Evidence for microsatellite instability in bilateral breast carcinomas

Cancer Letters 154 (2000) 9±17

www.elsevier.com/locate/canlet

Evidence for microsatellite instability in bilateral breast carcinomas Evgeny N. Imyanitov a,b,*, Alexander V. Togo a, Evgeny N. Suspitsin a, Maxim Y. Grigoriev a, Kazimr M. Pozharisski a, Elena A. Turkevich a, Kaido P. Hanson a, Nicholas K. Hayward b, Georgia Chenevix-Trench a, Charles Theillet c, Martin F. Lavin b,d a

b

Group of Molecular Diagnostics and Laboratory of Pathomorphology, N.N. Petrov Institute of Oncology, St. Petersburg, Russia Queensland Cancer Fund Research Laboratories, The Queensland Institute of Medical Research, PO Royal Brisbane Hospital, Brisbane, Queensland 4029, Australia c Centre de Recherche en Cancerologie, Montpellier, France d The Department of Surgery, The University of Queensland, PO Royal Brisbane Hospital, Brisbane, Queensland 4029, Australia Received 10 September 1999; received in revised form 11 December 1999; accepted 11 December 1999

Abstract The molecular pathogenesis of various categories of breast cancer (BC) has been well described, but surprisingly few reports have appeared on analysis of somatic mutations in bilateral BC. We have performed a polymerase chain reaction (PCR)-driven investigation of chromosomal regions showing common loss of heterozygosity (LOH) in 23 cases (46 tumors) from patients diagnosed with bilateral BC. LOH was observed in 15/46 (33%) informative tumors for chromosome 1p, 5/32 (16%) for 5q, 12/ 44 (27%) for 11q, 15/40 (38%) for 13q and 4/24 (17%) for 17p. These values are within the range of interlaboratory variations reported for unilateral BC. There was no strong evidence for concordance of LOH within the same patient for any of the chromosomal loci tested. Atypical for breast carcinomas, 7/46 (15%) tumors accumulated a high frequency (ranging from 11 to 29%) of shortened dinucleotide CA repeats, implying microsatellite instability (MI). Further analysis with the highly informative BAT-26 marker allowed for the classi®cation of two of these tumors as having a replication error positive (RER 1/MSI-H) phenotype, whereas the remaining ®ve carcinomas harbored so-called borderline MI. Thus an involvement of both RER 1 and borderline MI appears to be a distinct feature of bilateral breast carcinomas compared to unilateral lesions. q 2000 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Bilateral breast cancer; Loss of heterozygosity; Microsatellite instability

1. Introduction Breast cancer (BC) is a common disease affecting approximately one of ten women during their lifetime. The probability of BC development is likely to be * Corresponding author. Tel.: 17-812-596-8821; fax: 17-812596-8947. E-mail address: [email protected] (E.N. Imyanitov)

in¯uenced by a combination of various risk factors. Although many of these factors have been already identi®ed, the frequency of their direct involvement and the mechanisms of their participation in BC pathogenesis remain largely uncertain [1]. It is generally believed that bilateral BC patients represent a special group of BC, since the extent of contribution of exogenous and/or endogenous triggers is signi®cantly higher in this cohort compared with unilateral

0304-3835/00/$ - see front matter q 2000 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0304-383 5(99)00444-9

10

E.N. Imyanitov et al. / Cancer Letters 154 (2000) 9±17

cases. This interpretation is based on the fact that actual occurrence of bilateral BC considerably prevails over that expected from random co-incidence [2±4]. Bilateral BC is usually recognized either as a synchronous (time interval ,0.5±1 year) or metachronous lesion. Synchronous bilateral BC accumulate at 0.5±1% of the total breast cancer incidence, whereas metachronous neoplasms occur 5±10 times more often [2,4]. Diagnosis of bilateral BC is complicated by the requirement to discriminate between independent primary tumors and metastasis to the other breast. Although there are well established morphological and clinical criteria developed for such discrimination, occasional misinterpretation remains possible [3]. Extensive clinical studies have focused on the search for speci®c bilateral BC features. Nonetheless, comparison of bilateral and unilateral BC failed to reveal essential differences concerning predisease records, tumor morphology, or prognosis. Although some investigators reported slight predominance of positive family history and/or lobular carcinomas in the bilateral BC group, these tendencies were not suf®cient to explain the speci®city of this BC category [4,5±9]. Certain bilateral BC appear to be attributed to germ-line mutations in familial cancer predisposition genes (BRCA1, BRCA2 etc.) [10], but the critical event for the vast majority of bilateral cases remains unknown. Over the last decade impressive progress has been achieved in unraveling the molecular pathogenesis of BC. Many somatic mutations such as ERBB2 oncogene ampli®cation, TP53 suppressor gene inactivation, and deletion of genetic material on chromosomes 1p, 1q, 3p, 5q, 6q, 11p, 11q, 13q, 16q, 17p, 18q, 22q etc. have been repeatedly shown to be typical for breast carcinomas. It is noteworthy that a very high degree of population heterogeneity exists for the pattern of somatic mutations in BC [11]. It is not known yet, whether this heterogeneity is due to diversity of triggering events or re¯ects the promiscuity of the mechanisms of BC development. While a multitude of reports have been devoted to studies of mammary tumors, in general, very little has been accomplished in this respect for bilateral BC. The most intriguing question is whether concordance or discordance of somatic changes in bilateral breast tumors exists within the same patient. In other words, does the nature of an exogenous or endogenous trigger factor strictly deter-

mine the subsequent chain of genetic alterations, or does a high breast cancer risk manifest itself through random gain of various somatic mutations?

2. Materials and methods 2.1. Patients For this pilot attempt we collected 23 matched bilateral BC (®ve synchronous and 18 metachronous) from patients treated between 1968 and 1996 in The N.N. Petrov Institute of Oncology, St. Petersburg, Russia. None of the patients had a history of nonbreast malignancies. A discrimination between bilateral BC and a metastatic lesion in the second breast was made based on commonly accepted criteria: (a) the presence of an in situ component in the second tumor; or (b) differences in histology between two tumors; or (c) greater degree of differentiation in the second tumor; or (d) lack of evidence for regional or distant metastatic lesions [3]. A 1 year interval between the onset of two tumors was taken as a threshold between synchronous and metachronous cases. Samples were also obtained from 43 patients with unilateral BC. The average age of diagnosis for bilateral tumors was 53 ^ 8, range 35±67 (L) and 52^11 range, 36±79 (R) while that for unilateral cases was 57^11, range 34±81. Paraf®n-embedded archival tumor and normal tissues were the source of DNA for polymerase chain reaction (PCR). Samples were subjected to an analysis of loss of heterozygosity (LOH) at selected loci which are frequently altered in sporadic breast carcinomas. 2.2. Sample preparation Ten micrometer thick archival sections were deparaf®nized in xylene and incubated in 100 ml of lysis buffer (10 mM Tris±HCl (pH 8.3), 1mM EDTA, 1% Triton, 500 mg/ml proteinase K) overnight at 608C. Then lysates were boiled for 5 min, and diluted in ten times by water for subsequent PCR analysis. To overcome the problem of partial DNA degradation in archival samples, short fragments (90±150 bp) containing polymorphic (CA)n repeats were subjected to PCR analysis.

E.N. Imyanitov et al. / Cancer Letters 154 (2000) 9±17

2.3. Microsatellite analysis For microsatellite analysis a series of primer sets speci®c for loci on chromosome 1, 5, 11, 13 and 17 were obtained from Research Genetics Inc. (See Table 1 and legend for details). PCR reactions were carried out in a ®nal volume of 4 ml with cycling conditions recommended by the manufacturer. PCR mixtures contained 1 ml of DNA lysate, 0.5 units of heat-activated AmpliTaq Gold Polymerase (Perkin±Elmer Cetus Corp.) and 0.5 mCi of [a 33P]dATP, in the presence of 1 £ PCR buffer, 1.5 mM MgCl2, 200 mM dCTP, dTTP, an dGTP, 25 mM dATP, and 1 mM of each primer. After reaction the samples were diluted in formamide loading buffer, denatured by heating and separated in a 6% sequencing gel. Autoradiograms were analyzed visually. 2.4. Detection of replication error phenotype Replication error phenotype (RER 1/MSI-H) occurs

11

due to lack of correct repair of errors arising during DNA replication and can be readily detected in microsatellites. We employed BAT-26, a poly(A) tract localized to the ®fth intron of the gene MSH2, to identify the RER status of bilateral BC. This marker is quasimonomorphic in DNA from normal individuals and RER 2 tumors but shows size variations in RER 1 tumors of various origins with 99.5% ef®ciency [12]. The primer sets to amplify BAT-26 are described in Parsons et al. [13]. PCR ampli®cation was carried out as described above at 958C for 5 min followed by 35 cycles (958C for 30 s, 458C for 1 min and 708C for 1 min). PCR products were analyzed on 6% sequencing gels as described above. 2.5. Statistical analysis Tendency to concordance of genetic lesions in bilateral BC was statistically evaluated by the chisquare test, using the following assumptions. If the

Table 1 Frequency of deletions in bilateral breast carcinomas Genetic lesion

LOH

Chromosomal region

1p34±36 5q21±22 11q22±25

13q12±14 17p13 Microsatellite instability

Alterations of two or more repeats

Loci tested a

Number of informative tumors b

Number of alterations (frequency, % of informative tumours) c

D1S2801, D1S2677, D1S2892, D1S2832, D1S2734 APC, MCC, D5S346 D11S4127, D11S4129, D11S4167, D11S4158, D11S4110, D11S4198 D13S1293, D13S1253, D13S1307 D17S578, Tp53

46

15 (33)

32 44

5 (16) 12 (27)

40

15 (38)

24

4 (17)

46

7 (15)

a Primer sets (Research Genetics Inc., http://www.resgen.com). Other types of polymorphisms tested (data not shown) were: 5q21±22: APC11, RsaI RFLP; MCC-10, 14 bp deletion polymorphism; 17p13; p53-6, MspI RFLP (all primers from Greenwald et al., [32]; p53-Alu, (AAAAT)n, repeat polymorphism (GGCAATAAGAGCTGAGACTCC and CATCCCCTACCAAACAGCTCC, our design of oligonucleotides, based on Futreal et al. [33]. In addition, the BAT-26 primer set was used for the detection of the RER 1 phenotype [12]. b A single informative (heterozygous) marker was considered suf®cient to judge the status of a chromosomal arm. In addition, more detailed analysis was accomplished for chromosomes 1p and 11q. In particular, parallel examination of 1p34±35 and 1p36 loci did not reveal any differences (40 tumours). Separate testing of 11q22±23 and 11q25 (24 samples) also failed to demonstrate speci®city for any of the regions. c Alterations include LOH and band shifts.

12

E.N. Imyanitov et al. / Cancer Letters 154 (2000) 9±17

frequency of each particular lesion (Table 2) is de®ned as p, the frequency of the normal status will be q ˆ 1 2 p. In the case of random coincidence of mutations, the expected number of patients carrying LOH in neighboring loci in both tumors will be equal to Np 2, where N is the total number of informative cases. Accordingly, the number of women with the normal status in both neoplasms will be Nq 2. Thus, the total expected number of concordant cases will be N(p 2 1 q 2). In turn, the expected number of discordant cases will be 2Npq. Expected numbers of concordant and discordant cases were compared to the actual ones (Table 2), using 2 £ 2 tables. P-values , 0.05 were considered statistically signi®cant. 3. Results Here we report initial results of a study of somatic mutations in 23 matched (®ve synchronous and 18 metachronous) bilateral BC. LOH was determined with primer sets for different loci on chromsomes 1, 5, 11, 13 and 17 shown previously to be deleted in unilateral BC [11]. A typical set of data for determination of LOH using primer sets for the different chromosomes is shown in Fig. 1a. It is evident that LOH occurred on chromosome 5q (D5S346) only in the left BC for patient 41 and in the case of patient 45, LOH was found on chromosome 11q (D11S4198)

only in the right tumor. Patient 29 showed LOH for chromosome 1p (D1S2677) in both tumors. The LOH data for all samples are summarized in Table 1. The frequency of LOH in bilateral BC was within the range of interstudy variations reported for sporadic breast carcinomas [11]. LOH was observed in 15/ 46 (33%) informative tumors for chromosome 1p, 5/ 32 (16%) for 5q, 12/44 (27%) for 11q, 15/40 (38%) for 13q and 4/24 (17%) for 17p. All ®ve loci tested contain putative or identi®ed familial cancer genes, but none of them showed a signi®cant difference in the frequency of deletions compared with published data on unilateral BC. We also attempted to analyze whether the events examined demonstrated a tendency to concordance in the same patients. We failed to obtain strong evidence for concordance for any of the chromosomal loci (Table 2), although the number of cases was not suf®cient to exclude moderate associations. Many of the tumor samples demonstrated a shift in electrophoretic mobility for certain dinucleotide repeat markers, e.g. patient 16 D1351307 (Fig. 1a). (CA)n repeats shortening may represent so-called genomic microsatellite instability (MI), but interpretation of such observations is complicated by the lack of a clear de®nition for MI. Recent reports tend to agree that occasional alterations in the length of microsatellite repeats (,10% markers per tumor) do not re¯ect true MI. Authentic MI is represented by

Table 2 Concordant and discordant genetic lesions in bilateral breast carcinomas Genetic lesion

LOH 1p 5q 11q 13q 17p Microsatellite instability a

Concordance

Discordance

Total P-value for concordance informative (actual vs. expected) a patients

Alteration in both tumours (frequency, %)

Normal status in both tumours (frequency, %)

Total number of concordant cases (frequency, %)

Total number of discordant cases (frequency, %)

5 (22) 2 (10) 0 (0) 3 (15) 1 (6)

13 (56) 15 (75) 10 (45) 8 (40) 10 (63)

18 (78) 17 (85) 10 (45) 11 (55) 11 (69)

5 (22) 3 (15) 12 (55) 9 (45) 5 (31)

23 20 22 20 16

0.12 (NS) 0.26 (NS) 0.37 (NS) 0.53 (NS) 1.00 (NS)

1 (4)

17 (74)

18 (78)

5 (22)

23

0.73 (NS)

NS, not signi®cant.

E.N. Imyanitov et al. / Cancer Letters 154 (2000) 9±17

very frequent (.30%) shifts of repeated sequences and de®nes a replication error positive (RER 1) pheno-

13

type. This abnormality is usually caused by inactivation of mismatch repair genes, and primarily occurs in

Fig. 1. An analysis of microsatellite repeats in bilateral breast carcinomas. (a) A typical set of examples of LOH in different patients. Closed arrows point to undeleted alleles while open arrow refers to deleted allele and the (CA)n repeat in case 16 is marked by an asterisk. Residual signals in case 29 are due to contamination of tumor sample by stromal tissue. (b) BAT-26 poly(A) repeat shortening in bilateral and unilateral breast carcinomas. Shifts of the CA marker are shown for tumours of different patients when the highly informative, speci®c BAT-26 poly(A) repeat was examined. Asterisks mark allele shifts and arrows point to unmodi®ed alleles.

14

E.N. Imyanitov et al. / Cancer Letters 154 (2000) 9±17

tumors of the digestive tract [14,15]. Cases harboring 10±30% altered microsatellites are classi®ed as borderline microsatellite instability. Mechanisms of borderline MI are less well understood than for RER 1 malignancies (see [12] and references therein). Although some reports described alterations of a single microsatellite repeat in breast carcinomas, accumulation of CA shortening in BC seems to be exceptionally rare (see [16,17] and references therein). Contrary to these data, we observed a shift in two or more microsatellite repeats in 7/46 (15%) carcinomas (11±29% of total markers tested) (Table 1). In 5/23 (22%) patients this phenomenon was noticed on only one side, and in one (4%) woman both neoplasms were affected (Table 2). A reliable method which discriminates between borderline and RER 1 MI instability has been described recently [12]. In that assay a quasi-monomorphic mononucleotide repeat microsatellite, BAT26, localized in the ®fth intron of the MSH2 gene was found to be 99.5% ef®cient in detecting the RER 1 phenotype. Of the seven samples of bilateral BC that showed evidence for MI (Table 1), two belonged to the RER 1 category when shortening of BAT-26 was used as the criterion for instability (Fig. 1b). For example the right side tumor in case 16 was considered to harbor borderline MI since it revealed dinucleotide repeat shift for 3/16 markers but was intact for BAT-26 (Fig. 1a and data not shown). Accordingly, cases 39 (left tumor) and 45 (right tumor) were de®ned as RER 1 due to the changed size of the latter marker (Fig. 1b). In agreement with published data [12], in all 39 tumors with no (CA)n repeat shortening BAT-26 was intact. Moreover, BAT-26 abnormalities were not detected in a control panel of 43 unilateral BC (data for ten of these patients appear in Fig. 1b), strengthening the evidence for non-involvement of the RER 1 phenotype in the molecular pathogenesis of unilateral BC [12]. 4. Discussion Genetic studies on unilateral BC reveal frequent LOH at several loci. Frequencies ranging from 20± 79% [11] have been described for a number of chromosomes including both arms of chromosome 1,

chromosomes 3p, 5q, 11q, 13q and chromosome 17 [18]. By comparison there is considerably less data available on bilateral BC [19,20]. In this study we have demonstrated common LOH in 23 cases (46 tumors) from patients diagnosed with bilateral BC. In all, LOH was detected in 26% (varying from 16± 38%), informative tumors at loci on ®ve different chromosomes. This value falls within the range on that reported for unilateral tumors. The loci tested 1p34±36 (p73), 5q21±22 (APC), 11q22±25 (ATM, chk1), 13q12±14 (BRCA2) and 17p13 (Tp53) all contain putative or identi®ed genes implicated in cancer. It has been suggested that p73, a homologue of p53 that maps to 1p36 acts, as a tumor suppressor gene [21]. However, more recent data strongly suggest that p73 is not the target of 1p36 LOH at least in ovarian adenocarcinoma [22]. Clearly another candidate gene in this region remains to be identi®ed. ATM and chk1 are candidates for 11q22±25 LOH with recent data supporting a tumor suppressor role for ATM in T cell prolymphocytic leukemia (T-PLL) and in B cell chronic lymphocytic leukemia (BCLL) [23,24]. BRCA2, a tumor suppressor gene contributing with BRCA1 to 80% of hereditary breast cancer, is localized to 13q12±14 [25] and mutant p53 (17p13) is long associated with unilateral breast cancer [10]. Thus the genes implicated in unilateral BC appear to coincide with those involved in the bilateral form of the disease. Incidence rates of a second primary carcinoma in the contralateral breast vary from 1.6±23% with an estimated relative increased risk of developing such a carcinoma three to nine times greater than the risk for the ®rst primary in age-related women [3,6,9]. In one study approximately 16% of bilateral BC patients had simultaneous carcinomas while the remainder (84%) had metachronous tumors with a time interval of detection between 17 and 20 months [6]. The higher risk of developing a tumor on the contralateral breast is not unexpected since this breast would also be exposed to the same risk factors in any individual. In most cases it is possible using morphological and clinical criteria to distinguish between metastasis and the development of a second primary in the other breast [3]. However, little is known about the genetic changes that occur in these independently arising tumors. We were unable to provide evidence of signi®cant concordance of LOH between bilateral tumors in the same patient with ®ve

E.N. Imyanitov et al. / Cancer Letters 154 (2000) 9±17

different loci containing tumor suppressor genes. This is supportive of independent primaries in the two breasts and provides additional evidence of the heterogeneity of different tumors arising in the same tissue. However, this lack of concordance might also be explained by the appearance of two sub-populations of cells originating from a single cell, one of which acquired different changes at a later stage. While the higher risk of developing a second tumor in patients with BC is well established it is unclear what the factors are that enhance this risk and whether these tumors are different in their behavior. There is some evidence that patients under 40 have a greater risk of developing a second tumor than those who ®rst developed BC at an older age [3,6]. Some data support an increased likelihood of family history among bilateral patients compared with unilateral cases but other reports fail to reveal a signi®cant relationship [26]. MI is observed in .90% of hereditary non-polyposis colorectal cancers [13] and in 15% of sporadic tumors [27]. This MI is a hallmark of defective mismatch repair genes [28] caused by errors during DNA replication (RER 1 phenotype). MI is established when alterations in the length of microsatellite repeats is observed in .30% of markers with individual tumors, less than this are considered borderline. More recently Boland et al. [29] have recommended in the case of colorectal cancer, that when more than ®ve markers are employed, tumors be designated MSI-H for MSI$30±40% of markers tested and MSI-L where the value is ,30%. In this study we demonstrated the presence of genomic MI in a proportion of bilateral BC which was very rarely observed in unilateral tumors. Fifteen percent (7/46) of bilateral tumors displayed CA repeat shortening (range 11±29%). These changes were observed on only one side for 5/23 (22%) of patients and on both sides for a single patient. Use of the mononucleotide repeat microsatellite, BAT26, discriminates between RER 1 and RER 2 colorectal tumors [12]. We found that two of the seven bilateral BC, showing evidence of MI, belonged to the RER 1 category as determined by BAT-26 shortening. On the other hand none of the 43 unilateral BC showed evidence of BAT-26 abnormality. This agrees with recent data from Zhou et al., [12] that found only normal alleles (ampli®ed at the BAT-26

15

locus) in 105 DNA samples from BC patients. These results appear to rule against the involvement of an RER 1 phenotype in the pathogenesis of unilateral BC. However, approximately 30% of bilateral tumors showing evidence of MI were of an RER 1 phenotype. Although the numbers are small these results point to distinct differences between unilateral and bilateral cancers. It is important to note that none of 23 bilateral BC patients examined demonstrated a clear-cut cancer family history in general, or accumulation of neoplasms of digestive tract among relatives in particular. Therefore, the observed cases of MI are unlikely to be related to the hereditary non-polyposis colorectal cancer (HNPCC) syndrome, which is caused by germ-line mutations in mismatch repair genes [16]. Thus the data indicate that RER 1 and borderline MI is a distinct feature of a small proportion of bilateral BC. In conclusion, numerous clinical and morphological investigations failed to demonstrate considerable speci®city for bilateral BC compared with unilateral disease [4]. Surprisingly little has been accomplished so far concerning the molecular pathogenesis of bilateral BC. Recent investigations of TP53 tumor suppressor gene alterations in bilateral breast carcinomas did not show striking differences compared with unilateral BCs [20,30,31]. The present study of 23 bilateral BC cases also failed to provide discriminating evidence when LOH at ®ve chromosomal regions was examined. However, the observations of RER 1 and borderline MI in bilateral BC suggest, that at least a subset of bilateral BC may develop by somewhat different mechanisms.

Acknowledgements We are very grateful to Mrs Olga Zaitseva, Olga Yatsuk and Lumila Rikunova for technical assistance, and to Mrs Ann Knight for manuscript preparation. We are also indebted to Dr Oleg Chagunava for helpful discussions. This work was supported by INTAS grant 96-1551, a grant from the Scienti®c Council for Malignant Diseases 02.02-7/96 and a grant from the Australia/ Russia Agreement for Medical Research.

16

E.N. Imyanitov et al. / Cancer Letters 154 (2000) 9±17

References [1] B.S. Hulka, Epidemiology of susceptibility to breast cancer, Prog. Clin. Biol. Res. 395 (1996) 159±174. [2] H.P. Leis, Bilateral breast cancer, Surg. Clin. North Am. 58 (1978) 833±841. [3] M.A. Chaudary, R.R. Millis, E.O. Hoskins, M. Halder, R.D. Bulbrook, J. Cuzick, J.L. Hayward, Bilateral primary breast cancer: a prospective study of disease incidence, Br. J. Surg. 71 (1984) 711±714. [4] A.J. Donovan, Bilateral breast cancer, Surg. Clin. North Am. 70 (1970) 1141±1149. [5] T.G. Hislop, J.M. Elwood, A.J. Coldman, J.J. Spinelli, A.J. Worth, L.G. Ellison, Second primary cancers of the breast: incidence and risk factors, Br. J. Cancer 49 (1984) 79±85. [6] H. Gulay, E. Hamaloglu, O. Bulut, H.A. Goksel, Bilateral breast carcinoma. 28 years experience, World J. Surg. 14 (1990) 529±533. [7] J.L. Bernstein, W.D. Thompson, N. Risch, T.R. Holford, The genetic epidemiology of second primary breast cancer, Am. J. Epidemiol. 136 (1992) 937±948. [8] M.D. Graham, A. Yelland, J. Peacock, N. Beck, H. Ford, J.C. Gazet, Bilateral carcinoma of the breast, Eur. J. Surg. Oncol. 19 (1993) 259±264. [9] J. Gogas, C. Markopoulos, P. Skandalakis, H. Gogas, Bilateral breast cancer, Am. Surg. 59 (1993) 733±735. [10] M.H. Green, Genetics of breast cancer, Mayo Clin. Proc. 72 (1997) 54±65. [11] P. Devilee, C.J. Cornelisse, Somatic genetic changes in human breast cancer, Biochim. Biophys. Acta 1198 (1994) 113±130. [12] X.P. Zhou, J.M. Hoang, Y.J. Li, R. Seruca, F. Carneiro, M. Sobrinho-Simoes, R.A. Lothe, C.M. Gleeson, S.E. Russell, F. Muzeau, J.F. Flejou, K. Hoang-Xuan, R. Lidereau, G. Thomas, R. Hamelin, Determination of the replication error phenotype in human tumours without the requirement from matching normal DNA by analysis of mononucleotide repeat microsatellites, Genes Chromosomes Cancer 21 (1998) 101±110. [13] R. Parsons, L.L. Myeroff, B. Liu, J.K.V. Willson, S.D. Markowitz, K.W. Kinzler, B. Vogelstein, Microsatellite instability and mutations of the transforming growth factor b type II receptor gene in colorectal cancer, Cancer Res. 55 (1995) 5548±5550. [14] R. Gryfe, C. Swallow, B. Bapat, M. Redston, S. Gallinger, J. Couture, Molecular biology of colorectal cancer, Curr. Probl. Cancer 21 (1997) 233±300. [15] S. Oda, E. Oki, Y. Maehara, K. Sugimachi, Precise assessment of microsatellite instability using high resolution ¯uorescent microsatellite analysis, Nucleic Acids Res. 25 (1997) 3415± 3420. [16] J. Jiricny, Mismatch repair and cancer, Cancer Surv. 28 (1996) 47±68. [17] E.K. Dillon, W.B. de Boer, J.M. Papadimitriou, G.R. Turbett, Microsatellite instability and loss of heterozygosity in mammary carcinoma and its probable precursors, Br. J. Cancer 76 (1997) 156±162. [18] D. Niederacher, F. Picard, C. van Roeyen, H.X. An, H.G. Bender, M.W. Beckmann, Patterns of allelic loss on chromo-

[19] [20] [21] [22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

some 17 in sporadic breast carcinomas detected by ¯uorescent-labeled microsatellite analysis, Genes Chromosomes Cancer 18 (1997) 181±192. C.J. Yee, N. Roodi, C.S. Verrier, F.F. Parl, Microsatellite instability and loss of heterozygosity in breast cancer, Cancer Res. 54 (1994) 1641±1644. J. Ackerman, D.A. Baunoch, P. Gimotty, J. George, M.A. Lane, P.J. Dawson, The role of p53 mutations in bilateral breast carcinomas, Mod. Pathol. 8 (1995) 244±248. C.A. Jost, M.C. Marin, W.G. Kaelin, p73 is a human p53related protein that can induce apoptosis, Nature 389 (1997) 191±194. E.N. Imyanitov, G.W. Birrell, I. Filippovich, N. Sorokina, J. Arnold, M.A. Mould, K. Wright, M. Walsh, S.C. Mok, M.F. Lavin, G. Chenevix-Trench, K.K. Khanna, Frequent loss of heterozygosity at 1p36 in ovarian adenocarcinomas but the gene coding p73 is unlikely to be the target, Oncogene 18 (1999) 4640±4642. I. Vorechovsky, L. Luo, M.J. Dyer, D. Catovsky, P.L. Amlot, J.C. Yaxley, L. Foroni, L. Hammarstrom, A.D. Webster, M. Yuille, Clustering of missence mutations in the ataxia-telangiectasia gene in a sporadic T-cell leukaemia, Nat. Genet. 17 (1997) 96±99. T. Stankovic, P. Weber, G. Stewart, T. Bedenham, J. Murray, P.J. Byrd, P.A.H. Moss, A.M.R. Taylor, Inactivation of ataxiatelangiectasia mutated gene in B-cell chronic lymphocytic leukaemia, Lancet 353 (1999) 26±29. R. Wooster, S.I. Neuhausen, J.L. Mangion, Y. Quirk, D. Ford, N. Collins, K. Nguyen, K.S. Seal, T. Tran, D. Averill, et al., Localization of a breast cancer susceptibility gene BRCA2, to chromosome 13q12±13, Science 265 (1994) 2088±2090. M.J. Bailey, C. Royce, J.P. Sloane, H.T. Ford, T. Powles, J.C. Gazet, Bilateral carcinoma of the breast, Br. J. Surg. 67 (1980) 514±516. A. Aaltonen, P. PeltomaÈki, F.S. Leach, P. Sitonen, L. PylkkaÈnen, J.P. Mecklin, H. JaÈrvinen, S.N. Powell, J. Jen, S.P. Hamilton, G. Petersen, K.W. Kinzler, B. Vogelstein, A. de la Chapelle, Clues to the pathogenesis of familial colorectal cancer, Science 260 (1993) 812±816. R. Fishel, M.K. Lescoe, M.R.S. Rao, N.G. Copeland, N.A. Jenkins, J. Garber, M. Kane, R. Kolodner, The human mutator gene homolog MSH2 and its association with hereditary nonpolyposis colon cancer, Cell 75 (1993) 1027±1038. C.R. Boland, S.N. Thibodeau, S.R. Hamilton, D. Sidransky, J.R. Eshleman, R.W. Burt, S.J. Meltzer, M.A. RodriguezBigas, R. Fodde, G. Nadia, R. anzani, S. Srivastava, National Cancer Institute workshop on microsatellite instability for cancer detection and familial predisposition: development of international criteria for the detection of microsatellite instability in colorectal cancer, Cancer Res. 58 (1998) 5248± 5257.` A. Shibata, Y.C. Tsai, M.F. Press, B.E. Henderson, P.A. Jones, R. Ross, Clonal analysis of bilateral breast cancer, Clin. Cancer Res. 2 (1996) 743±748. E. Ozer, T. Canda, F. Kuyucuoolu, p53 mutations in bilateral breast carcinoma. Correlation with Ki-67 expression and the mean nuclear volume, Cancer Lett. 122 (1998) 101±106.

E.N. Imyanitov et al. / Cancer Letters 154 (2000) 9±17 [32] B.D. Greenwald, N. Harpaz, J. Yin, Y. Huang, Y. Tong, V.L. Brown, T. McDaniel, C. Newkirk, J.H. Resau, S.J. Meltzer, Loss of heterozygosity affecting the p53 Rb, and mcc.apc tumor suppressor gene loci in dysplastic and cancerous ulcerative colitis, Cancer Res. 52 (1992) 741±745.

17

[33] P.A. Futreal, J.C. Barrett, R.W. Wiseman, An Alu polymorphism intragenic to the TP53 gene, Nucleic Acids Res. 19 (1991) 6977.