Evidence for an internal and functional circadian clock in rat pituitary cells

Molecular and Cellular Endocrinology 382 (2014) 888–898

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

Evidence for an internal and functional circadian clock in rat pituitary cells Denis Becquet, Bénédicte Boyer, Ramahefarizo Rasolonjanahary, Thierry Brue, Séverine Guillen, Mathias Moreno, Jean-Louis Franc, Anne-Marie François-Bellan ⇑ CRN2M, CNRS UMR 7286, Aix-Marseille Université, Marseille, France

a r t i c l e

i n f o

Article history: Received 6 June 2013 Received in revised form 14 October 2013 Accepted 6 November 2013 Available online 14 November 2013 Keywords: Pituitary cells GH4C1 cells Core-clock genes Clock-controlled genes Circadian oscillator

a b s t r a c t In primary cultures of rat pituitary cells and in a pituitary sommatolactotroph cell line (GH4C1), endogenous core-clock- as well as hormone-genes such as prolactin displayed a rhythmic expression pattern, fitted by a sinusoidal equation in which the period value was close to the circadian one. This is consistent with the presence of a functional circadian oscillator in pituitary cells whose importance was ascertained in GH4C1 cell lines stably expressing a dominant negative mutant of BMAL1. In these cells, both endogenous core-clock- and prolactin-genes no more displayed a circadian pattern. Some genes we recently identified as mouse pituitary BMAL1-regulated genes in a DNA-microarray study, lost their circadian pattern in these cells, suggesting that BMAL1 controlled these genes locally in the pituitary. The intra-pituitary circadian oscillator could then play a role in the physiology of the gland that would not be seen anymore as a structure only driven by hypothalamic rhythmic control. Ó 2013 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Physiology and behavior of organisms are adapted to environmental changes by a multi-oscillatory network able to generate circadian rhythms. In this network, a central clock, localized in the suprachiasmatic nuclei (SCN) of the brain and synchronized to astronomical time, sets the period and phase coherence between and within the oscillators present in the brain and peripheral organs. Indeed in mammals the SCN represents the autonomous biological clock while within peripheral tissues, oscillators are driven and coupled by the SCN and they run out of phase without the driving force of the SCN, resulting in damped oscillations of peripheral organs. At the molecular level, circadian rhythms in central and in peripheral oscillators are cell-autonomous and generated by similar interconnecting transcriptional-translational feedback loops involving several transcription factors encoded by core-clock genes (Guillaumond et al., 2005; Ko and Takahashi, 2006). Transcription of Period1–3 (Per1–3) genes and Cryptochrome1–2 (Cry1–2) genes is activated by a heterodimer containing the products of Bmal1 and Clock genes. In turn, PER and CRY proteins repress their own transcription by inhibiting the activity of CLOCK/BMAL1 dimer. In addition, CLOCK/BMAL1 activates expression of retinoic acid ⇑ Corresponding author. Address: CRN2M, CNRS UMR 7286, Aix-Marseille Université, Faculté de Médecine Nord, 51 Bd Pierre Dramard CS 80011, 13344 Marseille Cedex 15, France. Tel.: +33 491 698 892; fax: +33 491 698 920. E-mail address: [email protected] (A.-M. François-Bellan). 0303-7207/$ - see front matter Ó 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.mce.2013.11.004

receptor-related genes Rora-b and RevErba, whose products in turn respectively stimulate and repress the transcription of the Bmal1 gene, further stabilizing the circadian circuitry. Most of the circadian core-clock genes in the mouse exist as paralog pairs (Per1 and Per2, Cry1 and Cry2, Clock and Npas2) in which each gene of the pair must be knocked out to confer arrhythmicity. The only exception to this pattern is Bmal1 (official gene name Arntl, also known as Mop3), the single knockout of which confers arrhythmicity, despite the presence of its paralog, Bmal2 (official gene name Arntl2 also known as Mop9) (Dardente, 2008; Takahashi, 2004). The pituitary gland is a heterogeneous organ composed of five cell types (somatotroph, lactotroph, thyreotroph, corticotroph and gonadotroph cell lineages) that secrete protein hormones (growth hormone, prolactin, thyreotrophic hormone, adrenocorticotrophic hormone, luteinizing and follicular stimulating hormone) all with a rhythmic pattern. While all pituitary cell types are under the control of hypothalamic factors, it has also been shown that adenohypophyseal cells contain a molecular clock capable to measure time autonomously (Abe et al., 2002). However, a recent study debated this point while finding no evidence for a functional intrinsic clockwork in human pituitary cells (Wunderer et al., 2013). Moreover, if present in pituitary cells, no experimental studies have been conducted to evaluate the importance of this intrinsic clock in the gland physiology. We first used primary cultures of rat pituitary cells to determine whether pituitary cells house a functional circadian oscillator. Then, to look for the importance of this circadian oscillator in the physiology of the pituitary gland, we used a pituitary cell

889

D. Becquet et al. / Molecular and Cellular Endocrinology 382 (2014) 888–898

line, the rat sommatolactotroph GH4C1 cells. We showed that GH4C1 cells also house a functional molecular circadian oscillator. Disruption of the circadian oscillator in GH4C1 cells led to the loss of the circadian expression pattern of some clock-controlled-genes (CCGs). These results suggested that the local circadian oscillator is important for the physiology of the pituitary gland that would play a role within the circadian system as an autonomous generator of circadian rhythmicity and would not be a structure only driven by hypothalamic neuropeptide rhythmic control. 2. Materials and methods 2.1. Primary cultures of rat pituitary cells All procedures were performed in strict accordance with European Economic Community for the care and use of laboratory animals (86/609/EEC and 2010/63/UE) and under a licence granted to D. Becquet (Préfecture des Bouches-du-Rhône, Authorization no. 13-002). The rat pituitary cells were prepared by enzymatic dispersion as previously described (Hopkins and Farquhar, 1973) and adapted to the anterior pituitary (Enjalbert et al., 1986). Briefly, the anterior pituitaries were rapidly removed and dissected in sterile conditions after Sprague–Dawley male rat decapitation. They were rinsed, cut into small pieces in DMEM-0.3% BSA, pH 7.3 (medium A) and incubated in DMEM-0.5% trypsin (from bovine pancreas, Sigma–Aldrich Chimie, Lyon, France) for 15 min at 37 °C. Deoxyribonuclease (2 lg/ml, Sigma–Aldrich) was then added to the medium for 2 min. After enzymatic digestion, the medium was removed and anterior pituitaries were incubated in DMEM containing a trypsin inhibitor, type I-S from Soybean (1 mg/ml, Sigma–Aldrich) for 5 min at 37 °C. The medium was then discarded and pituitaries were incubated in Ca2+ and Mg2+-free medium containing 2 mM EDTA for 5 min at 37 °C, followed by a 15-min incubation in the same medium containing only 1 mM EDTA. All incubation steps were run under very gentle shaking. The cells were rinsed with Ca2+ and Mg2+-free medium and dispersed mechanically in the same medium. After centrifugation at 500g for 10 min and suspension in medium A, cells were counted and plated at a density of 2.5  105 cells per dish culture. Cells were maintained 3 days at 37 °C in DMEM supplemented with: 10% fetal calf serum, 2 mM glutamine, 0.05 mg/ml penicillin and streptomycin in water-saturated atmosphere of 5% CO2. 2.2. Cell line culture and preparation of stably transfected cell lines GH4C1 sommatolactotroph pituitary cells (ATCCÒ CCL-82.2™, Molsheim, France) were grown in HamF10 medium supplemented with 15% horse serum and 2% fetal calf serum. For generation of stable GH4C1 cell lines, cells were transfected with the plasmid of interest and, when necessary, with a plasmid expressing a neomycin resistance gene by Lipofectamine Plus (Invitrogen, Cergy Pontoise, F). Cells were selected with 250 lg/ml G418 (Invitrogen) beginning 48 h after transfection.

The Npas2 proximal promoter was cloned by PCR from mouse genomic DNA using the following primers: 50 -cgggatcccgGCCACTTGCTGGAATGTGAGATGTAG-30 (forward) and 50 -ccgctcgagcggGCTTTGAATTGAGCCTCTTGGTACCT-30 (reverse) and cloned into the pGL3-Basic vector (Promega) to create the Npas2:Luc reporter construct. 2.4. RNA expression analysis Total RNA was prepared from GH4C1 sommatolactotroph cells using an RNAII kit (Macherey Nagel, Hoerdt, F). Total RNA (500 ng) was then used for cDNA synthesis with MMLV (Invitrogen), followed by quantitative Polymerase Chain Reaction (qPCR) using Fast SYBR Green mix (Applied Biosystem, Courtaboeuf, F). Expression of mRNA was normalized to the levels of Gapdh mRNA levels. The sequences of the primers used in qPCR can be found in Table 1. 2.5. Real-time monitoring of rhythmic luciferase activity and mathematical analysis For real-time monitoring of cellular circadian oscillation, 6  105 neomycin-resistant GH4C1 cells were seeded in 35 mm diameter well plates and cultured overnight with growth medium of GH4C1 cells. The next day, the medium was changed with a growth medium containing 100 nM forskolin to synchronize the cellular circadian oscillators. 20 min later, the medium was changed with a DMEM without phenol red medium containing 100 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 100 mM pyruvate and 0.2 mM luciferin. Well plates were then inserted into a Lumicycle bioluminescence monitoring system (Actimetrics Wilmette, IL USA). Firefly luciferase activities in GH4C1 cells with stable, constitutive expression of the pGL2-(Per1E)3:Luc, pGL3-Npas2:Luc and PXP2-Prl:Luc reporter constructs were recorded over 125 h after the forskolin stimulation (T0). The bioluminescence signal was counted for 1 min every 10 min for at least 5 days without changing media, and data where

Table 1 qPCR Primer list (50 –30 ). Bmall Clock Rorc Per2 Reverba Npas2 Prl Gh

2.3. Plasmid constructs

Nono

The pGL2-(Per1E)3 and pcDNA3-BMAL1-R91A (generous gift of Dr. Hosoda) have been described previously (Triqueneaux et al., 2004; Hosoda et al., 2004). Briefly, the vector (Per1E)3-Luc was generated by ligation in triplicate of the following oligonucleotide: 50 -AGATCCAAGTCCACGTG CAGGGC-30 harboring the mPer1 E-box sequence, upstream of a synthetic TATA-box oligonucleotide (50 AGATCTGCATCGGGTATA TAATAA-30 ). The whole fragment was cloned as a XhoI-HindIII fragment in the pGL2 vector (Triqueneaux et al., 2004).

Sfpq Tef Cntn1 Dio2 Gapdh

TCCACAGCACAGGCTACTTGA TTGCAACGAGGCAGCTCAGAT GACAGCCCCACTGTACAATACG TGCGGCATACTGGATGGAAT CTGTGCAGCCAACATGTGGAAA CAGAGGACTCAATGTCAGTGCTGAAG TCTCAGTGCGTTCCCTTATGTGGT CCACTAAGCTCCATCAGTCCAGAGTA TGCCATTGGAGCTGTCACTATAGAGG TGAACAGAGTCCTTCCCTGCAGTA CTGTGTCAGTCGGTAGAGTACTTGGA CAGCCATACAGACAGGAACTAAGTGC AATTAGCCAGGCCTATCCTGAAGC TGGACAATTTGGCACCTCAGGA CCGCGTCTATGAGAAACTGAAGGA GGTTTGCTTGAGGATCTGCCCAAT GTGGAGCCTATGGACCAGTTAGATGA TGTGCAAATCTGGGTGGCTGTT AATGGCCTGTTTGGGCAGGTAA TGGAAATTCAGTGGCACAAGGT GAAGCCCCAGCCTATGATCAAGAAAG GAGCGTTTAGCTGCCACATTGTTC GAGGTCTGGCTCCCGATACATAATCA TGGGGACTTCTATGGAGTGCTTGT CGTGTCCAATCCTGAAGCAGGTAA GAAGGCTGGCAGTTGCCTAGTAAA CCCTCAAGATTGTCAGCAATG GTCCTCAGTGTAGCCCAGGAT

890

D. Becquet et al. / Molecular and Cellular Endocrinology 382 (2014) 888–898

Fig. 1. Rhythmic expression pattern of core-clock genes in primary cultures of rat pituitary cells. To synchronize cells between themselves, cells were treated by forskolin (10 lM, 20 min) and then transferred to fresh medium. Cells were harvested after this forskolin treatment (T0) every 4 h from T0 to T48. At each time point, total RNA was prepared and then used for cDNA synthesis followed by qPCR. Shown are the experimental values from two experiments as well as the sine wave equation that fitted experimental data with an R2 higher than 0.55. Rhythmic expression is considered significantly compatible with a circadian pattern when R2 is higher than 0.55 attesting of the goodness-of-fit and when the 95% confidence interval of the amplitude did not include the zero value.

normalized by subtraction of the 24 h running average from the raw data and then smoothed with a 2 h running average. Data where then fitted to find the set of parameters that gives the least-squared distance between the data and the equation: y(t) = A  sin(2  pi  f_t + fi)  e  t/d + C which included a damping factor (d), and where A is the amplitude, c is the phase, and T is the period.

2.6. Cosinor analysis Mean experimental mRNA values (±SEM), expressed as a percent of initial value, were fitted using Prism4 software (GraphPad Software, Inc.) by a non-linear sine wave equation: Y = Baseline + Amplitudesin (FrequencyX Phase-shift), where Frequency = 2pi/period. Goodness-of-fit was quantified using R squared, experimental values being considered well fitted by cosinor regression when the R squared was higher than 0.55. A statistically significant circadian oscillation was considered if the 95% confidence interval for the amplitude did not include the zero value (zero-amplitude test) (Yang et al., 2009; Kavcic et al., 2011).

3. Results 3.1. Circadian expression of core-clock genes and CCGs in primary cultures of rat pituitary cells Forskolin (10 lM, Sigma–Aldrich) was applied for 20 min to synchronize rat pituitary cells between themselves and then replaced by fresh medium. In order to determine whether gene expression in rat pituitary cells could display a rhythmic pattern, cells were harvested after forskolin treatment (T0) every 4 h from T2 to T35–48. At each time point, total RNA was prepared and then used for cDNA synthesis followed by qPCR. Using the cosinor analysis (Prism4 software), patterns of gene expression were displayed as indicated in Fig. 1, which illustrates a result of single cosinor analysis, including sequential data and the fitted cosinor curve. The zero-amplitude test determines the significance of the circadian rhythms. Bmal1 mRNA levels displayed a pattern in rat pituitary cells over the T2–T48 time period that could be fitted with a non-linear sine wave equation in which the period value (2pi/Frequency) was close to the circadian period value comprised between 20 h and

D. Becquet et al. / Molecular and Cellular Endocrinology 382 (2014) 888–898

891

28 h. Experimental values could indeed be fitted by the following equation y = 131.6  31.86sin (0.230x + 2.11) with a R2 = 0.641 (Fig. 1). The expression of Bmal1 mRNA levels was then compatible with a circadian pattern statistically significant since the 95% confidence interval for the amplitude did not include the zero value (zero-amplitude test) (Yang et al., 2009; Kavcic et al., 2011). By contrast, Clock mRNA levels could not be significantly fitted by a sine wave equation with a period near 24 h (R2 = 0.524) (Fig. 1). Npas2 mRNA levels displayed a pattern in phase with that of Bmal1. This pattern could be circadian since experimental values were fitted by the following equation y = 190.1  80.93sin (0.229x + 1.478) with a R2 = 0.910 (Fig. 1). As expected, rhythmic pattern of Reverba mRNA was antiphasic to that of Bmal1 and fitted by the following equation y = 47.32 + 23.06sin (0.254x + 1.572) with a R2 = 0.563 (Fig. 1). Experimental values for Rorc and Per2 were fitted by the respective following equations: Rorc y = 133.923.87sin (0.266x + 2.038) with a R2 = 0.674; Per2 y = 84.46 + 30.98sin (0.260x + 0.129) with a R2 = 0.684 (Fig. 1). In rat pituitary cells, prolactin (Prl) mRNA levels fluctuated over the T2–T35 time period (Fig. 2A) with a pattern that could be circadian since experimental values could be fitted by the following equation: y = 167 + 35.19sin (0.299x  45.28) with a R2 = 0.606 (Fig. 2A) in which the period value was in the range of circadian values, namely comprised between 20 h and 28 h. Three genes, namely Thyrotroph embryonic factor (Tef), Contactin 1 (Cntn1) and Deiodinase iodothyronine type II (Dio2) whose mRNA level expression follows a circadian pattern in mouse pituitaries, as we recently reported (Guillaumond et al., 2012), were also found here to display a pattern in primary cultures of rat pituitary cell that was compatible with a circadian one (Fig. 2B). Experimental values could indeed be fitted by the respective following equations in which the period was in the range of circadian values: Tef: y = 67.62 + 20.56sin (0.256x + 0.943) with a R2 = 0.776 (Fig. 2B); Cntn1: y = 93.57 + 12.76sin (0.211x + 1.26) with a R2 = 0.727 (Fig. 2B); Dio2: y = 141.2–23.02sin (0.258x + 1.70) with a R2 = 0.679 (Fig. 2B)). 3.2. Circadian expression of core-clock genes and hormone genes in GH4C1 cells To synchronize cells between themselves, GH4C1 cells were transferred to fresh medium. This was previously shown to allow for a rhythmic pattern of PRL gene expression (Guillaumond et al., 2011). In order to determine whether gene expression in GH4C1 cells could display a rhythmic pattern, cells were harvested after this fresh medium replacement (T0) every 4 h from T2 to T30–38. At each time point, total RNA was prepared and then used for cDNA synthesis followed by qPCR. As shown in Fig. 3A, Bmal1 mRNA levels displayed a rhythmic pattern in GH4C1 cells over the T2–T30 time period. Experimental values were fitted by the following equation y = 297 + 123sin (0.314x  0.969) with a R2 = 0.655 (Fig. 3A). By contrast, Clock mRNA levels, which fluctuated slightly with low amplitude, cannot be fitted by a sine wave equation with a period near 24 h (R2 = 0.396) (Fig. 3A). Npas2 mRNA levels in GH4C1 cells were too low to determine a potential temporal pattern of expression. As expected circadian pattern of Rorc was in phase with Bmal1. Surprisingly, in GH4C1 cells, we observed that this was also the case for Per2, a result in contrast with that we obtained in primary culture of pituitary cells (Fig. 3A). However, this unusual phase relationship of PER2 and BMAL1 was already reported in other cell types (Teboul et al., 2005; Gómez-Abellán et al., 2012). Experimental values were fitted by the respective following equations: Rorc y = 290 + 112.5sin (0.314x  1.00) with a R2 = 0.551; Per2 y = 274.6 + 140.4sin (0.287x  0.337) with a R2 = 0.628 (Fig. 3A). As expected, rhythmic pattern of Reverba mRNA was antiphasic

Fig. 2. Rhythmic expression pattern of clock-controlled genes in primary cultures of rat pituitary cells. To synchronize cells between themselves, cells were treated by forskolin (10 lM, 20 min) and then transferred to fresh medium. Cells were harvested after this forskolin treatment (T0) every 4 h from T0 to T35. At each time point, total RNA was prepared and then used for cDNA synthesis followed by qPCR. Shown are the experimental values from two experiments as well as the sine wave equation that fitted experimental data with an R2 higher than 0.55. Rhythmic expression is considered significantly compatible with a circadian pattern when R2 is higher than 0.55 attesting of the goodness-of-fit and when the 95% confidence interval of the amplitude did not include the zero value. (A) Variations of Prl mRNA levels over the T0–T35 time period in pituitary cells and (B) variations of Tef, Cntn1 and Dio2 mRNA levels over the T0–T35 time period in pituitary cells.

to those of Bmal1 and Rorc and fitted by the following equation y = 247.6 + 140.3sin (0.224x + 1.773) with a R2 = 0.885 (Fig. 3A). As previously reported (Guillaumond et al., 2011), Prolactin (Prl) mRNA levels displayed a rhythmic pattern in GH4C1 cells over

892

D. Becquet et al. / Molecular and Cellular Endocrinology 382 (2014) 888–898

Fig. 3. Rhythmic expression pattern of core-clock genes and hormone genes in GH4C1 cells. To synchronize cells between themselves, GH4C1 cells were transferred to fresh medium. Cells were harvested after this fresh medium replacement (T0) every 4 h from T0 to T30–36. At each time point, total RNA was prepared and then used for cDNA synthesis followed by qPCR. Experimental data expressed as mean ± SEM obtained in 4 experiments are shown. Also shown is the sine wave equation that fitted experimental data with an R2 higher than 0.55. Rhythmic expression is considered significantly compatible with a circadian pattern when R2 is higher than 0.55 attesting of the goodnessof-fit and when the 95% confidence interval of the amplitude did not include the zero value. (A) Variations of 5 core-clock gene levels over the T0–T30 time period in GH4C1 cells and (B) variations of Prl and Gh hormonal gene levels over the T0-T36 time period in GH4C1 cells.

the T2-T38 time period (Fig. 3B). This was also the case for growth hormone (Gh) mRNA levels even if, for this latter hormone, amplitude of the oscillations was extremely reduced (Fig. 3B). These rhythmic patterns were compatible with a circadian pattern since experimental values could be fitted by the respective following equations in which the period was in the range of circadian values: Prl: y = 225.4 + 145.8sin (0.195x + 4.013) with a R2 = 0.866; Gh: y = 95.03 + 11.06sin (0.242x + 1.142) with a R2 = 0.782 (Fig. 3B).

3.3. Rhythmic activity of core-clock gene promoter constructs in GH4C1 cell line Promoters of clock genes that show cyclic transcription often contain circadian regulatory element such as E-box and RORE (Ror responsive element) and these circadian regulatory elementcontaining promoters can drive cyclic expression of luciferase gene as a reporter. To detect and analyze the intrinsic molecular

D. Becquet et al. / Molecular and Cellular Endocrinology 382 (2014) 888–898

893

oscillator in GH4C1 cells, we generated stably transfected cell lines expressing a transgene construct corresponding to the luciferase reporter gene under the control of either a Per1 like promoter containing 3 repeats of E-box (pGL2-(Per1E)3 (Triqueneaux et al., 2004)) or a Npas2 promoter containing 4 ROREs sequences (Npas2:Luc). Real-time monitoring of luciferase activity showed circadian molecular oscillations of the two promoter constructs that persisted at least four days (Fig. 4). Raw data were fitted by a sine wave equation that included a damping factor. The average circadian peak phase of (Per1E)3:Luc bioluminescence was ZT = 6, and that of Npas2:Luc was ZT = 12. It then appeared that there was a 6 h delay in oscillatory phases of (Per1E)3:Luc and Npas2:Luc transfected cell lines (Fig. 4). The average circadian period was 24.1 h and 23.5 h, respectively, for (Per1E)3:Luc and Npas2:Luc. 3.4. Local BMAL1 control of core-clock genes in GH4C1 cells Since the cell lines expressing (Per1E)3:Luc and Npas2:Luc transgene constructs were established using a neomycin resistance marker, it may be concluded that the G418 selection procedure did not perturb the cell-autonomous clock of GH4C1 cells. We then used the same procedure to clone GH4C1 cell lines expressing a dominant negative mutant of BMAL1 (BMAL1-R91A). Since pcDNA3-BMAL1-R91A (Hosoda et al., 2004) was a dominant negative mutant of BMAL1 in mice, it was possible to screen the levels of BMAL1-R91A expression in rat GH4C1 cells by PCR using primers specific for mouse. This screening study allowed us to select two cell lines (data not shown). To test whether in these two cloned GH4C1 cell lines the circadian oscillator was disrupted, we determined the expression pattern of core-clock genes and hormone genes. We found that core-clock gene mRNA levels obtained in the two cells lines cannot be fitted by a sine wave equation in which parameters such as amplitude and frequency were constraint to those obtained in control cells (R2 < 0.5) (Fig. 5A). It held also true for Prl and Gh hormone genes (Fig. 5B). 3.5. Disruption of Prl promoter rhythmic activation by BMAL1-R91A We previously reported that Prl rhythmic expression in GH4C1 cells depended upon Prl promoter rhythmic activation (Guillaumond et al., 2011). We monitored real-time luciferase activity using Lumicycle apparatus in stably transfected cell line expressing a transgene construct corresponding to the luciferase reporter gene under the control of a Prl proximal fragment promoter (pXP2164hPrl) that we have previously described (Guillaumond et al., 2011). As previously reported (Guillaumond et al., 2011), after synchronization of the cells by a medium change, this transgene (PrlLuc) showed circadian oscillations in our cell line (Fig. 6). From this cell line, we generated a clone stably expressing BMAL1-R91A. As shown in Fig. 6, the Prl-Luc transgene did not exhibit a circadian activation pattern in the clone expressing a dominant negative mutant of BMAL1. In this clone, raw data cannot be fitted by a sine wave equation with a period close to 24 h (Fig. 6). 3.6. Local BMAL1 control of Nono and Sfpq expression in GH4C1 cells We previously reported that Prl rhythmic transcription in GH4C1 cells was driven by rhythmic expression of two proteins, namely NONO and SFPQ, whose mRNA levels also displayed a rhythmic pattern (Guillaumond et al., 2011). As shown in Fig. 7A, Nono and Sfpq mRNA levels displayed a rhythmic pattern in GH4C1 cells over the T2–T30 time period that was compatible with a circadian pattern since experimental values could be fitted by the respective following equations in which the period was in the range of circadian values: Nono: y = 222.8 + 91.13sin (0.300x  1.022) with a R2 = 0.644; Sfpq: y = 350.4 + 137sin (0.314x  1.308) with a R2 = 0.601 (Fig. 7A).

Fig. 4. Real-time monitoring of transcriptional oscillations of core-clock gene promoter constructs in GH4C1 cells. GH4C1 cells stably transfected with (Per1E)3:Luc or Npas2:Luc constructs were stimulated with forskolin. In the presence of luciferin, light emission was then measured and integrated for 1 min at intervals of 10 min. Ordinate and abscissa represent arbitrary units and time after forskolin treatment, respectively. Upper panel: A representative example of GH4C1 cells stably transfected with (Per1E)3:Luc constructs showing circadian bioluminescence oscillations Lower panel: A representative example of GH4C1 cells stably transfected with Npas2:Luc showing circadian bioluminescence oscillations. Note the 6 h delay in phases of circadian oscillations in (Per1E)3:Luc and Npas2:Luc cell lines.

By contrast, Nono and Sfpq mRNA levels obtained in our two cell lines stably expressing BMAL1-R91A cannot be fitted by a sine wave equation in which parameters such as amplitude and frequency were constraint to those obtained in control cells (R2 < 0.5) (Fig. 7B). 3.7. Local BMAL1 control of target genes in GH4C1 cells We recently identified genes that are differentially expressed in pituitaries from Bmal1/ knockout versus wild-type mice and whose mRNA level expression follows a circadian pattern (Guillaumond et al., 2012). Some of these BMAL1 target genes in the mouse pituitary gland were also expressed in the GH4C1 cells, namely Tef, Cntn1 and Dio2. We then thought to determine whether these genes could display a rhythmic pattern of expression in GH4C1 cells. We showed that Tef, Cntn1 and Dio2 mRNA levels varied with time over the T2–T26 time period (Fig. 8A). Experimental values could be fitted by the respective following equations in which the period was in the range of circadian values: Tef: y = 106 + 52.5sin (0.206x + 2.21) with a R2 = 0.714; Cntn1: y = 111 + 41.77sin (0.188x + 3.067) with a R2 = 0.884; Dio2: y = 106 + 31.6sin (0.296x  0.36) with a R2 = 0.640 (Fig. 8A). By contrast, Tef, Cntn1 and Dio2 mRNA levels obtained in our two cells lines stably expressing BMAL1-R91A cannot be fitted by a sine wave equation in which parameters such as amplitude and frequency were constraint to those obtained in control cells (R2 < 0.5) (Fig. 8B). 4. Discussion 4.1. Pituitary cells house a functional circadian oscillator Like all peripheral tissues, pituitary gland has been shown to contain a molecular clock capable to measure time autonomously

894

D. Becquet et al. / Molecular and Cellular Endocrinology 382 (2014) 888–898

Fig. 5. Disruption of the rhythmic pattern of mRNA levels of 5 main core-clock genes (A) and Prl and Gh hormone genes (B) in two GH4C1 cell clones expressing BMAL1-R91A. Cells were synchronized between themselves by a medium change and were then harvested after this fresh medium replacement (T0) every 4 h from T0 to T30. Experimental data expressed as mean ± SEM obtained in 2 experiments are shown. These data cannot be fitted by a sine wave equation with a period close to 24 h and a R2 > 0.55.

(Abe et al., 2002). However, recent data challenged this point while finding no evidence for a functional intrinsic clockwork in human pituitary cells (Wunderer et al., 2013). We showed that in primary cultures of rat pituitary cells synchronized between themselves by a forskolin treatment, the main endogenous core-clock genes exhibited a circadian expression pattern. This also hold true for CCGs such as Tef, a direct target gene for the molecular circadian oscillator, Cntn1 and Dio2, two genes whose expression follows a circadian pattern in mouse pituitaries, as we recently reported (Guillaumond et al., 2012), and Prl, a hormone gene, we have previously shown to display a rhythmic expression pattern in the rat sommatolactotroph GH4C1 cell line (Guillaumond et al., 2011).

While providing evidence for a functional circadian oscillator in rat pituitary cells, our study totally disagreed with that of Wunderer et al. (2013). However in their study, Wunderer et al. (2013) cannot ruled out a possible degradation of core-clock gene mRNAs during the period that precedes the storage of the human pituitary gland at 80 °C especially since it is very well known that the mRNAs of core-clock genes have a short half life (Kojima et al., 2011). This degradation could explain both the scattered data reported by these authors and the discrepancy between their results and ours. While our data provide compelling evidence that pituitary cells house a functional circadian oscillator, the importance of this

D. Becquet et al. / Molecular and Cellular Endocrinology 382 (2014) 888–898

Fig. 6. Real-time monitoring of transcriptional oscillations of hPrl:Luc gene promoter constructs in GH4C1 cells. GH4C1 cells stably transfected with hPrl:Luc constructs were synchronized by a fresh medium replacement. In the presence of luciferin, light emission was then measured and integrated for 1 min at intervals of 10 min. Ordinate and abscissa represent arbitrary units and time after the medium change, respectively. Upper panel: A representative example of GH4C1 cells stably transfected with hPrl:Luc constructs showing circadian bioluminescence oscillations Lower panel: GH4C1 cells stably expressing hPrl:Luc constructs were stably transfected with pcDNA3-BMAL1-R91A. A representative example of the pattern of hPrl:Luc bioluminescence when BMAL1 R91A is overexpressed in the cells.

895

intrinsic clock in pituitary physiology remained to be investigated. This question was approached in the pituitary GH4C1 cell line, since cell lines are more convenient to transfect than primary cell cultures. We first characterized the molecular circadian oscillator in GH4C1 cells and showed that GH4C1 cells exhibited, like pituitary cells, a rhythmic expression of the main endogenous coreclock genes compatible with a circadian pattern. As reported here in primary cultures of pituitary cells in vitro, and as we previously observed in the pituitary gland in vivo (Guillaumond et al., 2012) Reverba and Rorc displayed a pattern of mRNA expression antiphasic or in phase with that of Bmal1, respectively. These rhythmic patterns of core-clock genes with transcription phase angles similar to those found in other circadian oscillators (Reppert and Weaver, 2002) confirmed that GH4C1 cell line houses a circadian molecular oscillator. In GH4C1 cells expressing (Per1E)3 promoter- or Npas2 promoter-driven luciferase constructs, we were able to detect circadian promoter construct activation. Indeed, these stably transfected cell lines exhibited robust daily cycles of bioluminescence that dampened after forskolin synchronizing signal but persisted at least four days. These results showed that the integrated reporters appropriately read-out the intrinsic cellular circadian clock. However, previous studies reported that Per1 and Npas2 endogenous genes are expressed nearly anti-phase in various types of cells and tissues (Ueda et al., 2002; Yamamoto et al., 2004) and we only found a 6 h delay in oscillatory phases of our two constructs in GH4C1 cells. Since in these GH4C1 cells, we also found an unusual phase relationship between Per2 and Bmal1 endogenous genes, it is tempting to speculate that the molecular oscillator in GH4C1 cells display specific timing features as already reported in other cell types (Teboul et al., 2005; Gómez-Abellán et al., 2012). To pertain to the functionality of this molecular oscillator in GH4C1 cells, we attempted to determine whether hormone genes

Fig. 7. (A) Rhythmic expression of Nono and Sfpq mRNA levels in GH4C1 cells. Experimental data expressed as mean ± SEM obtained in 4 experiments are shown. Also shown is the sine wave equation that fitted experimental data with an R2 higher than 0.55. Rhythmic expression is considered significantly compatible with a circadian pattern when R2 is higher than 0.55 attesting of the goodness-of-fit and when the 95% confidence interval of the amplitude did not include the zero value. (B) Disruption of the rhythmic pattern of Nono and Sfpq mRNA levels in two GH4C1 cell clones expressing BMAL1-R91A. Experimental data expressed as mean ± SEM obtained in 2 experiments are shown. These data cannot be fitted by a sine wave equation with a period close to 24 h and a R2 > 0.55.

896

D. Becquet et al. / Molecular and Cellular Endocrinology 382 (2014) 888–898

Fig. 8. (A) Rhythmic expression of Tef, Cntn1 and Dio2 mRNA levels in GH4C1 cells. Experimental data expressed as mean ± SEM obtained in 4 experiments are shown. Also shown is the sine wave equation that fitted experimental data with an R2 higher than 0.55. Rhythmic expression is considered significantly compatible with a circadian pattern when R2 is higher than 0.55 attesting of the goodness-of-fit and when the 95% confidence interval of the amplitude did not include the zero value. (B) Disruption of the rhythmic pattern of Tef, Cntn1 and Dio2 mRNA levels in two GH4C1 cell clones expressing BMAL1-R91A. Experimental data expressed as mean ± SEM obtained in 2 experiments are shown. These data cannot be fitted by a sine wave equation with a period close to 24 h and a R2 > 0.55.

expressed by this cell line display circadian expression pattern. As previously reported (Guillaumond et al., 2011), Prl mRNA levels were shown to fluctuate over the 24 h circadian period in GH4C1 cells. These fluctuations could be fitted by a sine wave equation in which the period was in the range of circadian values (between 20 and 28 h) assuming that in addition to its ultradian pattern (Harper et al., 2011), Prl expression also follows a circadian pattern as previously reported in individual GH3 cells (Leclerc and Boockfor, 2005) as well as in a population of synchronized GH3 or GH4C1 cells (Bose and Boockfor, 2010; Guillaumond et al., 2011). This circadian component of hormonal pattern was also found for Gh mRNA levels but in this latter case, fluctuations displayed very low amplitude. 4.2. Disruption of the molecular oscillator in GH4C1 cells by a dominant negative mutant of BMAL1 We generated two GH4C1 cell clones that expressed a dominant negative mutant of BMAL1, BMAL1-R91A (Hosoda et al., 2004). To test whether the circadian oscillator was disrupted, we analyzed

the expression pattern of core-clock genes in these two cloned GH4C1 cell lines and found that core-clock gene mRNA levels did not display any more circadian expression pattern. Since BMAL1 R91A can form a hetero-dimer with CLOCK, but cannot support DNA binding activity, this mutant is unable to stimulate transcription from an E-box-dependent promoter in vivo (Hosoda et al., 2004). This explained why core-clock genes such as Reverba, Rorc and Per2 whose circadian expression is driven by CLOCK/BMAL1 through an E-box in their promoter, did not display any more circadian pattern in our clones. The loss of rhythmic Bmal1 mRNA levels in our clones was also consistent with the fact that rhythmic expression of Bmal1 is driven by REV-ERB(a and b) that repress Bmal1 transcription by binding to the ROR elements in the Bmal1 promoter (Preitner et al., 2002; Guillaumond et al., 2005) and ROR(a and b) that act as positive drivers of Bmal1 expression (Guillaumond et al., 2005). Finally, Clock mRNA levels did not fluctuate in GH4C1 cells whether or not they expressed BMAL1 R91A. The loss of rhythmic core-clock gene expression in clones expressing the dominant negative mutant of BMAL1 provided evidence for a disruption of the molecular oscillators in these cells.

D. Becquet et al. / Molecular and Cellular Endocrinology 382 (2014) 888–898

4.3. Consequences of the disruption of the molecular oscillator on rhythmic gene expression in GH4C1 cells In keeping with the view that the molecular oscillators were disrupted in GH4C1 cell clones expressing BMAL1 R91A, we found that in these two clones, Prl and Gh mRNA levels did no more display a rhythmic expression pattern. In a previous recent study, we reported the accurate molecular mechanisms that accounted for the rhythmic Prl mRNA expression in GH4C1 cells (Guillaumond et al., 2011). We then tested here whether these mechanisms were affected in GH4C1 cell clones expressing BMAL1 R91A. As reported in a previous study (Guillaumond et al., 2011), rhythmic oscillations in Prl mRNA levels depended upon Prl promoter rhythmic activation. We showed here that disruption of the molecular oscillators by expression of a dominant negative mutant of BMAL1 in GH4C1 cells prevented this circadian Prl promoter activation. Furthermore, we have previously shown that the rhythmic pattern of Prl promoter activity involves fluctuations in the expression of two proteins, SFPQ and NONO. NONO and SFPQ have been identified as HLTF-associated proteins on an E-box located in the proximal promoter of PRL (Guillaumond et al., 2011). It was then of interest to show that Sfpq and Nono mRNA levels did not fluctuate any more in GH4C1 clones expressing the dominant negative mutant of BMAL1. By a differential DNA microarray analysis, we recently identified the genes that are differentially expressed in pituitaries from Bmal1/ knockout versus wild-type mice and we further characterized in the mouse pituitary gland the daily pattern of some of these genes (Guillaumond et al., 2012). Among them, Tef, Cntn1 and Dio2 were expressed in GH4C1 cells where they also displayed a rhythmic expression compatible with a circadian pattern. Here again these rhythmic expression patterns were abolished in GH4C1 clones expressing BMAL1 R91A. These results not only provided evidence that the intrinsic clock housed by pituitary cells contribute to the generation of circadian rhythms in the pituitary gland but also that at least some pituitary genes identified in our previous study as BMAL1 targets (Guillaumond et al., 2012) were in fact submitted to the local control of BMAL1 in the pituitary cells.

5. Conclusions In contrast with results recently reported (Wunderer et al., 2013), our present results showed the presence of a functional circadian oscillator in pituitary cells. Furthermore, they also allowed to emphasis the role that the local circadian oscillator plays in the physiology of the pituitary gland; indeed, like other peripheral oscillators, the pituitary gland would play a role within the circadian system as an autonomous generator of circadian rhythmicity and would not be a structure only slaved to hypothalamic neuropeptide rhythmic control. In this view, the role of hypothalamic neuropeptides may be to synchronize the pituitary cellular oscillators and/or to increase the amplitude of intra-pituitary oscillations and/or to allow pituitary hormone secretions which are believed to involve the regulatory and not the constitutive pathway (for review see (Burgess and Kelly, 1987)). PRL and GH have indeed been shown to aggregate in secretory granules (Dannies, 2012) and to be secreted after stimulation of the cells by the hypothalamic neuropeptides. While they probably do not function as generator but merely as synchronizing, magnitude amplifier and/or releasing signals, SCN driven rhythmic hypothalamic neuropeptides remain essential for pituitary hormone circadian rhythmicity as attested by the loss of pituitary rhythms following SCN lesions. According to our present results, it may be proposed that the role of the functional clock in the pituitary gland could be to stimulate the production of pituitary hormones at the right time.

897

Beyond the importance of the intrinsic pituitary clock, the role of the gland itself within the circadian system still is puzzling. Some pituitary hormones are able to generate rhythms in some other peripheral tissues. This is the case for ACTH which is critical for glucocorticoid hormone oscillations (Walker et al., 2012) and TSH which can mediate rhythmic secretion of thyroid hormones (Kalsbeek et al., 2000). In addition pituitary hormones likely contribute to coordinating the system when time cues conflict, such as under time-restricted food availability (Davidson and Stephan, 1999). The pituitary gland and its circadian oscillators would thus be located at the crossroad of the circadian system.

References Abe, M., Herzog, E.D., Yamazaki, S., Straume, M., Tei, H., Sakaki, Y., Menaker, M., Block, G.D., 2002. Circadian rhythms in isolated brain regions. J. Neurosci. 22, 350–356. Bose, S., Boockfor, F.R., 2010. Episodes of prolactin gene expression in GH3 cells are dependent on selective promoter binding of multiple circadian elements. Endocrinology 151, 2287–2296. Burgess, T.L., Kelly, R.B., 1987. Constitutive and regulated secretion of proteins. Ann. Rev. Cell Biol. 3, 243–293. Dannies, P.S., 2012. Prolactin and growth hormone aggregates in secretory granules: the need to understand the structure of the aggregate. Endocr. Rev. 33, 254–270. Dardente, H., 2008. Synchronization and genetic redundancy in circadian clocks. Med. Sci. (Paris) 24, 270–276. Davidson, A.J., Stephan, F.K., 1999. Feeding-entrained circadian rhythms in hypophysectomized rats with suprachiasmatic nucleus lesions. Am. J. Physiol. 277, R1376–R1384. Enjalbert, A., Sladeczek, F., Guillon, G., Bertrand, P., Shu, C., Epelbaum, J., GarciaSainz, A., Jard, S., Lombard, C., Kordon, C., 1986. Angiotensin II and dopamine modulate both cAMP and inositol phosphate productions in anterior pituitary cells. Involvement in prolactin secretion. J. Biol. Chem. 261, 4071–4075. Gómez-Abellán, P., Díez-Noguera, A., Madrid, J.A., Luján, J.A., Ordovás, J.M., Garaulet, M., 2012. Glucocorticoids affect 24 h clock genes expression in human adipose tissue explant cultures. PLoS One 7, e50435. Guillaumond, F., Dardente, H., Giguère, V., Cermakian, N., 2005. Differential control of Bmal1 circadian transcription by REV-ERB and ROR nuclear receptors. J. Biol. Rhythms 20, 391–403. Guillaumond, F., Boyer, B., Becquet, D., Guillen, S., Kuhn, L., Garin, J., Belghazi, M., Bosler, O., Franc, J.L., François-Bellan, A.M., 2011. Chromatin remodeling as a mechanism for circadian prolactin transcription: rhythmic NONO and SFPQ recruitment to HLTF. FASEB J. 25, 2740–2756. Guillaumond, F., Becquet, D., Boyer, B., Bosler, O., Delaunay, F., Franc, J.L., FrançoisBellan, A.M., 2012. DNA microarray analysis and functional profile of pituitary transcriptome under core-clock protein BMAL1 control. Chronobiol. Int. 29, 103–130. Harper, C.V., Finkenstädt, B., Woodcock, D.J., Friedrichsen, S., Semprini, S., Ashall, L., Spiller, D.G., Mullins, J.J., Rand, D.A., et al., 2011. Dynamic analysis of stochastic transcription cycles. PLoS Biol. 9, e1000607. Hopkins, C.R., Farquhar, M.G., 1973. Hormone secretion by cells dissociated from rat anterior pituitaries. J. Cell. Biol. 59, 276–303. Hosoda, H., Motohashi, J., Kato, H., Masushige, S., Kida, S., 2004. A BMAL1 mutant with arginine 91 substituted with alanine acts as a dominant negative inhibitor. Gene 338, 235–241. Kalsbeek, A., Fliers, E., Franke, A.N., Wortel, J., Buijs, R.M., 2000. Functional connections between the suprachiasmatic nucleus and the thyroid gland as revealed by lesioning and viral tracing techniques in the rat. Endocrinology 141, 3832–3841. Kavcic, P., Rojc, B., Dolenc-Groselj, L., Claustrat, B., Fujs, K., Poljak, M., 2011. The impact of sleep deprivation and nighttime light exposure on clock gene expression in humans. Croat. Med. J. 52, 594–603. Ko, C.H., Takahashi, J.S., 2006. Molecular components of the mammalian circadian clock. Hum Mol Genet 15 Spec No. 2, R271–R277. Kojima, S., Shingle, D.L., Green, C.B., 2011. Post-transcriptional control of circadian rhythms. J. Cell. Sci. 124, 311–320. Leclerc, G.M., Boockfor, F.R., 2005. Pulses of prolactin promoter activity depend on a noncanonical E-box that can bind the circadian proteins CLOCK and BMAL1. Endocrinology 146, 2782–2790. Preitner, N., Damiola, F., Lopez-Molina, L., Zakany, J., Duboule, D., Albrecht, U., Schibler, U., 2002. The orphan nuclear receptor REV-ERBalpha controls circadian transcription within the positive limb of the mammalian circadian oscillator. Cell 110, 251–260. Reppert, S.M., Weaver, D.R., 2002. Coordination of circadian timing in mammals. Nature 418, 935–941. Takahashi, J.S., 2004. Finding new clock components: past and future. J. Biol. Rhythms 19, 339–347. Teboul, M., Barrat-Petit, M.A., Li, X.M., Claustrat, B., Formento, J.L., Delaunay, F., Lévi, F., Milano, G., 2005. Atypical patterns of circadian clock gene expression in human peripheral blood mononuclear cells. J. Mol. Med. (Berl) 83, 693–699.

898

D. Becquet et al. / Molecular and Cellular Endocrinology 382 (2014) 888–898

Triqueneaux, G., Thenot, S., Kakizawa, T., Antoch, M.P., Safi, R., Takahashi, J.S., Delaunay, F., Laudet, V., 2004. The orphan receptor Rev-erbalpha gene is a target of the circadian clock pacemaker. J. Mol. Endocrinol. 33, 585–608. Ueda, H.R., Chen, W., Adachi, A., Wakamatsu, H., Hayashi, S., Takasugi, T., Nagano, M., Nakahama, K.-I., Suzuki, Y., et al., 2002. A transcription factor response element for gene expression during circadian night. Nature 418, 534–539. Walker, J.J., Spiga, F., Waite, E., Zhao, Z., Kershaw, Y., Terry, J.R., Lightman, S.L., 2012. The origin of glucocorticoid hormone oscillations. PLoS Biol. 10, e1001341.

Wunderer, F., Kühne, S., Jilg, A., Ackermann, K., Sebesteny, T., Maronde, E., Stehle, J.H., 2013. Clock gene expression in the human pituitary gland. Endocrinology 154, 2046–2057. Yamamoto, T., Nakahata, Y., Soma, H., Akashi, M., Mamine, T., Takumi, T., 2004. Transcriptional oscillation of canonical clock genes in mouse peripheral tissues. BMC Mol. Biol. 5, 18. Yang, X., Zhang, Y.K., Esterly, N., Klaassen, C.D., Wan, Y.J., 2009. Gender disparity of hepatic lipid homoeostasis regulated by the circadian clock. J. Biochem. 145, 609–623.