C3d receptor (CR2, CD21) which is due to alternative exon usagefn3

\ PERGAMON

Molecular Immunology Molecular Immunology 24 "0887# 0914Ð0920

Evidence for a new transcript of the EpsteinÐBarr virus:C2d receptor "CR1\ CD10# which is due to alternative exon usage0 M[ Barel\ M[ Balbo\ R[ Frade Immunochimie des Regulations Cellulaires et des Interactions Virales\ INSERM U[243\ Centre INSERM\ Ho¼pital Saint!Antoine\ 64901\ Paris\ France Received 4 August 0887^ accepted 18 September 0887

Abstract CR1 extracellular domain is constituted of 04 or 05 Short Consensus Repeats "SCR#\ with additional SCR 00 localized between SCRs 09 and 01[ We ampli_ed Raji cDNA library\ with speci_c primers where SCR 00 is localized[ This generated a new fragment of 532 bp "05b SCR#\ in addition to the two expected transcripts of 378 "04 SCR# and 556 "05a SCR# bp[ Sequencing these three fragments and the corresponding genomic DNA\ demonstrated the presence of a 13 bp deletion in 05b SCR\ without change of open reading frame and that this 13 bp region was ~anked by two splicing acceptor sites[ This supported a new alternative splicing of CR1\ with generation of a third distinct mRNA[ This third transcript was expressed in human CR1 positive T cells\ normal or transformed B cells and EBV negative B cell lines[ The 13 bp deletion corresponds to a proline!rich region\ which may in~uence CR1 conformation and more likely have consequences on CR1 extra and intracellular interactions[ Þ 0888 Elsevier Science Ltd[ All rights reserved[ Keywords] Human CR1^ Gene regulation

0[ Introduction CR1\ the receptor for C2d\ the 22 kDa fragment of the third component of complement "Iida et al[\ 0872\ Weis et al[\ 0873\ Frade et al[\ 0874a# is a 039 kDa membrane glycoprotein isolated from Raji cell surface "Barel et al[\ 0870#\ which interacts with the LYNVEA site expressed on C2d fragment "Lambris et al[\ 0874# and also access! ible on C2b and C2bi fragments "Frade\ 0882#[ CR1 is also the EBV receptor "EBV:C2dR\ CD10# "Fingeroth et al[\ 0873^ Frade et al[\ 0874b#[ CR1 binds to its two extracellular ligands\ the C2d and the EBV capsid gly! coprotein gp249:119 "Tanner et al[\ 0876#\ through two distinct binding sites\ as shown using polyclonal anti! idiotypic anti!EBV:C2dR antibody "Ab1# "Barel et al[\  Corresponding author] Raymond Frade\ Immunochimie des Regu! lations Cellulaires et des Interactions Virales\ INSERM U[243\ Centre INSERM\ Ho¼pital Saint!Antoine\ 64901\ Paris\ France[ Tel[] "22# "0# "38 17 35 95#^ fax] "22# "0# "32 39 69 07#^ e!mail] frade243Ýeasynet[fr Abbreviations] CR1\ Complement receptor type 1^ EBV\ EpsteinÐBarr virus^ SCR\ Short consensus repeats^ TAPA!0\ Target of anti!pro! liferative antibody 0^ LCL\ Lymphoblastoid cell lines[ 0 This work was supported by Institut National de la Sante et de la Recherche Medicale "INSERM#\ Association pour la Recherche contre le Cancer "ARC# and Comite de Paris de La Ligue Nationale Francžaise contre le Cancer[

0877# or CR1 chimera and synthetic peptides "Molina et al[\ 0880^ Martin et al[\ 0880#[ Deletion mutants allowed to localize binding sites for EBV and C2d on SCRs 0 and 1 "Carel et al[\ 0889#[ CR1 also interacts with autoan! tibodies present in serum of polyarthrite rhumatoid pat! ients "Barel et al[\ 0875# and with CD12 "Aubry et al[\ 0881#\ CR0\ the C2b receptor "Tuveson et al[\ 0880# and CD08 "Matsumoto et al[\ 0880#[ CR1 and CD08 form a membrane complex which also involves TAPA!0 and Leu!02 "Bradbury et al[\ 0881#[ CR1 allows C2d and EBV to induce proliferation "Hatzfeld et al[\ 0876^ Frade et al[\ 0874c# or trans! formation "Frade et al[\ 0874b#\ respectively[ One of the most early events in these two biological functions is the crosslinking of CR1 at cell surface by speci_c extra! cellular multivalent ligands\ as F"ab?#1 fragments of poly! clonal anti!CR1 Ab "Frade et al[\ 0874c#\ OKB6 an anti! CR1 mAb "Nemerow et al[\ 0874#\ particle bound C2d "Melchers et al[\ 0874#\ EpsteinÐBarr virus envelope "Masucci et al[\ 0876# or gp249\ the EBV capsid protein "Tanner et al[\ 0876#\ which activates CR1 and conse! quently enhances B lymphocyte proliferation[ While CR1 has been considered as a speci_c marker of B mature cells\ it is also expressed on immatures thy! mocytes "Tsoukas et al[\ 0877^ Watry et al[\ 0880#\ on T cell lymphomas as Molt!3 "Menezes et al[\ 0866#\ HPB!

S9050Ð4789:88:, ! see front matter Þ 0888 Elsevier Science Ltd[ All rights reserved PII] S 9 0 5 0 Ð 4 7 8 9 " 8 7 # 9 9 9 8 7 Ð 3

0915

M[ Barel et al[:Molecular Immunology 24 "0887# 0914Ð0920

ALL "Fingeroth et al[\ 0877# and Jurkat "Sinha et al[\ 0882# as well as on some populations of T lymphocytes "Fingeroth et al[\ 0877#\ on pharyngial epithelial cells "Young et al[\ 0875#\ on follicular dendritic cells "Gerdes et al[\ 0872# and on astrocytes "Gasque et al[\ 0885#[ Signi_cant amount of CR1 was also localized in nuclei of human B lymphoma cells Raji "Delcayre et al[\ 0876#\ mainly on nuclear pores and at the level of interchromatin _brils rich in ribonucleoproteins "Gau}re et al[\ 0881#[ CR1 also interacted with intracellular proteins as the p42 tumor suppressor protein "Barel et al[\ 0878#\ the p57 {Calcium!binding protein| "Barel et al[\ 0880# or a 019 kda nuclear ribonucleoprotein "RNP# whose in vitro phosphorylation depended on presence of CR1 "Delcayre et al[\ 0876^ Delcayre et al[\ 0878#[ CR1 interacted through two distinct binding sites on its intracellular domain of 23 amino acids with p42 and p57 "Frade et al[\ 0881#[ CR1 cDNA was isolated from a tonsil lymphocyte cDNA library "Weis et al[\ 0875#[ The extracellular domain is constituted of 04 short consensus repeats or SCRs[ These SCRs are units of 59Ð64 amino acids in which the positions of 00Ð03 amino acids are conserved[ Presence of SCRs is a characteristics of proteins which belong to the superfamily of complement proteins "Complement Control Protein# "Reid et al[\ 0875#[ Cloning of CR1 cDNA from Raji cDNA library "Moore et al[\ 0876# allowed the characterization of a clone with an additional SCR "SCR 00# localized between SCRs 09Ð01[ A 04 SCRs CR1 was also found in Raji cDNA "Fujisaku et al[\ 0878#[ Toothaker et al[ "0878# did not establish whether this variability of two CR1 transcripts re~ected an allelic polymorphism or alternative splicing events[ Illges et al[ "0886# demonstrated that CR1 solu! bilisation could not be explained by alternative splicing[ We analyzed CR1 cDNA transcription after speci_c ampli_cation of a large region where the additional SCR is expressed[ We herein demonstrate the existence of a new CR1 transcript\ corresponding to a third form which has never been described before[ Furthermore\ by ana! lyzing genomic sequence of CR1\ we show that tran! scription of this new form is due to an additional alternative splicing of CR1 mRNA transcription[

previously described "Barel et al[\ 0880# and transformed with B84!7 EBV strain "LCL#[ 1[1[ Preparation of cDNA by reverse transcription Two mg total RNA from di}erent cells were prepared with RNAzole "Bioprobe# and incubated at 31>C for 04 min with 9[4 ml RNAse inhibitor at 29 U:ml "Promega#\ 3 ml 14 mM MgCl1\ 1 ml RT 09X "Promega#\ 1 ml 09 mM dNTPs\ 1 ml oligo!dT primer at 499 mg:ml\ 0[4 ml AMV Reverse Transcriptase 12 U:ml "Promega# in 19 ml[ Reac! tion was stopped by heating at 099>C for 4 min[ The UniZAP!XR cDNA library was constructed from 4 mg polyadenylated RNA puri_ed from total RNA of Raji cells\ as described "Drane et al[\ 0886#\ by three successive absorptions on oligo!dT cellulose "Pharmacia# using the ZAPÐcDNA synthesis kit "Stratagene#[ The library con! tained a total of 0×095 pfu:ml and was ampli_ed to a titer of 2×098 pfu:ml[ 1[2[ Cloning of PCR products PCR reactions were performed with CR1a 4| primer GGCAGTAGTCAGATTCGTTG\ nt 0801 on CR1 with 04 SCRs "EMBL] HSEBVR[CR1# and 05 SCRs "EMBL] HSEB1CR1[CR1# and CR1b 2| primer ATTGAG CTTGTACCCATGTT "nt 1399 on 04 SCRs^ nt 1451 on 05 SCRs#[ In some experiments\ CR1c 4| primer CCTGAAATACCAGTTTTGT "nt 0843 on 04 and 05 SCRs# and CR1d 2| primer CTTGGTCACATT CATAAGAG "nt 1140 on 04 SCRs^ nt 1317 on 05 SCRs# were used[ PCR was performed with 099 pmoles of each primer\ 1 mM dNTPs\ 4) DMSO\ 09x bu}er and 1[4 units Taq!DNA Polymerase "Bioprobe#\ cDNA or gen! omic DNA "099!499 ng# or 04 ml cDNA library[ Reaction was brought to 83>C for 3 min\ then for 29 cycles at 83>C for 29 s\ 44>C for 34 s\ 61>C for 89 s\ followed by 09 min at 61>C[ PCR products were analyzed on 0[4) agarose gel in TAE bu}er and further puri_ed with Sephaglass Band Prep Kit "Pharmacia#[ The PCR products were cloned into pGEM!T vector "Promega# and sequenced in both directions using Thermosequenase kit "Amersham#[ 1[3[ Preparation of genomic DNA

1[ Materials and methods 1[0[ Cells Human cells were grown at 26>C\ with 4)CO1\ in RPMI 0539 containing 09) SVF\ with kanamycin and streptomycin at 099 mg:ml\ penicillin at 099 U:ml[ B cells were Raji\ BJAB\ Daudi and Louckes which are CR1¦ Burkitt B lymphomas[ T cells were Molt 3 "CR1¦# and CEM "CR1−#\ both derived from T Acute Leukocyte Lymphoblastoma[ Tonsil B lymphocytes were puri_ed as

Genomic DNA was prepared from 096 cells as described by Sambrook et al[ "0878#\ using the genomic DNA kit "R+D System#[ Brie~y\ genomic DNA was puri_ed by two successive extraction with phenol: chloroforme:isoamyl alcool "14:13:0#\ followed by extraction with 0 vol[ chloroforme:isoamyl alcohol "13:0#[ Genomic DNA was then precipitated by 9[0 vol[ 2 M sodium acetate and 1 vol[ 099) ethanol for 04 min at −79>C[ After washing the pellet with 69) ethanol\ genomic DNA was recovered in TE bu}er[ RNAs were eliminated by incubating for 29 min at 26>C with ribo!

M[ Barel et al[:Molecular Immunology 24 "0887# 0914Ð0920

nuclease A "09 mg:ml#[ Then\ a new extraction with phenol:chloroforme:isoamyl alcohol "14:13:0# was per! formed\ the pellet was washed as previously described and suspended in TE bu}er[ Analysis of splice sites within the sequence ampli_ed from genomic DNA was per! formed using Spliceview program "internet address] http]::lita[itba[mi[cnr[it:½webgene:wwwspliceview!ex[ html#[ All details are available on the Help Page of this web site[ Brie~y\ this program is based on two main assumptions] "a# high frequency of some nucleotides in de_ne site positions^ "b# nucleotides of di}erent site positions considered mutually dependent[

2[ Results and discussion 2[0[ Evidence for a new transcript in Raji B lymphoma cell line Raji cDNA library was submitted to PCR with two speci_c primers\ CR1a and CR1b\ which allowed the ampli_cation of CR1 sequence corresponding to SCRs 8:09Ð02:03\ where the supplementary SCR 00 was local! ized "Moore et al[\ 0876#[ According to the published sequences "Moore et al[\ 0876^ Weis et al[\ 0877#\ these primers should generate two di}erent transcripts of 378 "04 SCR# and 556 "05a SCR# bp\ for 04 and 05 SCRs CR1 respectively[ However\ after migration on 0[4 ) agarose gel "Fig[ 0\ left panel#\ a third fragment of 532 bp "05b SCR# was found[ Two other couples of primers\ CR1a! :CR1d and CR1b:CR1c\ also generated three fragments\ ruling out that this new transcript of CR1 could be an artefactual product of PCR technique "Fig[ 0\ center panel#[ The three fragments were isolated after separation on agarose gel and puri_ed "Fig[ 0\ right panel#[

0916

2[1[ Presence of the new CR1 transcript in different human B cells Presence of this third transcript was looked for in other transformed cell lines and in normal human B lympho! cytes[ Polyadenylated mRNA contained in total RNA was reverse transcribed with oligo!dT primers\ then ampli_ed with CR1a and CR1b primers "Fig[ 1#[ The three tran! scripts were found in all analyzed human cells which expre! ssed CR1] B cells as Raji\ Daudi\ Louckes and BJAB\ and T cells as Molt!3[ None of these transcripts was found in CEM\ a CR1 negative T cell line[ These three transcripts were also present in tonsil B lymphocytes[ Expression of this third transcript was not related to EBV infection\ as it was present in the two EBV negative cell lines\ Louckes and BJAB[ While this technique was not quantitative\ the relative yield of the three transcripts generated with the same couple of primers in each cell showed that the 04 SCR transcript was reproducibly present at a higher level than the two other forms[ Illges et al[ "0886# analyzed some of these cells by using another set of primers[ They also found that 04 SCR transcript was always equal to or higher than 05 SCR\ depending on the cells[ However\ they did not _nd a 05b SCR mRNA\ as their 2| primer was located 296 bp upstream the deletion[ The primers used by Liu et al[ "0886# were identical to the ones we used[ However\ they performed an RT!PCR on dendritic cells and obtained only the 05a SCR[ These results sug! gested that dendritic cells may use di}erent transcriptional machinery\ as neither 04 nor 05b SCR mRNA was present[ 2[2[ Sequence of the three ampli_ed CR1 fragments Nucleotide sequence of these three transcripts "Fig[ 2A# demonstrated that] "a# sequence of 04 SCR fragment "378 nt# corresponded to the sequence previously described "Weis et al[\ 0877^ Fujizaku et al[\ 0878#^ "b# sequence of

Fig[ 0[ Identi_cation of PCR products obtained from Raji cDNA library with di}erent primers[ Left panel] lane 0\ marker^ lanes 1 and 2\ two di}erent experiments performed with CR1a and CR1b primers[ Center panel] lane 0\ marker^ lane 1\ CR1a:CR1d^ lane2\ CR1b:CR1c^ lane 3\ CR1a:CR1b primers[ Right panel] puri_cation of the three PCR fragments[

0917

M[ Barel et al[:Molecular Immunology 24 "0887# 0914Ð0920

Fig[ 1[ Identi_cation of PCR products obtained from the di}erent human cells with CR1a and CR1b primers[

05a SCR fragment "556 nt# corresponded mainly to the published sequence "Moore et al[\ 0876#\ but with some di}erences\ such as addition or mutation of nucleotides\ also observed by Liu et al[ "0886#[ These di}erent nucle! otides did not change the amino acid sequence of the

protein^ "c# sequence of 05b SCR di}ered from that of 05a SCR by a deletion of 13 bp\ localized on nt 1213Ð1236 of 05 SCRs CR1 "Moore et al[\ 0876#[ Alignment and comparison of the three nucleotide sequences dem! onstrated they were identical\ despite presence of the 13

Fig[ 2[ Alignment and comparison of sequences of the three puri_ed fragments[ "A# Nucleotide sequences^ "B# amino acid sequences deduced from nucleotide sequences[ The site where the three proline and the cysteine are deleted in 05b and present in 04 and 05a SCR CR1 isoforms\ is indicated by stars[

M[ Barel et al[:Molecular Immunology 24 "0887# 0914Ð0920

bp deletion in 05b SCR[ This 13 bp deletion did not change the open reading frame "Fig[ 2B#[ These results suggested alternative splicing of the primary CR1 transcript with generation of a third mRNA[ 2[3[ Sequence of genomic DNA Sequence of genomic DNA prepared from Raji cells and ampli_ed with CR1a and CR1b primers "0[85 kbp# was cloned into PGEM!T vector and sequenced "Fig[ 3#[ Sequence of intron 8:09Ð00 was homologous at 87) with that published by Illges et al[ "0886#[ As the sequence of intron 01bÐ02 was not yet published\ we now registered it in EMBL data bank\ under accession number AJ900401[ Comparison of this sequence with data base "Spliceview# containing sequences for splicing acceptor or donor sites demonstrated that the 13 bp region was ~anked by two

0918

splicing acceptor sites "Fig[ 4A#[ This 13 bp region was localized on 4| region of exon 02 "Fig[ 4B#[ In conclusion\ we herein demonstrated the presence of a new CR1 transcript which was generated by an alternative splicing of CR1 exon 02[ This could give rise to putative translation of three di}erent isoforms[ Expression of these three transcripts could account for the di}use and di}erent gel migration observed for CR1 proteins\ since this recep! tor was described as a 039 kDa "Barel et al[\ 0870# or a 034 kDa membrane protein "Weis et al[\ 0873#[ Furthermore\ presence of three successive proline and one cysteine resi! dues among the eight amino acids deleted in 05b SCR strongly suggests potential changes in CR1 05b con! formation which may have consequence on its extra and intracellular interactions[ Indeed\ the cysteine is highly conserved in evolution and is present in most of comp! lement proteins and part of all SCRs "Reid et al[\ 0875#[

Fig[ 3[ Sequence of genomic DNA from Raji cells ampli_ed between primers CR1a and CR1b[ Intron sequences are written in lower!case letters[ Underlined region corresponds to additional SCR 00[

0929

M[ Barel et al[:Molecular Immunology 24 "0887# 0914Ð0920

Fig[ 4[ "A# The 13 bp nucleotide sequence "in bold# which di}ers between 05b and 05a SCR is ~anked by alternative splicing sites[ The consensus sites for alternative splicing are underlined[ Arrows indicate position of the splicing[ Intron sequence is in italic^ "B# CR1 gene may generate a new alternative transcript[ The 13 bp sequence is hatched[ Nomenclature of SCRs and their corresponding exons is given according to Fujisaku et al[ "0878# "# and Illges et al[ "0886# "è#[

Therefore\ the 05b SCR would be a}ected by the deletion inducing a change in globular structure[ Acknowledgments We would like to thank Gerard Drevet\ Nathalie Guibourt and Damien Arnoult for technical assistance[

References Aubry\ J[P[\ Pochon\ S[\ Graber\ P[\ Jansen\ P[\ Bonnefoy\ J[Y[\ 0881[ CD10 is a ligand for CD12 and regulates IgE production[ Nature 247\ 494Ð496[ Barel\ M[\ Charriaut\ C[\ Frade\ R[\ 0870[ Isolation and characterisation of a C2b receptor!like molecule from membranes of a human B lymphoblastoid cell line "Raji#[ FEBS Lett[ 025\ 000Ð003[ Barel\ M[\ Kahan\ A[\ Charriaut!Marlangue\ C[\ Kahan\ A[\ Frade\ R[\ 0875[ Autoantibodies against gp039\ the EpsteinÐBarr virus and C2d receptor in sera from rheumatoid arthritis patients[ Eur[ J[ Immunol[ 05\ 0246Ð0250[ Barel\ M[\ Fiandino\ A[\ Delcayre\ A[X[\ Lyamani\ F[\ Frade\ R[\ 0877[ Monoclonal and anti!idiotypic anti!EBV:C2d receptor "EBV:C2dR# antibodies detect two distinct binding sites\ one for EpsteinÐBarr virus and one for C2d on gp039 the EBV:C2dR\ expressed on human B lymphocytes[ J[ Immunol[ 030\ 0489Ð0484[ Barel\ M[\ Fiandino\ A[\ Lyamani\ F[\ Frade\ R[\ 0878[ EpsteinÐBarr virus:C2d receptor "EBV:C2d R# reacts with p42\ a cellular anti! oncogene encoded membrane phosphoprotein] detection by poly! clonal anti!idiotypic anti!EBV:C2dR antibodies "Ab1#[ Proc[ Natl[ Acad[ Sci[ USA 75\ 09\943Ð09\947[ Barel\ M[\ Gau}re\ A[\ Lyamani\ F[\ Fiandino!Tirel\ A[\ Hermann\ J[\ Frade\ R[\ 0880[ Intracellular interaction of EpsteinÐBarr virus recep!

tor with p57\ a calcium binding protein\ present in normal and not in transformed B lymphocytes[ J[ Immunol[ 036\ 0175Ð0180[ Barel\ M[\ Balbo\ M[\ Gau}re\ A[\ Frade\ R[\ 0884[ Binding sites of the EpsteinÐBarr virus and C2d receptor "CR1\ CD10# for its three intracellular ligands\ the p42 anti!oncoprotein\ the p57 calcium bind! ing protein and the nuclear p019 ribonucleoprotein[ Mol[ Immunol[ 21\ 278Ð286[ Bradbury\ L[E[\ Kansas\ G[S[\ Levy\ S[\ Evans\ R[L[\ Tedder\ T[F[\ 0881[ The CD08:CD10 signal transducing complex of human B lymphocyte includes the target of antiproliferative antibody!0 and leu!02 molecules[ J[ Immunol[ 038\ 1730Ð1749[ Carel\ J[C[\ Myones\ B[L[\ Frazier\ B[\ Holers\ V[M[\ 0889[ Structural requirements for C2d\g:EpsteinÐBarr virus receptor "CR1:CD10# ligand binding\ internalization\ and viral infection[ J[ Biol[ Chem[ 154\ 01\182Ð01\188[ Delcayre\ A[\ Fiandino\ A[\ Barel\ M[\ Frade\ R[\ 0876[ Gp039\ the EBV:C2d receptor "CR1# of human b lymphocytes\ is involved in cell!free phosphorylation of p019\ a nuclear ribonucleoprotein[ Eur[ J[ Immunol[ 06\ 0716Ð0722[ Delcayre\ A[X[\ Fiandino\ A[\ Lyamani\ F[\ Barel\ M[\ R[ Frade\ R[\ 0878[ Enhancement of EpsteinÐBarr virus:C2d receptor "EBV:C2dR or CR1# and nuclear p019 ribonucleoprotein phosphorylation by speci_c EBV:C2d ligands in subcellular fraction of the human B lymphoma cell line\ Raji[ Biochem[ Biophys[ Res[ Comm[ 048\ 0102Ð 0119[ Drane\ P[\ Barel\ M[\ Balbo\ M[\ Frade\ R[\ 0886[ Identi_cation of RB07A\ a 194 kDa new p42 regulatory protein which shares antigenic and functional properties with p42[ Oncogene 04\ 2902Ð2913[ Fingeroth\ J[D[\ Weis\ J[J[\ Tedder\ T[F[\ Strominger\ J[L[\ Biro\ P[A[\ Fearon\ D[T[\ 0873[ EpsteinÐBarr virus receptor of human B lym! phocytes is the C2d receptor CR1[ Proc[ Natl[ Acad[ Sci[ USA 70\ 3409Ð3403[ Fingeroth\ J[D[\ Clabby\ M[L[\ Strominger\ J[L[\ 0877[ Characterization of a T!lymphocyte EpsteinÐBarr virus:C2d receptor "CD10#[ J[ Virol[ 51\ 0331Ð0336[

M[ Barel et al[:Molecular Immunology 24 "0887# 0914Ð0920 Frade\ R[\ Myones\ B[L[\ Barel\ M[\ Krikorian\ L[\ Charriaut\ C[\ Ross\ G[R[\ 0874a[ Gp039\ a C2b!binding membrane component of lym! phocytes\ is the B cell C2dg:C2d receptor "CR1# and is distinct from the neutrophil C2dg receptor "CR3#[ Eur[ J[ Immunol[ 04\ 0081Ð 0086[ Frade\ R[\ Barel\ M[\ Ehlin!Henriksson\ B[\ Klein\ G[\ 0874b[ Gp039\ the C2d receptor "CR1# of human B lymphocytes\ is also the EBV receptor[ Proc[ Natl[ Acad[ Sci[ USA 71\ 0389Ð0382[ Frade\ R[\ Crevon\ M[C[\ Barel\ M[\ Vasquez\ A[\ Krikorian\ L[\ Char! riaut\ C[\ Galanaud\ P[\ 0874c[ Enhancement of human B cell pro! liferation by antibody to the C2d receptor\ the gp039 molecule[ Eur[ J[ Immunol[ 04\ 62Ð65[ Frade\ R[\ Gau}re\ A[\ Hermann\ J[\ Barel\ M[\ 0881[ EBV:C2d receptor "CR1# interacts by its intracytoplasmic carboxy!terminal domain and two distinct binding sites with the p42 anti!oncoprotein and the p57 calcium binding protein[ J[ Immunol[ 038\ 2121Ð2127[ Frade\ R[ 0882[ Signal transduction through the EpsteinÐBarr virus receptor in human B lymphocytes[ In] d|Alessandro\ N[\ Mihich\ E[\ Rausa\ L[\ Tapiero\ H[\ and Tritton\ T[R[ "Eds#\ Cancer therapy] Di}erentiation\ Immunomodulation and Angiogenesis\ SpringerÐ Verlag\ Berlin\ pp[ 22Ð27[ Fujisaku\ A[\ Harley\ J[B[\ Frank\ M[B[\ Gruner\ B[A[\ Frazier B[\ Holers\ V[M[\ 0878[ Genomic organization and polymorphisms of the human C2d:EpsteinÐBarr virus receptor[ J[ Biol[ Chem[ 153\ 1007Ð1014[ Gasque\ P[\ Chan\ P[\ Mauger\ C[\ Schouft\ M[T[\ Singhrao\ S[\ Dierich\ M[P[\ Morgan\ B[P[\ Fontaine\ M[\ 0885[ Identi_cation and charac! terization of complement C2 receptors on human astrocytes[ J[ Immu! nol[ 045\ 1136Ð1144[ Gau}re\ A[\ Viron\ A[\ Barel\ M[\ Hermann\ J[\ Puvion\ E[ and Frade\ R[\ 0881[ Nuclear localization of the EpsteinÐBarr virus:C2d receptor "CR1# in the human burkitt b lymphoma cell\ Raji[ Mol[ Immunol[ 18\ 0002Ð0019[ Gerdes\ J[\ Stein\ H[\ Mason\ D[Y[\ Ziegler\ A[\ 0872[ Human dendritic reticulum cells of lymphoid follicules] their antigenic pro_le and their identi_cation as multinucleated giant cells[ Virchows Arch[ Cell[ Pathol[ 31\ 050Ð054[ Hatzfeld\ J[\ Charriaut!Marlangue\ C[\ Levesque\ J[P[\ Barel\ M[\ Stan! cou\ R[\ Krikorian\ L[\ Hatzfeld\ A[\ Frade\ R[\ 0876[ C2 stimulates proliferation of pre!B Raji cells[ Ann[ Inst[ Pasteur:Immunol[ 027\ 340Ð344[ Iida\ K[\ Nadler\ L[\ Nussenzweig\ V[\ 0872[ Identi_cation of the mem! brane receptor for the complement fragment C2d by means of a monoclonal antibody[ J[ Exp[ Med[ 047\ 0910Ð0922[ Illges\ H[\ Braun\ M[\ Peter\ H[H[\ Melchers\ I[\ 0886[ Analysis of the human CD10 transcription unit reveals di}erential splicing of exon 00 in mature transcripts and excludes alternative splicing as the mech! anism causing solubilization of CD10[ Mol[ Immunol[ 23\ 572Ð582[ Lambris\ J[D[\ Ganu\ V[S[\ Hiran\ S[\ Muller!Eberhard\ H[J[\ 0874[ Map! ping of the C2d receptor "CR1#!binding site and neoantigenic site in the C2d domain of the third component of complement[ Proc[ Natl[ Acad[ Sci[ USA 71\ 3124Ð3128[ Liu\ Y[J[\ Xu\ J[\ de Bouteiller\ O[\ Parham\ C[L[\ Grouard\ G[\ Djossou\ O[\ de Saint!Vis\ B[\ Lebecque\ S[\ Banchereau\ J[\ Moore[\ K[W[\ 0886[ Follicular dendritic cells speci_cally express the long CR1:CD10 isoform[ J[ Exp[ Med[ 074\ 054Ð069[ Martin\ D[R[\ Yuryev\ A[\ Kalli\ K[R[\ Fearon\ D[T[\ Ahearn\ J[M[\ 0880[ Determination of the structural basis for selective binding of EpsteinÐBarr virus to human complement receptor type 1[ J[ Exp[ Med[ 063\ 0188Ð0200[ Masucci\ M[G[\ Szigeti\ R[\ Ernberg\ I[\ Hu\ C[P[\ Torsteinsdottir\ S[\ Frade\ R[\ Klein\ E[\ 0876[ Activation of B lymphocytes by EpsteinÐ Barr virus:CR1 receptor interaction[ Eur[ J[ Immunol[ 06\ 704Ð719[ Matsumoto\ A[K[\ Kopicky!Burd\ J[\ Carter\ R[H[\ Tuveson\ D[A[\ Tedder\ T[F[ Fearon\ D[T[\ 0880[ Intersection of the complement and immune systems] a signal transduction complex of the B lymphocytes containing complement receptor type 1 and CD08[ J[ Exp[ Med[ 062\ 44Ð53[

0920

Melchers\ F[\ Erdei\ A[\ Schultz\ T[\ Dierich\ M[P[\ 0874[ Growth control of activated\ synchronised murine B cells by the C2d fragment of human complement[ Nature 206\ 153Ð156[ Menezes\ J[\ Seigneurin\ J[M[\ Patel\ P[\ Bourkas\ A[\ Lenoir\ G[\ 0866[ Presence of EpsteinÐBarr virus receptors\ but absence of virus pen! etration\ in cells of an EpsteinÐBarr virus genome!negative human lymphoblastoid T line "Molt 3#[ J[ Virol[ 11\ 705Ð710[ Molina\ H[\ Brenner\ C[\ Jacobi\ S[\ Gorka\ J[\ Carel\ J[C[\ Kinoshita\ T[\ Holers\ V[M[\ 0880[ Analysis of EpsteinÐBarr virus binding sites on complement receptor 1 "CR1:CD10# using human!mouse chimeras and peptides[ At least two binding sites are necessary for ligand!receptor interaction[ J[ Biol[ Chem[ 155\ 01\062Ð01\068[ Moore\ M[D[\ Cooper\ N[R[\ Tack\ B[F[\ Nemerow\ G[R[\ 0876[ Molec! ular cloning of the cDNA encoding the EpsteinÐBarr virus:C2d recep! tor "complement receptor type 1# of human B lymphocytes[ Proc[ Natl[ Acad[ Sci[ USA 73\ 8083Ð8087[ Moore\ M[D[\ Discipio\ R[G[\ Cooper\ N[R[\ Nemerow\ G[R[\ 0878[ Hydrodynamic\ electron microscopic\ and ligand!binding analysis of the EpsteinÐBarr virus:C2dg receptor[ J[ Biol[ Chem[ 153\ 19\465Ð 19\471[ Nemerow\ G[R[\ McNaughton\ M[E[\ Cooper\ N[R[\ 0874[ Binding of monoclonal antibody to the Epstein Barr Virus "EBV#:CR1 receptor induces activation and di}erentiation of human B lymphocytes[ J[ Immunol[ 024\ 2957Ð2962[ Reid\ K[B[M[\ Bentley\ D[R[\ Campbell\ R[D[\ Tchung\ L[P[\ Sim\ R[B[\ Kristensen\ T[\ Tack\ B[\ 0875[ Complement system proteins which interact with C2b or C3b] a superfamily of structurally related proteins[ Immunol[ Today 6\ 129Ð123[ Sambrook\ J[\ Fritsch\ E[F[\ Maniatis\ T[\ 0878[ Molecular cloning[ A laboratory manual[ 1nd ed[ Cold Spring Harbor Laboratory Press[ Sinha\ S[K[\ Todd\ S[C[\ Hedrick\ J[A[\ Speiser\ C[L[\ Lambris\ J[D[\ Tsoukas\ C[D[\ 0882[ Characterization of the EBV:C2d receptor on the human Jurkat T cell line] Evidence for a novel transcript[ J[ Immunol[ 049\ 4200Ð4219[ Tanner\ J[\ Weis\ J[\ Fearon\ D[T[\ Whang\ Y[\ Kie}\ E[\ 0876[ EpsteinÐ Barr virus gp249:119 binding to the B lymphocyte C2d receptor mediates adsorption\ capping\ and endocytosis[ Cell[ 49\ 192Ð102[ Toothaker L[E[\ Henjes\ A[J[\ Weis\ J[J[\ 0878[ Variability of CR1 gene products is due to alternative exon usage and di}erent CR1 alleles[ J[ Immunol[ 031\ 2557Ð2564[ Tsoukas\ C[D[\ Lambris\ J[D[\ 0877[ Expression of CR1:EBV receptors on human thymocytes detected by monoclonal antibodies[ Eur[ J[ Immunol[ 07\ 0188Ð0291[ Tuveson\ D[A[\ Ahearn\ J[M[\ Matsumoto\ A[K[\ Fearon\ D[T[\ 0880[ Molecular interactions of complement receptors on B lymphocytes] a CR0:CR1 complex distinct from the CR1:CD08 complex[ J[ Exp[ Med[ 062\ 0972Ð0978[ Watry\ D[\ Hedrick\ J[A[\ Siervo\ S[\ Rhodes\ G[\ Lamberti\ J[J[\ Lambris\ J[D[\ Tsoukas\ C[D[\ 0880[ Infection of human thymocytes by EpsteinÐBarr virus[ J[ Exp[ Med[ 062\ 860Ð879[ Weis\ J[J[\ Tedder\ T[F[\ Fearon\ D[T[\ 0873[ Identi_cation of a 034\999 Mr membrane protein as the C2d receptor "CR1# of human B lym! phocytes[ Proc[ Natl[ Acad[ Sci[ USA 70\ 770Ð774[ Weis\ J[J[\ Fearon\ D[T[\ Klicstein\ L[B[\ Wong\ W[W[\ Richards\ S[A[\ De Bruyn Kops\ A[\ Smith\ J[A[\ Weiss\ J[H[\ 0875[ Identi_cation of a partial cDNA clone for the C2d:EpsteinÐBarr virus receptor of human B lymphocytes] homology with the receptor for fragments C2b and C3b of the third and fourth components of complements[ Proc[ Natl[ Acad[ Sci[ USA 0872\ 4528Ð4532[ Weis\ J[J[\ Toothaker\ L[E[\ Smith\ J[A[\ Weis\ J[H[\ Fearon\ D[T[\ 0877[ Structure of the human B lymphocyte receptor for C2d and the EpsteinÐBarr virus and relatedness to other members of the family of C2:C3 binding proteins[ J[ Exp[ Med[ 056\ 0936Ð0955[ Young\ L[S[\ Clark\ D[\ Sixbey\ J[W[\ Rickinson\ A[B[\ 0875[ EpsteinÐ Barr virus receptor on human pharengeal epithelia[ Lancet 0\ 139Ð 131[