Fig 3B). In cytometric analysis, the proportion of apoptotic THP-1 and K562 cells was distinctly rised by ATO in a dose-dependent manner. To elaborate the mechanism that underlies the apoptotic functions of ATO, our study determined changes in the JNK-mediated apoptotic signalling pathway, which is sited downstream of EVI-1. We found that ATO could raise the expressions of p-JNK, p-P53, PUMA, Bax, caspase-9 (including cleaved-9) and caspase-3 (including cleaved-3) to a great extent but reduced the expressions of Bcl-2 and Bcl-xl (Fig 4). ATO treatment did not significantly modify the level of total JNK and caspase-8 which is a caspase in the extrinsic pathway (Supplementary Fig1). Thus, ATO induced the apoptosis of THP-1 and K562 cells which are human monocytic leukemia cell line and human chronic myelogenous leukemia cell line via activation of the JNK signalling pathway. 3.4 Inhibition of JNK suppresses ATO-induced leukemia cell apoptosis To further delineate the mechanism of the JNK pathway in ATO-mediated leukemia cell apoptosis, we examined whether the inhibitor of JNK (SP600125) could reverse ATO-induced apoptosis in THP-1 cells. SP600125 is a potent, cell-permeable, selective and reversible inhibitor of the JNK pathway that inhibits JNK phosphorylation in a dose-dependent manner [20]. In preliminary experiments, we determined the appropriate method and concentration for treatment with the specific JNK inhibitor SP600125. Treatment with SP600125 10 µM did not affect the viability or apoptotic rate of normal THP-1 cells（Supplementary Fig2）. THP-1 cells were incubated with 10 µM SP600125 for 2 h before ATO treatment. SP600125 not only decreased the pro-apoptotic function of ATO in THP-1 cell line (Fig 5A and 5B) but also decreased the activation of the JNK-mediated apoptotic signalling pathway (Fig 5C). SP600125 silenced the activation of JNK by completely inhibiting the phosphorylation of JNK but had little effect on EVI-1 expression (Fig 5C). Thus, EVI-1 is located upstream of JNK. 3.5 EVI-1 knockdown in THP-1 and K562 cells induces apoptosis while regulating the JNK signalling pathway Given that the inhibition of the JNK signalling pathway could regulate THP-1 and K562 cell apoptosis without affecting EVI-1 expression, to test whether EVI-1 was located upstream of the JNK pathway and whether EVI-1 modulates apoptosis via the JNK signalling pathway, we transiently transfected THP-1 and K562 cells with siRNA against EVI-1 and a siRNA control. In these two human leukemia cell lines, the down-regulation of EVI-1 expression due to siRNA transfection was corroborated using RT-qPCR and Western blots at 48 and 72 h, respectively (Fig 8
6A, Fig 7A). In three independent experiments, EVI-1 knockdown induced cell apoptosis (Fig 6B, Fig 7B). To examine whether EVI-1 regulated apoptosis by affecting the JNK pathway, we measured phosphorylation of JNK in THP-1 and K562 cells transfected with control or EVI-1 siRNAs. Knocking down EVI-1 resulted in the suppression of Bcl-2 expression and the promotion of p-JNK, Bax, PUMA (Fig 6C, Fig 7C). Thus, silencing EVI-1 had profoundly affected the activation of JNK pathway and induction of the leukemia cell lines (THP-1 and K562) apoptosis. 4. Discussion Our results first demonstrated that EVI-1 regulated ATO-induced apoptosis through the JNK pathway. We found that the pro-apoptotic effect of ATO in AML cell lines was mediated by the expression of EVI-1. Furthermore, the JNK signal pathway activation was crucial in the ATO-induced apoptosis of EVI-1-positive AML cells. The application of ATO since the early 1990s has improved the clinical outcomes of APL [8]. Distinct pro-apoptotic effect is a significant characteristic of this drug. Initial researches indicated that ATO pro-apoptotic role is related to the suppression of Bcl-2 and regulation the protein levels of PML-RAR alpha/PML [21]. Our previous study demonstrated that ATO can downregulate EVI-1 expression in THP-1 cells [19]. In our in vitro and vivo research, we found that ATO can inhibit EVI-1 expression in human chronic myelogenous leukemia cell line (K562) and a zebrafish model. Murine bone marrow infection and transplantation experiments were performed by two independent groups and demonstrated that EVI-1 overexpression induces an MDS-like disease in recipient mice [22]. These animal models disclosed that in order to develop leukemia EVI-1 needs extra genetic events, such as overexpression of HoxA9/Meis1 and mutations of AML1/RUNX1 [23，24]. Leukemia is a malignant clonal disease from hemopoietic stem cells, suggesting a stem cell phenotype of leukemia cell lines. The EVI-1 aberrant expression was frequently found in patients with MDS and AML [25]. Our results found that PBMCs from healthy donors expressed an extremely low level of EVI-1 mRNA and protein; however, the five leukemia cell lines (MV4-11, K562, HL-60, U937 and THP-1) and primary acute myeloid leukaemic cells from patients had higher EVI-1 expression. Gene sequencing analysis corroborated that the patients’ primary cells and leukemia cells (THP-1 and K562) contained the same full length EVI-1 gene. In vitro evidence indicated that ATO can inhibit EVI-1 mRNA expression. In addition, the EVI-1 gene spliced forms encode three distinct proteins, leastways: EVI-1 (145 kDa), MDS1/EVI-1 (200 kDa) and EVI- 1Δ324 (88 kDa) [26]. Our Western blotting results showed that the THP-1 cell line expressed EVI-1 proteins encoded by the EVI-1 and EVI-1Δ324 variants but not the MDS1/EVI-1 splicing variant. ATO also down-regulated EVI-1 9
protein variants in the THP-1 cell line. A Japanese study cloned the human EVI-1 gene into NIH3T3 mouse fibroblasts and mouse bone marrow and found that ATO could degrade EVI-1 protein without affecting EVI-1 mRNA [14], which is inconsistent with the results of our study. The cause of this discrepancy may be the different gene regulation mechanisms present in humans versus mice. Our results found that ATO could induce apoptosis and decreased the EVI-1 expression (both mRNA and protein levels), however, ATO increased the expressions of p-JNK (the activated form of JNK) in THP-1 and K562 cell line. Our study suggested that ATO could induce apoptosis in leukemia cells by suppressing EVI-1 expression, thereby decreasing the suppressive influences of EVI-1 on JNK signalling. To further investigate the correlation between EVI-1 and the JNK pathway, the expression of EVI-1 was knocked down in leukemia cell lines with siRNA. The results of our experiments showed that EVI-1 knockdown activated the JNK pathway and induced cell apoptosis, indicating that EVI-1 expression is closely related to JNK signalling. Apoptotic activity and the expression levels of p-JNK, PUMA, Bax, and cleaved caspase 3, all of which are correlated with JNK signalling, were modified when EVI-1 was knocked down. Likewise, several studies demonstrated that the EVI-1 oncoprotein plays a role as an inhibitor of JNK, thereby suppressing apoptosis [7, 27, 28]. Our study demonstrated that the JNK signalling pathway was activated in ATO-treated leukemia cells. Downstream of pathway activation, p-JNK (activated form of JNK) translocates to the nucleus, where it phosphorylates and activates P53, which exerts anti-cancer activities (Fig 8) [29]. In the context of apoptosis, p-P53 (activated P53) can bind different sites of DNA and activate the pro-apoptotic genes expression, including PUMA, Bax, as well as caspase, while inactivating anti-apoptotic proteins, such as Bcl-2 and Bcl-xl (Fig 8) [30]. PUMA is a member of the BH3-only group of Bcl-2 family proteins, and it is one of the downstream targets of the tumour suppressor P53 [31, 32]. Under normal circumstances, the expression level of PUMA is very low, while its expression is significantly activated after the exposure of cells to DNA-damaging agents, such as chemotherapeutic drugs and ionizing radiation [33]. The activation of PUMA by DNA damage is dependent on P53 and occurs through the direct binding of p-P53 to the PUMA promoter region [34]. The apoptosis regulator Bcl-2 belongs to a family of evolutionarily related proteins. These proteins can be either pro-apoptotic (including Bax) or anti-apoptotic (including Bcl-2 and Bcl-xl). The anti-apoptotic proteins (e.g., Bcl-2 and Bcl-xL) inhibit apoptosis through heterodimerization with Bax [35]. PUMA initiates apoptosis in part by dissociating Bax and Bcl-2 or Bcl-xL, thereby promoting Bax multimerization and mitochondrial translocation [34, 36] (Fig 8). The caspase family of 13 aspartate-specific cysteine proteases plays an essential role in the execution of the apoptotic programme. Caspase-9 forms an apoptosome complex upon binding cytochrome c and Apaf-1 and activates the executive caspases 3, 6 and 7 10
[37]. Caspase-3 is a central terminator of apoptotic pathways [38]. The sequential activation of caspases plays a central role in the execution phase of apoptosis (Fig 8). These results indicate that the apoptosis of THP-1 and K562 cells could be induced by ATO in a dose-dependent manner. Using Western blot, our study found that ATO treatment distinctly upregulated the expressions of p-P53, PUMA, Bax, caspase-9 and caspase-3 (including cleaved caspase-9 and cleaved caspase-3) while downregulated the expressions of Bcl-2 and Bcl-xL. Nevertheless, in our study, there is no significant difference in the caspase-8 expression, which is the typical protein marker of the extrinsic apoptotic pathway. This finding suggests that ATO-induced apoptosis in THP-1 and K562 cells is mostly mediated through the mitochondrial apoptotic pathway. A similar observation was documented in APL cells with respect to ATO-mediated apoptosis through H2O2 accumulation, which is followed by changes in mitochondrial transmembrane permeability, cytochrome C release and caspase activation [39]. To further clarify the roles of EVI-1 and JNK in the apoptosis induced by ATO, we used the specific JNK inhibitor SP600125. SP600125 inhibited the p-JNK protein and decreased the level of apoptosis in leukemia cells induced by ATO. However, although SP600125 completely silenced the expression of p-JNK, it only partially reversed the apoptosis caused by ATO, suggesting that other mechanisms may be involved. In addition, SP600125 significantly affected the expression of p-JNK, whereas it had little effect on the expression of EVI-1. The results therefore suggest that EVI-1 is located upstream of JNK in this apoptotic signalling pathway. In conclusion, our study demonstrated that the apoptotic pathway in leukemia cells (THP-1 and K562) induced by ATO is closely associated with the oncogene EVI-1, the pro-apoptotic protein, p-JNK, p-P53, PUMA, Bax, caspase-9 and caspase-3 (including cleaved caspase-9 and cleaved caspase-3), and the anti-apoptotic proteins Bcl-2 and Bcl-xL. ATO can downregulate EVI-1 mRNA and oncoprotein and block the repression of EVI-1 in the JNK pathway. Moreover, the activated JNK signalling pathway modulated the apoptosis-associated proteins expressions, including p-P53, PUMA, Bax, Bcl‐ xL, Bcl‐ 2, caspase-9 and caspase-3. These findings may provide a novel theoretical basis for the development of personalized medical strategies for the treatment of EVI-1 positive AML patients. Acknowledgements The authors are very grateful to the members of the Leukemia Research Institute in Ren Ji Hospital and sincerely appreciate the Shanghai Institute of Hematology for excellent technical support. This manuscript has received Wiley's English Language Editing service. The study was partly supported by the National Natural Science Foundation of China Grant (No.81470312).
Conflict of interest 11
The authors declare that there are no conflicts of interest.
References 1. Liang R, Bai QX, Zhang YQ, et al. Reduced tumor lysis syndrome with low dose chemotherapy for hyperleukocytic acute leukemia prior to induction therapy. Asian Pac J Cancer Prev 2011; 12:1807-1811. 2. Wan H, Cai J, Chen F, Zhu J, Zhong J, Zhong H. SOX12: a novel potential target for acute myeloid leukaemia. Br J Haematol 2017; 176:421-430. 3. Mucenski ML, Taylor BA, Ihle JN, et al. Identification of a common ecotropic viral integration site, Evi-1, in the DNA of AKXD murine myeloid tumors. Mol Cell Biol 1988; 8:301-308. 4. Barjesteh van Waalwijk van Doorn-Khosrovani S, Erpelinck C, van Putten WL, et al. High EVI1 expression predicts poor survival in acute myeloid leukemia: a study of 319 de novo AML patients. Blood 2003; 101:837-845. 5. Yuan X, Wang X, Bi K, Jiang G. The role of EVI-1 in normal hematopoiesis and myeloid malignancies (Review). Int J Oncol 2015; 47:2028-2036. 6. Konantz M, André MC, Ebinger M, et al. EVI-1 modulates leukemogenic potential and apoptosis sensitivity in human acute lymphoblastic leukemia. Leukemia 2013; 27:56-65. 7. Kurokawa M, Mitani K, Yamagata T, et al. The evi-1 oncoprotein inhibits c-Jun N-terminal kinase and prevents stress-induced cell death. EMBO J 2000; 19:2958-2968. 8. Wang ZY, Chen Z. Acute promyelocytic leukemia: from highly fatal to highly curable. Blood 2008; 111:2505-2515. 9. Udupa K, Thomas J, Udupa CB, Binu VS, Sharan P. Treatment of Acute Promyelocytic Leukemia with Single Agent Arsenic Trioxide: Experience from a Tertiary Care Center in India. Indian J Hematol Blood Transfus 2017; 33:45-48. 10. Fox E, Razzouk BI, Widemann BC, et al. Phase 1 trial and pharmacokinetic study of arsenic trioxide in children and adolescents with refractory or relapsed acute leukemia, including acute promyelocytic leukemia or lymphoma. Blood 2008; 111:566-573. 11. Lin CC, Hsu C, Hsu CH, Hsu WL, Cheng AL, Yang CH. Arsenic trioxide in patients with hepatocellular carcinoma: a phase II trial. Invest New Drugs 2007; 25:77-84. 12. Schiller GJ, Slack J, Hainsworth JD, et al. Phase II multicenter study of arsenic trioxide in patients with myelodysplastic syndromes. J Clin Oncol 2006; 24:2456-2464. 13. Redondo-Muñoz J, Escobar-Díaz E, Hernández Del Cerro M, et al. Induction of B-chronic lymphocytic leukemia cell apoptosis by arsenic trioxide involves suppression of the phosphoinositide 3-kinase/Akt survival pathway via c-jun-NH2 terminal kinase activation and PTEN upregulation. Clin Cancer Res 2010; 16:4382-4391. 14. Shackelford D, Kenific C, Blusztajn A, Waxman S, Ren R. Targeted degradation of the AML1/MDS1/EVI1 oncoprotein by arsenic trioxide. Cancer Res 2006; 66:11360-11369. 15. Jing L, Zon LI. Zebrafish as a model for normal and malignant hematopoiesis. Dis Model Mech 2011; 4:433-438. 16. Amatruda JF, Shepard JL, Stern HM, Zon LI. Zebrafish as a cancer model system. Cancer Cell 2002; 1: 229-231. 17. Shen LJ, Chen FY, Zhang Y, et al. MYCN transgenic zebrafish model with the characterization of acute myeloid leukemia and altered hematopoiesis. PLoS One 2013; 8:e59070. 18. Goyama S, Yamamoto G, Shimabe M, et al. Evi-1 is a critical regulator for hematopoietic stem cells and transformed leukemic cells. Cell Stem Cell 2008; 3:207-220. 19. Zhou LY, Chen FY, Shen LJ, Wan HX, Zhong JH. Arsenic trioxide induces apoptosis in the THP1 cell line by downregulating EVI-1. Exp Ther Med 2014; 8:85-90. 20. Bennett BL, Sasaki DT, Murray BW, et al. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci U S A 2001; 98:13681-13686. 21. Chen GQ, Zhu J, Shi XG, et al. In vitro studies on cellular and molecular mechanisms of arsenic trioxide (As2O3) in the treatment of acute promyelocytic leukemia: As2O3 induces NB4 cell apoptosis with downregulation of Bcl-2 expression and modulation of PML-RAR alpha/PML proteins. Blood 1996; 88:1052-1061. 22. Buonamici S, Li D, Chi Y, et al. EVI1 induces myelodysplastic syndrome in mice. J Clin Invest 2004; 12
114:713-719. 23. Jin G, Yamazaki Y, Takuwa M, et al. Trib1 and Evi1 cooperate with Hoxa and Meis1 in myeloid leukemogenesis. Blood 2007; 109:3998-4005. 24. Watanabe-Okochi N, Kitaura J, Ono R, et al. AML1 mutations induced MDS and MDS/AML in a mouse BMT model. Blood 2008; 111:4297-4308. 25. Xu K, Wang L, Hao Y, et al. Evi-1 and MDS1-Evi-1 genes in pathogenesis of myelodysplastic syndromes and post-MDS acute myeloid leukemia. Chin Med J (Engl) 1999; 112:1112-1118. 26. Morishita K, Parganas E, Douglass EC, Ihle JN. Unique expression of the human Evi-1 gene in an endometrial carcinoma cell line: sequence of cDNAs and structure of alternatively spliced transcripts. Oncogene 1990; 5:963-971. 27. Mitani K. Molecular mechanisms of leukemogenesis by AML1/EVI-1. Oncogene 2004; 23: 4263-4269. 28. Shen L, Zhu J, Chen F, et al. RUNX1-Evi-1 fusion gene inhibited differentiation and apoptosis in myelopoiesis: an in vivo study. BMC Cancer 2015; 15:970. 29. Johnson GL, Nakamura K. The c-jun kinase/stress-activated pathway: regulation, function and role in human disease. Biochim Biophys Acta 2007; 1773: 1341-1348. 30. Lee TL, Yeh J, Friedman J, et al. A signal network involving coactivated NF-kappaB and STAT3 and altered p53 modulates BAX/BCL-XL expression and promotes cell survival of head and neck squamous cell carcinomas. Int J Cancer 2008; 122:1987-1998. 31. Nakano K, Vousden KH. PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell 2001; 7:683-694. 32. Raz L, Zhang QG, Han D, Dong Y, De Sevilla L, Brann DW. Acetylation of the pro-apoptotic factor, p53 in the hippocampus following cerebral ischemia and modulation by estrogen. PLoS One 2011; 6:e27039. 33. Tanaka Y, Nakamura A, Morioka MS, et al. Systems analysis of ATF3 in stress response and cancer reveals opposing effects on pro-apoptotic genes in p53 pathway. PLoS One 2011; 6:e26848. 34. Garrison SP, Phillips DC, Jeffers JR, et al. Genetically defining the mechanism of Puma- and Bim-induced apoptosis. Cell Death Differ 2012; 19:642-649. 35. Zhang Z, Lapolla SM, Annis MG, et al. Bcl-2 homodimerization involves two distinct binding surfaces, a topographic arrangement that provides an effective mechanism for Bcl-2 to capture activated Bax. J Biol Chem 2004; 279:43920-43928. 36. Zhang Y, Xing D, Liu L. PUMA promotes Bax translocation by both directly interacting with Bax and by competitive binding to Bcl-X L during UV-induced apoptosis. Mol Biol Cell 2009; 20:3077-3087. 37. Sun C, Guo XX, Zhu D, et al. Apoptosis is induced in cancer cells via the mitochondrial pathway by the novel xylocydine-derived compound JRS-15. Int J Mol Sci 2013; 14:850-870. 38. Yang B, Lu Y, Zhang A, et al. Doxycycline Induces Apoptosis and Inhibits Proliferation and Invasion of Human Cervical Carcinoma Stem Cells. PLoS One 2015; 10:e0129138. 39. Chou WC, Jie C, Kenedy AA, Jones RJ, Trush MA, Dang CV. Role of NADPH oxidase in arsenic-induced reactive oxygen species formation and cytotoxicity in myeloid leukemia cells. Proc Natl Acad Sci U S A 2004; 101:4578-4583.
Fig 1. EVI-1 gene expression levels in primary acute myeloid leukemia cells and leukemia cell lines. Fig 1A. EVI-1 expression in the BMMNCs of AML patients (n=11) and healthy donors. EVI-1 mRNA expression was higher in bone marrow mononuclear cells (BMMNCs) from the acute myeloid leukemia (AML) patients than in those from health donors. EVI-1, Ecotropic Viral Integration site-1. Fig 1B. Relative mRNA expression levels of EVI-1 in five leukemia cell lines and peripheral blood mononuclear cells (PBMC) from a healthy adult. Quantification of EVI-1 mRNA expression by quantitative real-time PCR, levels were normalized to an endogenous control, β-actin, by the 2-ΔCt method. The histogram shows mean ± SEM from at least three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 vs. healthy control group. Fig 1C. EVI-1 protein expression levels in five leukemia cell lines and PBMC from a healthy adult. Upper panel: Protein was extracted from each of the indicated cell lines and equal amounts of whole cell lysate were subjected to Western blotting and probed with anti-EVI-1 and anti-β-actin antibodies. Lower panel: Densitometry was performed to determine the expression of 13
EVI-1 protein in each of the cell lines. This was calculated by dividing the intensity of EVI-1 band over that of the loading control, β-actin. The histogram shows mean ± SEM from three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 vs. healthy control group. Fig 2 ATO down-regulated EVI-1 mRNA in primary acute monocytic leukemia cells, THP-1 and K562 cell lines and zebrafish model. Fig 2A. Relative mRNA expression levels of EVI-1 in primary acute monocytic leukemia treated with 0 or 1 μM ATO for 12h, 24h, 48h. Quantification of EVI-1 mRNA expression by quantitative real-time PCR, levels were normalized to an endogenous control, β-actin, by the 2-ΔCt method. The histogram shows mean ± SEM from at least three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control group. Fig 2B. (1) Relative mRNA expression levels of EVI-1 in THP-1 cell line and K562 cell line treated with 0,1,3,5μM ATO for 48h. Quantification of EVI-1 mRNA expression by quantitative real-time PCR, levels were normalized to an endogenous control, β-actin, by the 2-ΔCt method. The histogram shows mean ± SEM from at least three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control group. (2) EVI-1 protein expression levels in THP-1 and K562 cell lines after stimulation with different doses(0,1,3,5 μM) of ATO for 48h. Expression of EVI-1 in dose course stimulations were analyzed using Western blots. The histogram shows mean ± SEM from at least three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control group. Fig 2C. ATO down-regulated EVI-1 mRNA expression in EVI-1 transgenic zebrafish Representative RT-PCR results. EVI-1 CT, plasmid containing EVI-1 gene (positive control). Blank control without template. Quantitative results are expressed as the means ± standard deviation (n=3), *P<0.05 vs. control group; #P<0.05 vs. the previous concentration at the same time point. CT, control. Fig 3. Induction of apoptosis by ATO in THP-1 and K562 cell lines. Fig 3A. Morphological changes in the THP-1 and K562 cell line treated with ATO were observed using light microscopy (hematoxylin and eosin staining; magnification, ×1,000). Compared with the control group, cells treated with 0 or 3 µM ATO for 48h exhibited typical apoptotic characteristics, including a large number of bubbles in the cytoplasm, higher intensity of nuclear staining, karyopyknosis and the formation of crescents and apoptotic bodies Fig 3B. Flow cytometry analysis was conducted to analyze the apoptosis rate induced by ATO in THP-1 and K562 cells. Four subpopulations and their fractions are indicated: early apoptotic cells (lower right), late apoptotic cells (upper right), normal cells (lower left) and dead cells (upper left). The apoptotic index was expressed as the number of apoptotic cells/the total number of cells counted ×100%. Data are representatives of three independent experiments with similar results and expressed as the means ± standard deviation. *P<0.05, vs. control group; *P<0.05, vs. previous concentration at the same point. Fig 4. Altered levels of EVI-1, JNK, p-JNK, P-p53, PUMA, Bcl-2, Bcl-xL, Bax, full length caspase-9, cleaved caspase-9, full length caspase-3, cleaved caspase-3 proteins in THP-1 and K562 cell line treated with ATO. THP-1 and K562 cells were treated with 0,1,3μM ATO for 48 hours. Total lysates of the cells were subjected to SDS-PAGE electrophoresis and blotted with the antibodies against the molecules of apoptosis pathways. The data are representative of 3 experiments. Fig 5. Specific JNK inhibitor SP600125 not only decreased the pro-apoptotic effect of ATO in THP-1 cells but also suppressed the activation of JNK signal pathway Fig 5A. SP600125 decreased the pro-apoptotic effect of ATO in THP-1 cells. Morphological changes in the THP-1 cell line treated with or without ATO or SP600125 (hematoxylin and eosin staining; magnification, ×1,000). Fig 5B. Representative apoptotic ratio results detected using flow cytometry are shown. Four subpopulations and their fractions are indicated: early apoptotic cells (lower right), late apoptotic cells (upper right), normal cells (lower left) and dead cells (upper 14
left). The apoptotic index was expressed as the number of apoptotic cells/the total number of cells counted ×100%. Data are representatives of three independent experiments with similar results and expressed as the means ± standard deviation. *P<0.05, vs. control group; **P<0.01 vs. the ATO group. Fig 5C. Effect of SP600125 and ATO on JNK pathway. THP-1 were treated with 0μM，5μM ATO, 5μM ATO+10μM SP600125 for 48h respectively. Total lysates of the cells were subjected to SDS-PAGE electrophoresis and blotted with the antibodies against the molecules of JNK pathways. The data are representative of 3 experiments. Fig 6.EVI-1 knockdown in THP-1 cells induced cell apoptosis with regulating JNK signaling pathway Fig 6A Knockdown of EVI-1 was confirmed by RT-qPCR and western blots. Fig.6B EVI-1 knockdown induce cell apoptosis in culture. Morphological changes in the THP-1 cell line treated with scramble or EVI-1 siRNA after 72h (hematoxylin and eosin staining; magnification, ×1,000). Representative apoptotic ratio results detected using flow cytometry are shown. Four subpopulations and their fractions are indicated: early apoptotic cells (lower right), late apoptotic cells (upper right), normal cells (lower left) and dead cells (upper left). The apoptotic index was expressed as the number of apoptotic cells/the total number of cells counted ×100%. Data are representatives of three independent experiments with similar results and expressed as the means ± standard deviation. *P<0.05, **P<0.01, ***P < 0.001 vs. the control group. Fig 6C. Knockdown of EVI-1 regulated JNK pathway by promotion of p-JNK, Bax, Puma and suppression of Bcl-2. Protein was extracted from each of the indicated cell lines and equal amounts of whole cell lysate were subjected to Western blotting and probed with anti-EVI1 and anti- JNK pathway antibodies. Fig 7. EVI-1 knockdown in K562 cells induced cell apoptosis with regulating JNK signaling pathway Fig 7A Knockdown of EVI-1 was confirmed by RT-qPCR and western blots. Fig.7B EVI-1 knockdown induce cell apoptosis in culture. Morphological changes in the THP-1 cell line treated with scramble or EVI-1 siRNA after 72h (hematoxylin and eosin staining; magnification, ×1,000). Representative apoptotic ratio results detected using flow cytometry are shown. Four subpopulations and their fractions are indicated: early apoptotic cells (lower right), late apoptotic cells (upper right), normal cells (lower left) and dead cells (upper left). The apoptotic index was expressed as the number of apoptotic cells/the total number of cells counted ×100%. Data are representatives of three independent experiments with similar results and expressed as the means ± standard deviation. *P<0.05, **P<0.01, ***P < 0.001 vs. the control group. Fig 7C. Knockdown of EVI-1 regulated JNK pathway by promotion of p-JNK, Bax, Puma and suppression of Bcl-2. Protein was extracted from each of the indicated cell lines and equal amounts of whole cell lysate were subjected to Western blotting and probed with anti-EVI1 and anti- JNK pathway antibodies. Fig 8. A schematic model of EVI-1 modulating JNK signaling pathway in leukemia cell. Downregulation of EVI-1 could activate JNK pathway and induce cell apoptosis. Supplemental Fig 1. Altered level of caspase-8 protein in THP-1 and K562 cell line treated with ATO. THP-1 and K562 cells were treated with 0,1,3μM ATO for48 hours. Total lysates of the cells were subjected to SDS-PAGE electrophoresis and blotted with the antibodies against the molecules of apoptosis pathways. The data are representative of 3 experiments. Supplementary Fig 2. Treatment with specific JNK inhibitor SP600125 10 µM did not affect the apoptotic rate of normal THP-1 cells. Supplementary Fig 2A. Morphological changes in the THP-1 cell line treated with or without 10 µM SP600125 after 48 hours (hematoxylin and eosin staining; magnification, ×1,000). Supplementary Fig 2B. Representative apoptotic ratio results detected using flow cytometry are shown. Four subpopulations and their fractions are indicated: early apoptotic cells (lower right), late apoptotic cells (upper right), normal cells (lower left) and dead cells (upper left). The apoptotic index was expressed as the number of apoptotic cells/the total number of cells counted ×100%. Data are representatives of three independent experiments with similar results and expressed as the means ± standard deviation. Supplementary Fig 2C. 15
Effect of 10 µM SP600125 on JNK pathway for 48h. Total lysates of the cells were subjected to SDS-PAGE electrophoresis and blotted with the antibodies against the molecules of JNK pathways. The data are representative of 3 experiments. CT: Control group.
16
Fig. 1
17
Fig. 2
18
Fig. 3
19
Fig. 4
20
Fig. 5
21
Fig. 6
22
Fig. 7
23
Fig. 8
Graphical Abstract 24
Table I. Primer sequences Gene EVI-1 primer β-actin primer EVI-1 siRNA#1 EVI-1 siRNA#2 Scramble
Sequence Forward: CACATTCGCTCTCAGCATGT Reverse: GCTGTGGATGTGCTTGTGTT Forward: CATGTACGTTGCTATCCAGGC Reverse: CTCCTTAATGTCACGCACGAT Forward:GCUGAUUGCAGAACCCAAATT Reverse:UUUGGGUUCUGCAAUCAGCTT Forward:GGAAGCAACGUCGAAUCAATT Reverse:UUGAUUCGACGUUGCUUCCTT Forward:UUCUCCGAACGUGUCACGUTT Reverse:ACGUGACACGUUCGGAGAATT
EVI-1: ecotropic viral integration site-1 , siRNA: Small interfering RNA
25