Evidence for positive and negative regulation in the promoter of the chicken δ1-crystallin gene

DEVELOPMENTAL

BIOLOGY

Evidence

127,209-219 (1988)

for Positive and Negative Regulation in the Promoter of the Chicken 61-Crystallin Gene TERESABORRAS,CHARLOTTE

LaboratMrJ

of Molecular

and Developmental

Biology,

A. PETERSON,ANDJORAMPIATIGORSKY

National

Eye Institute,

Accepted

Januav

Natimal

Institute

of Health,

Bethesda,

Maryland

20892

25, 1988

We investigated the role of sequences flanking the transcription initiation site of the al-crystallin gene in transient transfection assays of primary embryonic chicken lens epithelial cells or fibroblasts. Varying lengths of the 5’ flanking sequence of the 61-crystallin gene (containing some untranslated sequence from exon 1) were fused to the bacterial chloramphenicol acetyltransferase (CAT) gene in the pSVOCAT plasmid. A plasmid carrying the bacterial P-galactosidase gene driven by the Rous sarcoma virus (RSV) promoter was used as an internal control. Standardized results showed that the sequence located between -120 to -43 exhibited strong promoter activity; however, the promoter activity was markedly reduced (20-fold) when the upstream sequence between -603 and -120 was included in the construct. The 61-crystallin promoter displayed little lens preference. This upstream sequence did not reduce the activity of the Simian virus 40 (SV40) early promoter (with or without its enhancer) or the Herpes thymidine kinase promoter in transfection tests, indicating some specificity in its effect. Evidence for a bl-crystallin negative trans-acting factor was provided by competition experiments. Our data raise the possibility that expression of the 61-crystallin gene involves a negative c&acting transcription element, a speculation which may deserve further attention in view of the gradual decrease in 6-crystallin synthesis in the developing lens. o 1988 Academic PRSS, kc. INTRODUCTION

d-Crystallin, a major structural protein in the eye lens of birds and reptiles, accounts for approximately 70% of the protein in embryonic chicken lenses (see Piatigorsky, 1984). Recently, this specialized protein has been found to be surprisingly similar to the urea cycle enzyme, argininosuccinate lyase (Wistow and Piatigorsky, 1987), an observation consistent with the presence of low concentrations of 6-crystallin mRNA in several non-lenticular tissues (Bower et ah, 1983; Agata et a,l., 1983; Jeanny et al., 1985; Ueda and Okada, 1986; Linser and Irvin, 1987). &Crystallin mRNA appears just after lens induction (Shinohara and Piatigorsky, 1976), accumulates during development, and is lost from the lens between the third and fifth month after hatching (Treton et al., 1982). There are two similar, tandemly arranged d-crystallin genes in the chicken (Hawkins et al., 1984; Nickerson et ak, 1985, 1986; Ohno et al, 1985). The two d-crystallin genes are separated by 4 kilobases (kb) of DNA, with the 61 gene being 5’ to the 62 gene. To date, all the d-crystallin cDNAs which have been isolated were derived from the bl-crystallin gene (Bhat and Piatigorsky, 1979; Nickerson and Piatigorsky, 1984; Yasuda et al., 1984; Wawrousek et al., 1986), although recent experiments have shown that the d2-crystallin gene also produces a small amount of mRNA in the lens (Parker et al., 1988).

Previous studies have implicated the 5’ flanking region in the control of crystallin genes (Borris et al., 1985; Chepelinsky et aZ., 1985,1987; Hayashi et ah, 1985; Lok et al., 1985; Okazaki et al., 1985; Overbeek et al., 1986). Experiments with chicken &crystallin genes have shown that 344 base pairs (bp) of the 5’flanking regions can promote the activity of the bacterial chloramphenicol acetyl transferase (CAT) gene in the pSVOCAT plasmid when transfected into embryonic chicken lens epithelia (Borris et ah, 1985). Microinjection experiments have shown that nucleotide positions -80 to -65 are necessary for expression of the 61-crystallin gene in murine lens epithelial cells and have suggested that nucleotide positions -92 to -80 may participate in the lower expression of this gene in fibroblasts (Hayashi et al., 1985). Recently, however, a tissue-specific enhancer has been shown in the third intron of the al-crystallin gene (Hayashi et ab, 1987). Finally, competition experiments in a HeLa whole cell extract (Das and Piatigorsky, 1986) and in microinjected murine lens cells (Hayashi and Kondoh, 1986) have provided evidence that transcription of the al-crystallin gene involves interaction with an Spl-like factor. Here we have examined further the 5’ flanking region of the chicken 61-crystallin gene in transfection experiments. Different lengths of 5’ flanking sequence were introduced into the pSVOCAT vector (Gorman et al., 1982b), and the plasmids were tested in primary embryonic chicken lens cells cultured by an adaptation of the 209

0012-1606/88 Copyright All rights

$3.00

0 1988 by Academic Press, Inc. of reproduction in any form reserved.

210

DEVELOPMENTAL

BIOLOGY

method of Menko et al. (1984). Our results provide evidence that nucleotide positions -603 to -43 contain positive (-120/-43) and negative (-603/-120) control elements for al-crystallin gene expression. MATERIAL

Primary

Patched Epithelial

AND

METHODS

Cells (PLE)

Primary embryonic lens cells were prepared by modifying the procedure of Menko et al. (1984). Lenses were removed from the eyes of chicken embryos and placed in a 60-mm dish of prewarmed Ham’s F-10 medium (Grand Island Biological Corp., GIBCO) supplemented with 1% (v/v) gentamicin (10 mg/ml, GIBCO). Lenses were transferred to a sterile filter paper (Whatman No. 1) with a drop of culture medium, rolled gently to remove adhering iris, and transferred to a second 60-mm dish. Twelve 11-day-old or eight 14-day-old embryonic chicken lenses were placed into a 35-mm tissue culture dish containing 3 ml of 1 X trypsin-EDTA (GIBCO) and disrupted with forceps (one pull apart is enough) under the dissecting microscope. After 9 min at 37”C, the broken lenses were drawn up and down 2 or 3 times with a 5-ml pipette, incubated 4 min longer, and transferred to a 15-ml falcon tube containing a drop of fetal calf serum (FCS). After spinning at room temperature for 5-10 min in a clinical centrifuge at a setting of 3, the supernatant fraction was removed and the pellet resuspended in 5 ml of Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% FCS (GIBCO) and 0.5% gentamicin. This procedure resulted in patches of cells which were seeded on a 60-mm collagen-coated dish. After 18-24 hr, unattached fiber cells were washed away with DMEM, while patches of epithelial cells remained anchored to the dish. After 72 to 96 hr the dishes were subconfluent with patches of growing lens cells containing lentoid bodies (Okada et al, 1971). These patches of lens epithelial cells (PLE) were cultured at 37°C in an environment containing 10% COz and used for transfection. Transfection

DNA for transfection into PLE cells or embryonic chicken muscle fibroblasts was prepared by the calcium phosphate-DNA precipitation technique (Graham and Van Der Eb, 1973). Eighteen to thirty-six hours after lens explantation, 10 pg of test plasmid and 1 pg of control plasmid were coprecipitated in 0.5 ml buffer for 30 min, added to the PLE preparations in 60-mm dishes, and incubated at 37°C for 8-12 hr; the cells were then washed four times with culture medium and given fresh medium 2-3 hr later. Control tests using pTB1 (see Fig. 2) and P-galactosidase activity showed that transfection efficiency increased in the concentration range of l-40 pg/ml of

VOLUME

12’7,1988

DNA and decreased progressively as tested to 100 pg/ml of DNA. In other tests using pTB13a (see Fig. 2), CAT activity was similar when measured in cells that were transfected 1, 2, or 3 days after explantation and harvested 48 hr later. Positive results were obtained with lens epithelial cells from lo- and 14-day-old embryos. Cell Harvest and Enzyme Assay

Thirty-six to forty-eight hours after transfection, the cells were harvested by trypsinization and washed with phosphate-buffered saline (PBS). Cells from one 60-mm dish were resuspended in 100 ~1 of 250 mM Tris-HCl at pH 7.8 and lysed with a small glass homogenizer. Extracts (50-80 ~1) were assayed for CAT activity by incubation with 4 j&i of [14C]chloramphenicol and acetyl coenzyme A (6 mMfina1) for l-2 hr at 37°C as described (Chepelinsky et al, 1985). P-Galactosidase assays were performed as published (Nielsen et aZ., 1983) using lo-20 ~1 of the extract in a total volume of 0.5 ml of 100 mM sodium phosphate at pH 7.5. For each dish, nanomoles of acetylated chloramphenicol were normalized against P-galactosidase units. Constructions

The constructions are listed in Fig. 2; the 61-crystallin sequences are shown in Fig. 3. All blunt-end ligations were preceded by filling in sticky ends of DNA with Klenow DNA polymerase (for 5’ extensions) or with T4 DNA polymerase (for 3’ extensions). Ligation junctions were confirmed by DNA sequencing. CAT plasmids were obtained by subcloning 5’ flanking sequences of the 81-crystallin promoter into the Hind111 site of the pSVOCAT plasmid (Gorman et ah, 1982) by blunt-end ligation. dl-Crystallin inserts were obtained from a DdeI-DdeI promoter fragment isolated by polyacrylamide gel electrophoresis from ~61.5, as described earlier (Borris et al, 1985). pTB13 contains the entire DdeI-DdeI insert; pCP1 contains the 143 bp of the HaeIII-DdeI fragment; pTB15 contains the 59 bp BstNI-BstNI fragment, and pTB14 contains the 369 bp RsaI-DdeI fragment. For plasmid pTB1, the 577 bp NdeI-Hind111 fragment of pRSVCAT (Gorman et al, 1982a) was blunt-end ligated to pCH126 at the Hind111 site. pCH126 was generously provided by Dr. Frank Lee (DNAX Corporation); it is similar to pCHll0 (Hall et al., 1983) but contains a PuuII-Hind111 deletion. This plasmid utilizes the RSV LTR promoter to produce an Escherichia coli fusion protein with 40 residues of gpt (xanthine-guanine phosphoribosyltransferase), 8 residues of trpS (tryptophanyl-transfer ribonucleic acid synthetase)

BORRAS,

PETERSON,

AND

PIATICORSKY

and 1012 residues of la& which has considerable fi-galactosidase activity. The 249 bp DdeI-H&f1 fragment (-603/-355) of the insert in ~61.5 was blunt-end ligated either at the Ace1 site of pSV2CAT (Gorman et al., 1982b) to give pTB3, or at the BgZII site of pAlOCAT2 (generously given by Dr. John Brady, National Cancer Institute, National Institutes of Health, Bethesda, Maryland) to give pTB4, or at the NdeI site of pTB14a to give pTB7, or at the H&c11 site of pUC9 to give pTB16, or at the Sal1 site of pTKCAT (generously donated by Dr. Richard Miksicek, German Cancer Research Center, Federal Republic of Germany) to give pTB8. The 239 bp HinfI-BbvI (-35’71-119) fragment of the insert in ~61.5 was blunt-end ligated into the HincII site of pUC9 to give pTB18 or at the Sal1 site of pTKCAT to give pTB9. On the vectors carrying the CAT gene, “a” and “b” refer to the vector in which the insert is in the same (sense) or opposite (anti-sense) transcriptional direction of the CAT gene. Plasmids were grown in superbroth overnight and their DNA extracted by the boiling method (Holmes and Quigley, 1981). Supercoiled DNA was banded twice by ultracentrifugation in C&l. RNA

Analysis

RNA was isolated from batches of PLE cultures prepared from 14-day-old embryonic lenses (24 lenses per 10 cm dish); the cells had been transfected with the CAT vectors or mock-transfected. Cells from each dish were scraped in 3 ml of lysis buffer (10 mMTris-HCl at pH 8.0, 10 mMNaC1, 0.5% SDS, and 100 yg/ml Proteinase K) and passed through a 25 gauge hypodermic needle. After 5 min at room temperature, nucleic acids were extracted twice with an equal volume of phenol:chloroform (1:l) and ethanol precipitated. Redissolved samples were treated with 100 pg/ml of DNAse (Bethesda Research Laboratories, RNAse free) for 1 hr at 3’7°C in the presence of RNAsin, followed by treatment with Proteinase K, phenol extraction, and ethanol precipitation. An average of 30 pug of total RNA/dish was obtained. The 5’ ends of the pTB14a and pTBl3a transcripts were analyzed by a modification of the gene amplification technique (Saiki et al., 1985). Three ZO-mer oligonucleotides were synthesized. Oligodeoxynucleotide 1 (5 GGGCTGTGAGACCGGAGAGC 3’) and oligodeoxynucleotide 2 (5’ ACGGAGCGACCAGCCAGGGC 3’) were complementary to the coding strand of pTBl3a and consisted of 20 nucleotides either upstream or downstream, respectively, from the al-crystallin initiation site. Oligodeoxynucleotide 1 consisted of nucleotide po-

61-Crystallin

Gene

Regulation,

211

sitions -20 to fl and oligodeoxynucleotide 2 consisted of positions $1 to f20 of the noncoding strand of the al-crystallin gene; oligodeoxynucleotide 3 (5’ CAACGGTGGTATATCCAGTG 3’) was complementary to the noncoding strand of the CAT gene, 70 bp downstream from the fusion site with the 61-crystallin gene in our constructs. Oligodeoxynucleotide 3 (300 ng) was mixed with 30 pg of total RNA from either transfected or mock-transfected cells and lyophilized. Dry pellets were dissolved in 3 ~1 of Hz0 and 1 ~1 of 10X reverse transcriptase buffer (1X: 50 mMTris-HCl at pH 8.3,50 mM KCl, 8 mM Mg&I, and 40 mM DTT), denatured at 65°C for 5 min, and annealed by letting the temperature equilibrate at 42°C. Next, 1 ~1 of avian myeloblastosis virus (AMV) reverse transcriptase (40 u/pi, Life Sciences) and 1.5 ~1 of 10 mM dNTPs were added and the volume was increased to 10 ~1. After 30 min of primer extension at 42”C, each sample was centrifuged briefly and divided into two tubes. Either oligodeoxynucleotide 1 or 2 (700 ng) was added to each of the tubes and the volume was adjusted to 100 ~1 under the conditions described (Saiki et ah, 1985). After a total of 20 cycles (boiling, annealing, Klenow DNA polymerase extension) (Saiki et al., 1985), samples were lyophilized and one-third was electrophoresed on an 8 Murea-5% polyacrylamide gel. Gels were electroblotted on Zeta bind filter paper (BioRad) at 1 A for 2 hr, and hybridized to lo7 cpm of the labeled oligodeoxynucleotide at 42°C (Saiki et al., 1985). Oligodeoxynucleotides were end-labeled with [32P]ATP and T4 polynucleotide kinase. Filters were washed twice in 2X SSPE (1X SSPE: 180 mMNaC1, 10 mMNaHeP04, and 1 mMEDTA at pH 7.4) and 0.1% SDS for 30 min at room temperature and exposed on X-ray film. For the primer extension experiments, 4 X 10” cpm of 32P-labeled oligodeoxynucleotide 3 were mixed with 100 pugof RNA from either transfected or mock-transfected cells, dried, and resuspended in 10~1 of annealing buffer (10 mM Tris-HCI at pH 7.5, 300 mM KCI, and 1 mM EDTA); after 5 min at 75°C the mixture was equilibrated at 42°C and incubated for 30 min in the presence of 50 mMTris-HCl at pH 8.3,lOO mMKC1, 8 mMMgC12, 4 mM DTT, 300 PM EDTA, 250 pM dNTP, 100 pg/ml Actinomycin D, and 50 units of AMV reverse transcriptase (Seikagaku Corp.). The reaction was stopped with 1.5 ~1 of 0.2 M EDTA, phenol extracted, ethanol precipitated, and loaded onto an 8 Murea-10% polyacrylamide sequencing gel. RESULTS

Patched Lens Epithelial Cells (PLE)

Photomicrographs of the patched lens epithelial (PLE) cells at 24, 36, 48, and 96 hr of culture are shown

212

DEVELOPMENTAL BIOLOGLY

in Fig. 1. The PLE cells synthesized d-crystallin at all stages of culture as measured by [35SJmethionine incorporation, immunoprecipitation and polyacrylamide gel electrophoresis (data not shown). The present experiments were performed on these primary cultures, although similar results can be obtained if the cells undergo one passage; we did not test subsequent passages. Furthermore, the PLE cells can also be successfully transfected once stored in liquid nitrogen after 96 hr of culture (Keshet, unpublished). Initial

Characterization

of the 6KrystaElin

Promoter

Initially we constructed pTB13a and pTB14a (see Fig. 2A). The sequence of this region of the al-crystallin gene is shown in Fig. 3, where the sequences used in these and other constructs are indicated. pTBl3a contains 603 bp of 5’ flanking sequence and 23 bp from exon 1 of the al-crystallin gene fused to the bacterial CAT gene, while pTBl4a contains only 346 bp of 5’ flanking sequence and 23 bp of exon 1 fused to the CAT gene. Each plasmid was cotransfected into PLE cells or primary embryonic chicken fibroblasts with pTB1, which contains the RSV LTR/P-galactosidase hybrid gene (see Fig. 2C), for normalization. The molar ratio of pTB13a

VOLUME 127,1988

or pTB14a to pTB1 was 11 to 1 in each experiment. Control tests showed that CAT activity was the same when PLE cells were transfected with pTB14a in the presence or absence of pTB1 (data not shown), indicating that the RSV LTR promoter did not affect our results and could be used as an internal control. Plasmids were designated “a” if the Gcrystallin promoter fragments were placed in the sense orientation and “b” if placed in the anti-sense orientation. pTB13a produced relatively little CAT activity in the transfected PLE cells (Fig. 4). Unexpectedly, when the deletion was extended to position -346 (pTB14a), the normalized CAT activity increased an average of threefold in 13 separate experiments. pTBl3a produced almost as much CAT activity when transfected into fibroblasts as when transfected into the PLE cells, while pTB14a gave approximately twice as much CAT activity in the PLE cells as in the fibroblasts. When the 61crystallin promoter fragments were placed in the antisense orientation relative to the CAT gene, essentially no CAT activity was generated in the transfected PLE cells or fibroblasts (Fig. 4, pTB13b and pTB14b). The same results were obtained using plasmid concentrations of 1, 5, and 10 pg, indicating that the relative CAT activities were not due to plasmid concentra-

24 h.

36 h.

4% h.

96 h.

FIG. 1. Photomicrographs of PLE cultures. Primary ll-day-old chicken embryo lens epithelial lentoid bodies began to form at 72 hr and were clearly seen after 96 hr of culture, as indicated.

cells cultured for 24, 36, 48, and 96 hr. Early

BORRAS,

PETERSON,

AND PIATICORSKY

A.

61-Crystallin

213

Gene Regulation

C. -603

+1 -346

m

pTB13a

CAT

q -120

:

m

pTB14a

”

Accl Sphl

pTB1

,&-

Sphl Hindlll

pCPla

-43

-I/??$

FcTid

pTB3a repeat

pTB15a

SPh -6g111

20i)bp -

pTB4a -603

8.

355 Ndel 1 -346 di

-----cl puc9

BamH Pst 1 I 4 I dl -603 ~355 BarnHI 1

355 puc9

di

w 61 2OObp -

357

pTB7

603

pTB16

Pstl 1

+23 ICAT(

603

~109 +51 1~~1 CAT 1 ~355

pTB8a

pTBl8 ~119

200bp -

~357

di ITKI -119

CAT I

pTB9a

FIG. 2. Schematic diagram of plasmids. (A) 61-crystallin promoter deletions fused to the CAT gene; +1 represents the cap site, the 5’ borders of the 61-crystallin promoter are indicated as the nucleotide position relative to the cap site; wavey line, pBR322 sequences. (B) 61-crystallin promoter sequences (open boxes) inserted at the HincII site of the multicloning site of pUC9 jwavey line). (C) bl-crystallin promoter sequences inserted in pSV2CAT (pTB3a). pAlOCAT2 (pTB4a), pTBl4a (pTB7), and pTKCAT (pTBRa, pTB9a). RSV, Rous sarcoma virus; SV, simian virus 40; TK, thymidine kinase promoter region of the Herpes simplex virus. See Materials and Methods for details.

dl PROMOTER

SEQUENCE

A -603/+23 CACTCTCAAGCTCACAGGAGCTTCTCAAGATTGACCCGATACAATTGGTGACAGCAGAAACCCTGAAAGCTGA 600 -590 -580 -570 -560 -550 -540 AGTGTCCTTTGAAGTGGGGTGAAMGGCTCATCTGCACAGCMCTGCAGGAGGCAAAATAGCTCCCAGCTGTTTCATTCTTGCGCGTTGGTGG -520 -510 -500 -490 -480 -470 -460 -450

-530

-440

A -6031-355

A -346/+23 AG

CAAGGATAGTCCCCGACMGGAGGTGACCTGCCTGTGAMCCACACAGCAGACACTCTCCACCACAGGTGCTCTTCCACCMTMC -340 -330 -320 -310 -300 -290 -280 -270

-260

TTTACMACAAGCAACACGATGGCATCTCTATCAGCTCTCTTCTTCACAGCCACCCTACCCACTGGGAAACCTCTCACTGACCTTTCCCT -250 -240 -230 -210 -200 -220 -190 -180

-170

f

A -120/+23 AATTGAGCAGGGGCCGGACACAGGATAGGGGTGGGCAGCATGAGGGG -160 -15.0 -140 -1s0

CAGAGGGAGAGGGGGCAGAGCTGGGCTGGACGAGGCGACA -110 -100 -90 -80

A-43/+16

-

CCCCGCCCCZGGGGCGTGACGAGCTGCCAGCC -70 -60 -se

-

20

30

cCTGAGCAGGGCTGTGCGCGCAGCTGGGGAGGCTCTGTGCTGCTGTGGGGCTGGGGCAGAGCTGAGC 40 50 60 70 80 90

TGAGCCAAACAGAGCTGAACTGAGCCTCGCCTCGCTGTTCCCCA 110 128 130 140

100 .

150

160

178

180

190

TGAGGCCGAACTTTGCTTTTCCTACGGGGTGC 220 230 240

FIG. 3. Sequences surrounding the cap site (+l) of the bl-crystallin gene. The TATA and the CAAT box are underlined, and the exons are boxed (dark). Deletions are indicated by brackets. Further data have led to the introduction of CC at position -76 in the previously published sequence (Borris et al., 1985). It is not clear whether there are 4 or 5 C residues at position -70. Maxam-Gilbert sequencing (1977) showed 5 C (Borris et al., 1985; Nickerson et al, 1985) and Sanger’s dideoxy chain termination method (1977) showed 4 C residues (Ohno et al., 1985; our results, unpublished).

214

DEVELOPMENTALBIOLOGY

L F pTB13a

L F pTB14a

L F pTB13b

L F pTB14b

FIG. 4. Relative CAT activity of U-promoter-CAT constructs in PLE cells (L) and fibroblasts (F). A total of 11 bg of DNA (10 lg pTB13 or pTB14 plus 1 pg of pTB1) were introduced into 11 day-old chicken embryo PLE cells (12 lenses/60-mm dish) or primary chicken muscle fibroblasts from the same embryo. Relative CAT activity was determined by standardizing the nanomoles of acetylated chloramphenicol against the P-galactosidase activity measurements as described under Materials and Methods. The bars indicate standard errors relative to the results with pTB14a. “a,” 61-crystallin promoter fragment in the same orientation as the CAT gene; “b,” promoter fragment in the opposite orientation.

tion. A linear increase in enzyme activity was observed for DNA concentrations up to 15 kg/O.5 ml medium/60mm dish when using pTB1; higher concentrations resulted in a sharp decrease in P-galactosidase activity. Transfections into fibroblasts cells were done in duplicate using two different cell concentrations (approximately 15 and 45% confluent cells/dish). Upon normalization, both deletions were expressed preferentially in the lens (Fig. 4), although the tissue preference was at best only twofold and was more pronounced in pTB14a than in pTB13a. We cannot conclude at the present time, however, that pTB13a or pTB14a possesses true lens preference over the fibroblasts because we do not know whether the viral RSV promoter (pTBl), upon which the results are normalized, is equally active in both cell types. An experiment was conducted to test whether the sequence between positions -603 and -355 could reduce the activity of pTB14a if inserted in the opposite orientation. The sequence -603 to -355 of the dl-crystallin promoter was placed, in reverse orientation, 57 bp upstream of the sequence -346 to f23 in pTB14a to produce pTB’7 (see Fig. 2C). PLE cells transfected with pTB7 had approximately 60% the normalized CAT activity of those transfected with pTB14a. Further

Deletions

of the dl-Crystallin

Promoter

Two more constructs containing further deletions of the 61-crystallin promoter were made. pCPla contains

vOLUME127.1988

sequences -120 to f23, and pTB15a contains sequences -43 to +16, both in the same orientation with respect to CAT (see Fig. 2A). PLE cells transfected with pCPla had 20 times more normalized CAT activity than cells transfected with pTB13a (Fig. 5). By contrast, pTB15a produced only half as much CAT activity as pTBl3a in the transfected PLE cells. The residual CAT activity in cells transfected with pTB15a was probably due to the TATA box in this sequence. It should be noted that pTB15a contained only 16 bp from exon 1 of the 61crystallin gene instead of the 23 bp from this exon that were present in all the other constructs. We also tested the relative CAT activity in PLE cells and fibroblasts transfected with pCPla. In two experiments pCPla was similarly active in the lens cells and the fibroblasts (data not shown). Thus, our data indicate that the fil-crystallin promoter contributes little, if anything, to lens specificity in these cultured cells. Competition

Experiments

The reduced strength of the 61-crystallin promoter in our constructs containing more than 120 bp of 5’ flank-

80 t

60

+1

t

ATG

4

dl

-603 I CAT]

pTB13a

120 tz3 1-j 43 116 m

pTBl3a

pCPla

pCPla pTi315a

pTB15a

FIG. 5. Relative CAT activity of pTB13a, ll-day-old PLE cells. Values were calculated errors are relative to pCPla.

pCPla, and pTB15a in as in Fig. 4; standard

BORRAS,

PETERSON,

AND

PIATIGORSKY

ing nucleotides opens the possibility that repressor molecules in PLE cells interact with upstream cis elements of this gene to modulate its expression. We thus performed in viva competition experiments as an attempt to neutralize the negative effect of the 5’ flanking sequences. Two pUC plasmids were constructed containing either the distal -603/-355 (pTB16) or the proximal -3571-119 (pTB18) 5’ flanking sequences of the 61crystallin gene that lower promoter activity (see Fig. 2B). When pTB16 or pTB18 were cotransfected with pTB13a at a molar ratio of 4:l or 51 (competitor:CAT plasmid), respectively, a small, though consistent, increase in CAT activity was observed (Fig. 6); the increase was obtained whether calf thymus DNA (Fig. 6, sample 1) or the parent plasmid pUC9 (Fig. 6, sample 3) was used as a carrier in the test plasmid reaction. One difficulty with this experiment is that the concentration of competitor DNA was very close to the toxic dose for cells in transfection experiments (Graham and Van Der Eb, 1973), limiting our ability to increase the amount of competitor DNA. Effect of the al-Crystallin Upstream 5’ Flanking Sequences on Heterologous Promoters We next tested whether the sequences upstream of nucleotide position -120 of the 61-crystallin promoter could reduce the activity of a heterologous promoter. The distal (-603/-355) or the proximal (-35’7/-119) fragments were inserted into pSVBCAT, pAlOCAT2, and pTKCAT. pSV2CAT (Gorman et al., 1982b) contains the SV40 early promoter plus the 72 bp repeat enhancer and produces high CAT enzymatic activity when trans-

1

1+2

m3 pTB13a

\~BR3221

pTB16

u

* 403

PUC9

3

+23 I CAT)

Ill

(311

~BR322

1411

PUC9

3% d

1

3+4

346 1 d 351

PUC9

j(2)

1

+23 1 CAT 1 pTB14a 119

d

j pUC9

{ pTBl8

FIG. 6. Competition experiments. Two micrograms of test plasmid (1 and 3) were mixed with either 8 pg (1 + 2) or 10 pg (3 + 4) of competitor plasmid. In each case 1 pg of pTB1 was included for normalization. CAT reactions were carried out for 2 hr and calculations were done as described in Fig. 4. In dishes 1 and 3, calf thymus DNA or pUC9 DNA was used as carriers to equalize the total DNA concentration in every sample.

61-Cr+sfallin

215

Gene Reyulaticm

fected into PLE cells. pAlOCAT2 has the SV40 early promoter without the enhancer, but still has the two 21 bp repeats containing Spl binding site (CCGCCC). pTKCAT contains the thymidine kinase (TK) promoter (nucleotide positions -109/+51) of the Herpes simplex virus (HSV) driving the CAT gene, with a multicloning site preceding the promoter. The resulting plasmids [pTB3 (pSV2CAT derivative), pTB4 (pAlOCAT2 derivative), pTB8, and pTB9 (pTKCAT derivatives)] are described in greater detail under Materials and Methods and are shown diagrammatically in Fig. 2C. The CAT activity in PLE cells transfected with the constructs containing the upstream sequences from the fil-crystallin 5’ flanking region was the same as that from cells transfected with the parent plasmid in every case (data not shown). In pTB3, pTB4, and pTB8, the 61-crystallin sequences were also inserted in the antisense orientation and gave similar results. Transcription

Initiation

Sites

In order to determine the initiation sites of transcription of the plasmids containing the 61-crystallin promoter fragments, we isolated total RNA from transfected and mock-transfected PLE cells and performed primer extension experiments (Fig. 7). A 20-mer oligodeoxynucleotide complementary to a CAT RNA region 70 bp downstream from the 61-crystallin and the CAT junction gene was used. A primer extension product approximately 93 nucleotides long was obtained after reverse transcribing the RNA extracts of pTB13a (lane l), pTB14a (lane 2), and pCPla (lane 3), shown in Fig. 7A. This is consistent with the expected size of extended products, since we have 23 nucleotides derived from exon 1 of 61-crystallin and 70 nucleotides from the CAT gene. Two additional bands of approximately 108 nucleotides and 70 nucleotides were present in the pCPla-derived RNA. The larger product may represent a second initiation site about 15 bp upstream from the cap site, the lower band may result from a premature stop of reverse transcription. No extended product was obtained from RNA of the mock-transfected cells (lane 4). We also used a modification of the gene amplification technique of Saiki et al. (1985) to test whether the alcrystallin promoter initiated upstream of the cap site in pTB13a and pTB14a (Fig. 7B). We did not attempt to amplify the RNA products from pCPla. After primer extension using the CAT oligodeoxynucleotide, either oligodeoxynucleotide 1 (complementary to coding strand sequence -2O/+l of fil-crystallin) or oligodeoxynucleotide 2 (complementary to coding strand sequence +1/+20 of dl-crystallin) was added and allowed to amplify the &CAT cDNA in the presence of Klenow DNA

216

DEVELOPMENTAL

A.

BIOLOGY

VOLUME

127,1988

B. M

627 -

1

2

M34

pTBlh

pTB14a

I’- -

pTB13a I -

+’

pTB14a I -

*,a__ .-,‘

-116

-116 M

-72 OLIGO

t 67 -

)

1 ” (,

j,/

1

-72 OLIGO

2

+113bp+__ +YSbp+ rm!&

GGGTGTGAGACCGGAGAGC ACGGAGCGACCAGCCAGGGC OLIGO 1 OLIGO 2

FIG. 7. Analysis of transcription initiation sites. (A) Primer extension products of mRNAs derived from the plasmids specified below. The primer (oligodeoxynucleotide 3:gene sequence 5’ CAACGGTGGTATATCCAGTG 3’) was complementary to the CAT mRNA; total RNA (100 pg) from cells transfected with pTB13a (lane l), pTB14a (lane 2), pCPla (lane 3), or mock-transfected cells (lane 4) was used. Reactions were carried out as indicated under Materials and Methods. Each lane was loaded with the total sample (100 pg of total RNA plus 4 X lo6 cpm of 32-P kinased oligodeoxynucleotide 3). M, MspI digestion fragments from pBR322 DNA which were used as markers. Arrows indicate the extended cDNA products which correspond to the expected initiation site from the bl-crystallin promoter. (B) Southern blots of amplified &CAT c-DNA with oligodeoxynucleotides 1 and 2. Oligodeoxynucleotide 3 (see A) was used for reverse transcription of the mRNA. The lanes designated pTBl3a and pTB14a contain cDNA amplified from total RNA from PLE cells transfected with (+) or without (-) pTB13a and pTB14a, respectively, and hybridized to radioactively labeled oligodeoxynucleotide 1 or 2. Bacteriophage 4X174 Hoe111 fragments were used as molecular size markers. The position of the oligodeoxynucleotides within the constructs and the sizes of the products expected for oligodeoxynucleotides 1 and 2 are diagrammed in the lower right.

polymerase, as described under Materials and Methods. The oligodeoxynucleotide 1 primer did not direct an amplified product with RNA from transfected (with pTB13a or pTB14a) or mock-transfected cells (Fig. ‘7B). By contrast, the oligodeoxynucleotide 2 primer did generate an amplified cDNA of expected size (approximately 93 nucleotides) when using RNA derived from cells transfected with either pTB13a or pTB14a; no amplified cDNA was obtained from the mock-transfected cells. Both oligodeoxynucleotide 1 and 2 hybridized to the plasmid DNA (not shown). These results are consistent with transcription being initiated at or near the correct cap site for the Al-crystallin gene in pTB13a and pTB14a. DISCUSSION

Two difficulties in the analysis of crystallin genes is that lens cells grow relatively slowly in culture and that their passage results in loss of crystallin synthesis. Consequently, primary lens cells have been used for studying the expression of cloned genes, with the recent exception of a rabbit lens epithelial cell line which syn-

thesizes a trace of cY-crystallin and responds to the murine cyA-crystallin promoter (Reddan et al., 1986). Primary murine lens epithelial cells have been used for microinjection (Kondoh et ab, 1983; Hayashi et al., 1985; Hayashi and Kondoh, 1986) and primary explants of embryonic chicken lens epithelia have been used for transfection (Borris et al, 1985; Chepelinsky et ah, 1985; Lok et ah, 1985; Chepelinsky et ab, 1987) of crystallin genes and their regulatory elements. Our present modification of the culture method of Menko et al. (1984) provides a relatively simple and rapid system for studying crystallin genes which eliminates the need for microdissection of primary lens epithelia or for microinjection of lens cells. The seeding of a given number of lenses per dish obviates the need for filtering and counting cells, and the limited trypsinization that produces patches of lens cells instead of single cells greatly improves cell attachment to the collagen-coated dishes. It remains to be tested whether lenses from hatched chickens or other species can also respond to crystallin promoters by similar preparations. The present data indicate that nucleotide positions -120 to -43 of the bl-crystallin gene contain elements

Bombs, PETERSON,ANDPIATIGORSKY

which promote gene expression in lens cells. This is consistent with previous studies demonstrating the ability of 5’ flanking sequences to contribute to the regulation of b-crystallin genes in homologous and heterologous lens cells (Borras et al., 1985; Hayashi et ah, 1985). Our results have uncovered one or more upstream regions between positions -603 and -120 that may down-regulate the expression of the 61-crystallin gene. Removal of these sequences resulted in a marked increase in dl-crystallin promoter activity. The 20-fold stimulation of CAT activity obtained by removing sequences -603 to -120 may be an overestimation for the increase in promoter strength because the deleted promoter acquired a new upstream start site for transcription in addition to keeping its proper start site. A putative negative sequence was not observed previously when deletions of the promoter still attached to its gene were microinjected into cultured murine lens epithelial cells (Hayashi et al, 1985). This may be due to the recently reported enhancer located within the attached al-crystallin gene (Hayashi et al., 1987). The presence of a strong enhancer overrides the repressive effect of the chicken lysozyme gene silencer (Baniahmad et al., 1987). Another possibility is that the putative negative sequences do not function in the heterologous murine lens cells, which lack d-crystallin. Possibly, then, expression of the dl-crystallin gene is modulated by one or more negative regulatory elements, as are a growing number of other eukaryotic genes (i.e., Bienz-Tadmor et al., 1985; Borrelli et ab, 1986; Gonzalez and Nebert, 1985; Goodbourn et ab, 1986; Gorman et al, 1986; Jalinot and Kedinger, 1986; Jones et al., 1985; Laimins et al., 1986; Miyazaki et al., 1986; Nir et al., 1986; Ragg and Weissmann, 1983; Remmers et al., 1986; Sassone-Corsi and Verma, 1987; Baniahmad et ah, 1987). The pattern of &crystallin synthesis during lens development is one of gradual turning off (see Piatigorsky, 1981). Initially, d-crystallin is synthesized in the epithelial, cortical fiber and central fiber cells of the embryonic lens. Later, &crystallin mRNA decreases in the epithelial and cortical fiber cells; by 3 to 5 months after hatching, &crystallin mRNA disappears selectively from the lens (T&ton et ah, 1982). Although we do not know the molecular basis for this gradual limitation of &crystallin mRNA during development in the lens, our experiments raise the possibility that negative control involving the sequence between positions -603 and -120 has some role in this process. The putative negative regulatory sequence functioned in the present transfection tests in embryonic lens epithelial cells at a stage when &crystallin is synthesized. It is possible that chromatin configuration may render the endogenous b-crystallin gene refractive or only partially susceptible to this negative influence at this time.

61-Crystallin

Gene Regulation

217

It is also possible that other regulatory sequences associated with the dl-crystallin gene such as the enhancer in the third intron (Hayashi et al., 1987) affect the down-regulation noted here, as occurs in the chicken lysozyme gene (Baniahmad et al., 1987). That the upstream 5’ flanking sequences of the bl-crystallin gene were also able to show promoter expression in fibroblasts may be related to the low levels of 6-crystallin transcription which have been reported in nonlens cells (Bower et al., 1983; Agata et al., 1983; Jeanny et al., 1985; Ueda and Okada, 1986; Linser and Irvin, 1987). This ubiquitous low level expression of 6-crystallin is consistent with the relationship between the b-crystallin gene and that for the urea cycle enzyme argininosuccinate lyase (Wistow and Piatigorsky, 1987). The absence of any significant lens specificity for the al-crystallin promoter in our experiments agrees well with the results of Hayashi et al, (1987) and distinguishes the regulation of the dl-crystallin gene from that of the other crystallins (Chepelinsky et al., 1985, 1987; Lok et ab, 1985; Overbeek et ah, 1986). The competition experiments provide initial evidence for the presence of one or more trans-acting inhibitory factors in the chicken lens cells. The modest (twofold) increase in fi-crystallin promoter activity in the competition tests may have been due to an abundance of putative inhibitory factor(s) coupled with a limited amount of competitor DNA entering the cells. In this regard, microinjection experiments with the 61-crystallin gene required a molar excess of 40-to 200-fold of competitor DNA to remove an Spl-like factor from lens cells (Hayashi and Kondoh, 1986); furthermore, the recently described CCAAT displacement protein (CDP) that represses transcription of the histone H2B gene in sea urchin was not competed out until a loo-fold molar excess of competitor DNA was used (Barberis et ah, 1987). It is also possible that the putative negative factor(s) may require or be facilitated by cooperative interaction with specific factors bound to the positive control sequences, which may not occur when purified upstream sequences are used as competitor. We cannot ascertain from the present experiments whether position -603 to -120 contains one or more sequence elements decreasing the activity of the 61-crystallin promoter. The upstream sequences of the dl-crystallin gene did not reduce the activity of heterologous viral promoters when inserted at their 5’ ends in the pSV2CAT, pAlOCAT2, or pTKCAT plasmids. It is still possible, however, that the effect of these putative negative regulatory sequences is position-dependent. For example, another 5’ negative element (-428 to -1188 of the murine c-myc gene) (Remmers et ah, 1986) reduced the activity of pSV2CAT 45-fold when placed at the 3’ end of

218

DEVELOPMENTAL

BIOLOGY

the CAT gene, but reduced its own promoter only threefold. Further experiments are necessary to determine if the putative negative regulatory sequences of the 5’ flanking region of the al-crystallin gene will be effective only when combined with their homologous gene. Finally, a computer-assisted comparison revealed a 9 bp match (AGGGGTGGG) between positions (-143 and -135 of the al-crystallin gene and the negative element of the murine major histocompatibility class I gene (Miyazaki et al., 1986). Furthermore, the consensus sequences called box 1 (ANCCTCTCE) and box 2 (ANTCTCCTCC), derived from negative regulatory regions of other eukaryotic and viral genes (Baniahmad et ab, 198’7), are present in either partial or complete form in the putative negative regulatory sequence of the alcrystallin gene. The similarity to box 1 is found three times in the proximal region between positions -291/-286, -224/-219, and -191/-184, and that to box 2 is found once in the distal region between positions -356/-352 of the 61-crystallin gene (see Fig. 3). In conclusion, our data are consistent with the 5’ flanking sequence of the bl-crystallin gene containing positive control elements between the cap site and position -120 and suggest, for the first time, that negative control elements may also contribute to the developmental regulation of this specialized gene. We thank and Graeme Zelenka for Chicchirichi

Drs. George Thomas, Mark Thompson, Eric Wawrousek, Wistow for useful criticism of the manuscript, Dr. Peggy assistance with statistical calculations, and Mrs. Dawn for her expert secretarial help. REFERENCES

AGATA, K., YASUDA, K., and OKADA, T. S. (1983). Gene coding for a lens-specific protein, &crystallin, is transcribed in nonlens tissues of chicken embryos. Dev. Biol. 100,222-226. BANIAHMAD, A., MULLER, M., STEINER, CH., and RENKAWITZ, R. (1987). Activity of two different silencer elements of the chicken lysozyme gene can be compensated by enhancer elements. EMBOJ. 6,2297-2303. BARBERIS, A., SUPERTI-FURGA, G., and BUSSLINGER, M. (1987). Mutually exclusive interaction of the CCAAT-binding factor and of a displacement protein with overlapping sequences of a histone gene promoter. Cell 50,347-359. BHAT, S. P., and PIATIGORSKY, J. (1979). Molecular cloning and partial characterization of &crystallin cDNA sequences in a bacterial plasmid. Proc. Nat1 Acad. Sci. USA 76,3299-3303. BIENZ-TARDMOR, B., ZAKUT-HOURI, R., LIBRESCO, S., GIVOL, D., and OREN, M. (1985). The 5’ region of the p53 gene: Evolutionary conservation and evidence for a negative regulatory element. EMBOJ. 4,3209-3213. BORRKS, T., NICKERSON,J. M., CHEPELINSKY, A. B., and PIATIGORSKY, J. (1985). Structural and functional evidence of differential promoter activity of the two linked b-crystallin genes in the chicken. EMBO

J 4,445-452.

BORRELLI, E., HEN, R., WASYLYK, C., WASYLYK, B., and CHAMBON, P. (1986). The immunoglobulin heavy chain enhancer is stimulated by

VOLUME 127,1988 the adenovirus type 2 ElA Nat1

Acad.

products in mouse fibroblasts. Proc.

Sci. USA 83,2846-2849.

D. J., ERRINGTON, L. H., COOPER, D. N., MORRIS, S., and CLAYTON, R. M. (1983). Chicken lens &crystallin gene expression and methylation in several non-lens tissues. Nucleic Acids Res. 11, 2513-2527. CHEPELINSKY, A. B., SOMMER, B., and PIATIGORSKY, J. (1987). Interaction between two different regulatory elements activates the murine otA-crystallin gene promoter in explanted lens epithelia. Mol. Cell. Biol 7, 1807-1814. CHEPELINSKY, A. B., KING, C. R., ZELENKA, P. S., and PIATICORSKY, J. (1985). Lens-specific expression of the chloramphenicol acetyltransferase gene promoted by 5’ flanking sequences of the murine alpha A-crystallin gene in explanted chicken lens epithelia. Proc. BOWER,

Nat1

Acad.

Sci. USA 82,2334-2338.

DAS, G. C., and PIATIGORSKY, J. (1986). The chicken Al-crystallin gene promoter: Binding of transcription factor(s) to the upstream G + C-rich region is necessary for promoter function in vitro. Proc. Nat1 Acad. Sci. USA 83, 3131-3135. GONZALEZ, F. J., and NEBERT, D. W. (1985). Autoregulation plus upstream positive and negative control regions associated with transcriptional activation of the mouse Pl(450) gene. Nucleic Acids Res. 13,7269-7288.

GOODBOURN,S., BURSTEIN, H., and MANIATIS, T. (1986). The human beta-interferon gene enhancer is under negative control. Cell 45, 601-610. GORMAN, C. M., MERLINO, G. T., WILLINGHAM, M. C., PASTAN, T., and HOWARD, B. H. (1982a). The Rous sarcoma virus long terminal repeat is a strong promoter when introduced into a variety of eucaryotic cells by DNA-mediated transfection. Proc. Nat1 Acad. Sci. USA 79,6777-6781.

GORMAN, C. M., MOFFAT, L. F., and HOWARD, B. H. (1982b). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell Biol. 2, 1044-1051. GORMAN, C. M., RIGBY, P. W., and LANE, D. P. (1985). Negative regulation of viral enhancers in undifferentiated embryonic stem cells. Cell 42, 519-526. GRAHAM, F. L., and VAN DER EB, A. J. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52, 456-467.

HALL, C. V., JACOB, P. E., RINGOLD G. M., and LEE, F. (1983). Expression and regulation of Eschetichia coli 1acZ gene fusions in mammalian cells. J. Mol. Appl. Genet. 2, 101-109. HAWKINS, J. W., NICKERSON, J. M., SULLIVAN, M. A., and PIATIGORSKY,J. (1984). The &crystallin gene family: two genes of similar structure in close chromosomal approximation. J. Biol. Chern. 259, 9821-9825. HAYASHI, S., GOTO, K., OKADA, T. S., and KONDOH, H. (1987). Lensspecific enhancer in the third intron regulates expression of the chicken 61-crystallin gene. Genes Dev. 1,818-828. HAYASHI, S., and KONDOH, H. (1986). In vivo competition of b-crystallin gene expression by DNA fragments containing a GC box. Mol. Cell. Biol. 6, 4130-4132. HAYASHI, S., KONDOH, H., YASUDA, K., SOMA, G., IKAWA, Y., and OKADA, T. S. (1985). Tissue-specific regulation of a chicken b-crystallin gene in mouse cells: involvement of the 5’ end region. EMBOJ. 4,2201-2207.

HOLMES, D. S., and QUIGLEY M. (1981). A rapid boiling method for the preparation of bacterial plasmids. Anal. Biochem. 114,193-197. JALINOT, P., and KEDINGER, C. (1986). Negative regulatory sequences in the Ela-inducible enhancer of the adenovirus-2 early EIIa promoter. Nucleic Acids Res. 14, 2651-2669. JEANNY, J. C., BOWER, D. J., ERRINGTON, L. H., MORRIS, S., and CLAYTON, R. M. (1985). Cellular heterogeneity in the expression of the &crystallin gene in non-lens tissues. Dev. Biol. 112,94-99.

BORRAS, PETERSON, AND PIATIGORSKY JONES, P. B., GALEAZZI, D. R., FISHER, J. (1985). Control of cytochrome Pl-450 Science 227,1499-1502. KONDOH, H., YASUDA, K., and OKADA, expression of a cloned chick &crystallin (London)

M., and WHITLOCK, J. P., JR. gene expression by dioxin. T. S. (1983). Tissue-specific gene in mouse cells. Nature

301,440-442.

LAIMINS, L., HOLMGREN-KONIG, M., and KHOURY, G. (1986). Transcriptional “silencer” element in rat repetitive sequences associated with the rat insulin 1 gene locus. Proc Natl. Acad. Sci. USA 83,3X-3155.

LINSER, P. J., and IRVIN, C. K. (1987). Immunohistochemical characterization of delta-crystallin-containing retina/optic nerve “boundary” cells in the chick embryo. Dev. Biol. 121, 499-509. LOK, S., BREITMAN, M. L., CHEPELINSKY, A. B., PIATIGORSKY, J., GOLD, R. J., and TSUI, L-C. (1985). Lens-specific promoter activity of a mouse y-crystallin gene. Mol. Cell. Biol. 5, 2221-2230. MAXAM, A. M., and GILBERT, W. (1977). A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA 74,560-564. MENKO, A. S., KLVK~S, K. A., and JOHNSON, R. G. (1984). Chicken embryo lens cultures mimic differentiation in the lens, Del: Biol. 103,129-141.

MIYAZAKI, J., APPELLA, E., and OZATO, K. (1986). Negative regulation of major histocompatibility class I gene in undifferentiated embryonal carcinoma cells. Proc. Natl. Acad. Sci. USA 83, 9537-9541. NICKERSON, J. M., WAWROUSEK, E. F., HAWKINS, J. W., WAKIL, A. S., WISTOW, G. J., THOMAS, G., NORMAN, B. L., and PIATIGORSKY, J. (1985). The complete sequence of the chicken 61 crystallin gene and its 5’ flanking region. J. Biol. Chem. 260, 9100-9105. NICKERSON, J. M., WAWROUSEK, E. F., BORRKS, T., HAWKINS, J. W., NORMAN, B. L., FILPULA, D. R., NAGLE, J. W., ALLY, A. H., and PIATIGORSKY, J. (1986). Sequence of the chicken 62-crystallin gene and its intergenic spacer: extreme homology with the 61 crystallin gene. J. Biol. Chem. 261,552-557. NICKERSON,J. M., and PIATIGORSKY, J. (1984). Sequence of a complete chicken &crystallin cDNA. Proc. Natl. Acad. Sci. USA 81,2611-2615. NIELSEN, D. A., CHOIJ, J., MACKRELL, A. J., CASADABAN, M. J., and STEINER, D. F. (1983). Expression of a preproinsulin-o-galactosidase gene fusion in mammalian cells. Proc. Nutl. Acad. Sci. USA 80, 5198-5202. NIR, U., WALKER, M. D., and RUTTER, W. J. (1986). Regulation of rat insulin 1 gene expression: evidence for negative regulation in nonpancreatic cells. Proc. Natl. Acad. Sci USA 83, 3180-3184. OHNO, M., SAKAMOTO, H., YASJDA, K., OKADA, T. S., and SHIMURA, Y. (1985). Nucleotide sequence of a chicken &crystallin gene. Nucleic Acids

Res. 13,1593-1606.

OKADA, T. S., EGUCHI, G., and TAKEICHI, M. (1971). The expression of differentiation by chicken lens epithelium in in vitro cell culture. Dev.

Growth

Difler.

13, 323-336.

OKAZAKI, K., YASUDA, K., KONDOH, H., and OKADA, T. S. (1985). DNA sequences responsible for tissue-specific expression of a chicken a-crystallin gene in mouse lens cells. EMBO J. 4, 2589-2595.

6X’r@&rc

Gene

Regulation

219

OVERBEEK, P. A., CHEPELINSKY, A. B., KHILLAN, J. S., PIATIGORSKY, J., and WESTPHAL, H. (1985). Lens-specific expression and developmental regulation of the bacterial chloramphenicol acetyltransferase gene driven by the murine oA-crystallin promoter in transgenic mice. Proc. Natl. Acad. Sci. USA 82,7815-7819. PARKER, D. S., WAWROUSEK, E. F., and PIATIGORSKY, J. (1988). Expression of the 62-crystallin gene in the embryonic chicken lens. Dev.

Biol.

126, 375-381.

PIATIGORSKY, J. (1981). Lens differentiation in vertebrates. A review of cellular and molecular features. Diferentiation 19,134-153. PIATIGORSKY, J. (1984). Delta-crystallins and their nucleic acids. Mol. Cell.

Biochem.

59, 33-56.

RAGG, H., and WEISSMANX, C. (1983). No more than 117 base pairs of 5 flanking sequence are required for inducible expression of a human IFN-alpha gene. Nature lLond(m) 303,439-442. REDDAN, J. R., CHEPELINSKY, A. B., DZIEDZIC, D. C., PIATIGORSKY, J., and GOLDENBERG, E. M. (1986). Retention of lens specificity in long-term cultures of diploid rabbit lens epithelial cells. Diflerenfiation

33,168-174.

REMMERS, E. F., YANG, J. Q., and MARCU, K. B. (1986). A negative transcriptional control element upstream of the murine c-myc gene. EMBO J 5, 899-904. SAIKI, R. K., SCHARF, S., FALOONA, F., MULLIS, K. B., HORN, G. T., ERLICH, H. A., and ARNHEIM, N. (1985). Enzymatic amplification of @-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350-1354. SANGER, F., NICKLEN, S., and COULSON,A. R. (1977). DNA-sequencing with chain-terminating inhibitors. Proc. Nutl. Acad. Sci. USA 74, 5463-546’7.

SASSONE-CORSI,P., and VERMA, I. M. (1987). Modulation of c-fos gene transcription by negative and positive cellular factors. Nuture (Lcmdon)

326,507-510.

SHINOHARA, T., and PIATIGORSKY, J. (1976). Quantitation of &crystallin messenger RNA during lens induction in chick embryos. Proc. N&l.

Acud.

Sci. USA 73, 2808-2812.

TRENTON,J. A., SHINOHARA, T., and PIATIGORSKY, J. (1982). Degradation of 6-crystallin mRNA in the lens fiber cells of the chicken. De?). Biol.

92, 60-65.

WA~ROUSEK, E. F., NICKERSON, J. M., and PIATIGORSKY, J. (1986). Two &crystallin polypeptides are derived from a cloned 61-crystallin cDNA. FEBS Lett. 205,235-240. WISTO~, G. J., and PIATIGORSKY, J. (1987). Recruitment of enzymes as lens structural proteins. Science 236, 155441556. UEDA, Y., and OKADA, T. S. (1986). Transient expression of a lens-specific gene, d-crystallin, in the embryonic chicken adenohgpophysis. Cell Differ.

19, 179-185.

YASUDA, K., NAKAJIMA, N., ISOBE, T., OKADA, T. S., and SHIMURA, Y. (1984). The nucleotide sequence of a complete chicken &crystallin cDNA. EMBO J 3,1397-1402.