- Email: [email protected]
Evidence for the biological function of miR403 in tomato development
Scientia Horticulturae 197 (2015) 619–626
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Evidence for the biological function of miR403 in tomato development Chao Zhang a,b,1 , Zhiqiang Xian a,1 , Wei Huang a , Zhengguo Li a,∗ a b
Genetic Engineering Research Center, School of Life Science, Chongqing University, Chongqing 400044, People’s Republic of China Life Science and Food Engineering College, Yibin University, 644000 Sichuan, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 6 July 2015 Received in revised form 14 October 2015 Accepted 16 October 2015 Available online 10 November 2015 Keywords: miR403 Argonaute 2 Tomato Germination Floral transition
a b s t r a c t miRNAs are important regulators in plants, animals and worms. AGO proteins bound to miRNAs by recognition of complimentary sequence to repress expression of target genes. In plants, two miRNAs, miR168 and miR403 were identified as repressors of AGO1 and AGO2 respectively. miR168 was confirmed to play a key role in development of plants. However, the function of miR403 had not been illuminated yet. Previously, we investigated the cleavage of SlAGO2at the complimentary sequence of miR403. In this study, over-expression of miR403 in tomato showed flowering delay, leaf morphology and resistance to ABA during germination. Besides, two of transgenic plants exhibited defects in shooting meristem maintenance which were similar as the defects observed in 4m-SlAGO1s transgenic plants. Decrease of SlAGO2and increase of SlAGO1A/1Bwere found in miR403 transgenic plants. Moreover, miR156, miR159 and miR394 were accumulated in miR403 transgenic plants. Our results revealed the function of miR403 in tomato development via affecting expression ofSlAGO2, which might further alter the homeostasis between SlAGO1A/1Band miR168, then influence the balance of down-stream miRNA. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Small RNAs (sRNA) are well known for participation in transcriptional and post-transcriptional regulation of target genes, which affect all levels of genetic information in plants (Rubio-Somoza and Weigel, 2011). As an endogenous sRNA, microRNA (miRNA) can modify both chromatin state and translational progress of their target genes by directing RNA Induced RNA Silencing Complex (RISC) (Voinnet, 2009; Chellappan et al., 2010; Wu et al., 2010). Unlike miRNAs in animals which usually have hundreds of target genes, miRNAs in plants tend to have fewer targets and most of their targets have been identified as important regulators, such as transcription factors and F-box proteins (Rhoades et al., 2002; Jones-Rhoades and Bartel, 2004; Chen et al., 2010). Moreover, miRNAs were found to drive phase transition in Arabidopsis(Wu et al., 2009; Wang et al., 2009), control senescence (Kim et al., 2009; Schommer et al., 2008), regulate cell proliferation (Palatnik et al.,
Abbreviations: AGO, Argonaut; RISC, RNA induced silencing complex; sRNA, small RNA; miRNA, micro RNA; ABA, abscisic acid; dpa, days post anthesis; dpg, days post germination. ∗ Corresponding author. Present address: Shazheng Street 174#, Shapingba 400030, Chongqing, People’s Republic of China. Fax: +86 23 6512 0483. E-mail addresses: [email protected] (C. Zhang), [email protected] (Z. Xian), [email protected] (W. Huang), [email protected], [email protected] (Z. Li). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.scienta.2015.10.027 0304-4238/© 2015 Elsevier B.V. All rights reserved.
2003; Koyama et al., 2007; Koyama et al., 2010) and almost all stages of plant development (see reviews by Rubio-Somoza and Weigel (2011)). miRNAs are synthesized, modified and act via RISC (Park et al., 2002; Vaucheret et al., 2004; Baumberger and Baulcombe, 2005; Qi et al., 2005). As the importance of miRNA directed genes regulation, components of RISC, such as DICERS and AGOs were identified as key regulators in plants. Being part of RNase III family, Dicer cleaved double-strand RNA or pre-miRNA into siRNA/siRNA* or miRNA/miRNA* duplex respectively. Among four Dicer-like proteins (DCL1, DCL2, DCL3 and DCL4) inArabidopsis, DCL1 played major roles in miRNA biosynthesis (Kurihara and Watanabe, 2004) and mutations of DCL1 showed defects in embryo development (Errampalli et al., 1991; Robinson-Beers et al., 1992; Castle et al., 1993; Lang et al., 1994; Vernon and Meinke, 1994; McElver et al., 2001). HYL1 encoded a double strand RNA binding proteins participating in synthesis of miRNA/miRNA* duplex. Mutation of HYL1 had pleiotropic effects on growth and development ofArabidopsis, meanwhile had altered sensitivity to abscisic acid (ABA), auxin and cytokinin (Lu and Fedoroff, 2000). HEN1 participated in modification of miRNA (Li et al., 2005) and its mutation exhibited reduced leaf size, height, carpel fusion, fertilization rate (Chen et al., 2002). Mutations of AGO1 altered leaf shape and architecture of flower (Bohmert et al., 1998). Interestingly, some miRNA were found to be involved in regulation of RISC. DCL1 mRNA was negatively feedback regulated by miR162 (Xie et al., 2003), and miR838 was derived from a
620
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
hairpin in the 14 intron of DCL1 mRNA which led to truncated fragments of DCL1 mRNA (Xie et al., 2003). Argonaut (AGO) proteins are core elements of RISC, which could recognize target genes by guiding miRNAs and then repress expression of target genes via inducing modification of genomic sequence, suppressing translation of mRNA or cleaving at complementary sequence. Transcript of AGO1was regulated by miR168, as both null-ago1 and 4m-AGO1 resulted in defects inArabidopsis. Thus, AGO1 homeostasis regulated by co-expression of miR168 and AGO1 itself was important for plant development (Vaucheret et al., 2006). InArabidopsis, there are ten AGOgenes, among which AGO1 is regulated by miR168 and AGO2 is a potential target of miR403. AGO1 is considered to be the major element acting in the miRNA directed target genes regulation of plants, because AGO1 preferentially binds to small RNAs with 5 U terminal nucleotide (Mi et al., 2008) which most of miRNAs harbor (Rajagopalan et al., 2006). However, biological functions of AGO2 in development of plants are not so clear. AGO2lack DDH motif in the cleavage site (Baumberger and Baulcombe, 2005) and mutations of AGO2showed no significant defects in development (Lobbes et al., 2006). Besides, AGO2 was found to bind to viral siRNA (Takeda et al., 2008) and mutations of AGO2was hyper-susceptible to plant virus (Harvey et al., 2011; Jaubert et al., 2011; Scholthof et al., 2011; Wang et al., 2011), thus AGO2 was considered as a player in antiviral defense, rather than having biological function in development. Interestingly, most of small RNAs that AGO2 binds to is 21 nt, the same length as the major small RNAs that AGO1 binds to (Mi et al., 2008). Recently, AGO2 was found to participate in miRNA or miRNA* guided activity in plants. miR393b* bound to AGO2 to function in antibacterial immunity (Zhang et al., 2011). Moreover, AGO1 and AGO2 were redundant in miR408-mediated plantacyaninregulation (Maunoury and Vaucheret, 2011). At the meantime, a part of miRNAs was found in the AGO2-enriched small RNA database (Shao et al., 2014). As the miRNA which have ability to regulate RISC core-element AGO2 protein, miR403 was supposed to have important function in plants development. But the exact function of miR403 in plant developmental progresses remains unknown. In this study, tomato pre-miR403 was isolated and transferred into tomato. The transgenic plants exhibited flowering delay, leaf morphology and resistance to ABA during germination, which were similar to transgenic of miR168 loss-of-function in tomato. The findings presented a novel idea that miR403 might participate in developmental progress of tomato via a miR403–AGO2–miR168–AGO1 loop. 2. Materials and methods 2.1. Plant materials and growth conditions Tomato (Solamum lycopersicum cv. Micro-Tom) plants were grown in a standard culture chamber under the following conditions: 16/8 h day/night cycle, 23 ◦ C, 80% humidity and 2000 mol s−1 m−2 light density. Seeds were sterilized and then planted on 1/2 MS with 0.8% agar, pH 5.9 for 7 days and the seedlings with similar status were transferred to soil. The tissues of root, stem, leaf, flower bud, flower and different parts of the flower (ovary, stamen, petal, and sepal) were harvested from a 10-weekold tomato plant, and the fruit in different developmental stages (immature green, mature green, breaker, yellow and ripening) were collected according to size or color. Ovaries taken from bud [−2 days post anthesis (−2 dpa)], anthesis flowers (0 dpa), and 4 days post-anthesis flowers (4 dpa). 2.2. Diurnal expression of miR403 and light treatment For examination of relative expression of miR403 in day/night changes, 15 days-old seedlings were harvested at 0 h in day (0 h),
4 h in day (4 h), 8 h in day (8 h), 12 h in day (12 h), 16 h in day (16 h), 4 h in dark (20 h) and 8 h in dark (8 h). 20 days-old seedlings were pre-treated in dark for 7 days, and then transferred to constitutive light for 72 h. Leaves from seedlings were harvested at 0 h (0 h), 0.5 h (0.5 h), 1 h (1 h), 2 h (2 h), 5 h (5 h), 10 h (10 h), 24 h (24 h) and 72 h (72 h) after light treatment. 2.3. Plasmid construction and plant transformation Putative mature sequence and precursor of SlmiR403 was previously identified (Xian et al., 2013). According to putative mature sequence of SlmiR403 (CTAGATTCACGCACAAGCTCG), a series of mature small RNA were identified by local blast with tomato unique small RNAs downloaded from tomato functional genomic database (http://ted.bti.cornell.edu/cgi-bin/ TFGD/sRNA/download.cgi, see results in Supplementary Table 1). The sequence with highestreads (S14362631: CUAGAUUCACGCACAAGCUCG, 6229 total reads with average 51.46 RPM) was identified as the mature sequence of miR403. Pre-miR403 (Sl.50ch01: 78368844–78369169) which contained the sequence of SlmiR403 was amplified with tomato genomic DNA and then directly linked to pBi121 with miR403-SENSE (TAAAAGAGGGCTTATCCATTTCC) and miR403-ANTISENSE (CCTTCATTAGGTATCCGCCGTAC). The positive clones were identified by PCR with the 35S-F (GCTCCTACAAATGCCATCATTGC) and miR403-ANTISENSE, which were subsequently sequenced by Genscript Crop., (Nanjing, China). Pre-miR403 was constructed under the control of the cauliflower mosaic virus 35S promoter and Nos terminator. Transgenic plants were generated according to Wang et al. (2005). Positive plants were selected by kanamycin and PCR amplification with 35S-F and miR403-antisense. 2.4. ABA treatment Seeds of wild type and three independent miR403 transgenic plants were harvested at the same time. After half an hour treatment of 1% HCl (v/v), seeds were washed and dried for 2 days, and then stored at same condition until experiment. Newly harvested seeds were sterilized by 70% ethanol for 30 s, followed by 30 min sterilization with 5% NaCl and washing twice with sterilized water. Sterilized seeds were transferred onto 1/2 MS with 0 M, 1 M and 10 M ABA (10 × 10 cm square dish, 72 seeds on each dish). After 240 h of incubation under the condition of 16/8 h light/dark cycle, 24 ◦ C in light and 16 ◦ C in dark, germination rate of the seeds with each treatment was counted. 2.5. RNA isolation and quantitative real-time PCR Total RNA was isolated from each tissue using Trizol Reagent (Invitrogen, USA). RNAs used for cDNA synthesis were pre-treated with DNaseI(Fermentas, Thermo, USA). cDNAs were reversely transcripted by First Aid cDNA synthesis Kit (Fermentas, Thermo, USA). For miRNA detection, PolyA was added before reverse transcription and adaptor was added by oligo (dT)-adaptor (AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTVN) (Xian et al., 2014). Quantitative real-time PCR (q-PCR) was performed using cDNAs corresponding to 2.5 ng of total RNA in a 20 l reaction using Fast SYBR Mixture (CWBIO, China) on Bio-Rad CFX connect. Slactin-51 (accession number Q96483) was used as reference gene for mRNA and truncated mRNA ofSlAGO2.U6(accession number X51447.1) was used as reference gene for miRNA detection. For target gene analysis, qPCR was performed with primers flanking the miRNAs target sites. Gene accession numbers and primers for qPCR are listed in Supplementary Table 2.
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
621
Fig. 1. Expression partern of miR403 in tomato. (A) Expression of miR403 in different tissues of tomato. Root, leaf, stem, FB (flower bud) and flower were collected from at least 5 flowering tomato plants (about 50 days past germination); IG (imature green) was the fruit harvested on about 15 dpa, MG (mature green) was the fruit harvested on about 30 dpa, Br (breaker) was the fruit harvested on about 42 dpa, YF (yellow fruit) was the fruit harvested on about 45 dpa, RF (red fruit) was the fruit harvested on about 50 dpa. (B) Expression of miR403 in different parts of flower. Ovary, stamen, petal and sepal were havested from flowers of 3 dpa. (C) Examination of miR403 during early fruit development: 2 days before anthesis (−2 days), ovary at anthesis (0 dpa), 4 days post anthesis (4 days) and 6 days post anthesie (6 days). (D) Expression of miR403 during diural cycle: 0–16 h were samples under light period of 0–16 h, 16–24 h were samples under dark period of 0–8 h. (E) Expression of miR403 under light treatment. After treatment under dark for 7 days, 22 dpg old plants were treated under constitant light for 72 h, and then the samples were harvested 0 h (0 h), half an hour (0.5 h), an hour (1 h), 2 h (2 h), 5 h (5 h), 10 h (10 h), 24 h (24 h) and 72 h (72 h) after light treatment. Each sample was harvested from at least 5 individual plants, and each value represents the mean ± standard error of three replicates.
3. Results 3.1. Constitutively expression in different tissues and diurnal oscillation of miR403 in tomato Expression of miR403 was detected in different tissues of tomato (root, stem, leaf, floral bud, flower, immature fruit, breaker fruit, yellow fruit and red fruit), four parts of flower (ovary, stamen, petal sepal) and early developmental progress of fruit (2 days before
anthesis, the day on anthesis, and 4 days after anthesis). According to our results (Fig. 1A–C) and the data from tomato small RNA database (Supplementary Table 3), miR403 was constitutively expressed in the detected tissues and the developmental progress of tomato which expressed 3.85, 4.72 fold in mature green fruit and yellow fruit respectively, while expressed 0.83 fold in the breaker fruit (Fig. 1A). miR403 was found highly accumulated in stamen (14.04 fold) which was dramatically higher than ovary (1.00 fold, Fig. 1B). Moreover, the decrease of miR403 accumulation was inves-
622
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
Table 1 Flowering time of the wild type and miR403 transgenic plants. Name
Flowering time (dpg)
P-value
WT miR403-3# miR403-6# miR403-8#
40.76 47.38 46.28 43.38
NT <0.0001 <0.0001 0.0048
mination efficiency of seeds was counted on MS with different concentration of ABA (0 M, 1 M or 10 M) for 240 h after sterilization. Significant decrease of germination efficiency was found in the wild type accompany with the increase of ABA concentration (83.44% in 0 M, 74.13% in 1 M and 46.53% in 10 M). While three independent miR403 transgenic plants exhibited resistance to ABA during germination. About 93.40%, 94.79% and 92.28% seeds of miR403-3#, miR403-6# and miR403-8# were germinated on 1/2 MS with 0 M ABA; about 88.19%, 85.57% and 70.83% seeds of miR403-3#, miR403-6# and miR403-8# were germinated on 1/2 MS with 1 M ABA; about 70.83%, 84.20% and 64.22% seeds of miR403-3#, miR403-6# and miR403-8# were germinated on 1/2 MS with 10 M ABA (Fig. 3). Due to the low production of miR4034# seeds, the germination efficiency was not detected. 3.3. Expression of relative genes in miR403 transgenic plants
Fig. 2. Defects in growth rate of three independent miR403 transgenic plants. Height of the wild type, miR403-3#, miR403-6# and miR403-8# were measured on 25 dpg. Each value represents the mean ± standard error. Significance was analyzed by Student’s t-test. * indicate p value ≤ 0.05, N ≥ 15, and 4 generations of miR403-3#, miR403-6# and miR403-8# exhibited similar trends of slow growth rate according to observation.
tigated during early fruit development (Fig. 1C). Multiple miRNAs including miR168 had diurnal oscillation in Arabidopsis(Sire et al., 2009), and flowering delay was observed in the 4m-SlAGO1A/4mSlAGO1B transgenic plants of tomato (Xian et al., 2014), indicating that the miRNA network might participate in the light sensing progress which is important for floral transition. Thus the expression of miR403 during day/night change was investigated. miR403 reached expression peak at 12 h after day change (Fig. 1D), which was similar to the expression of miR168 during diurnal change in tomato (Supplementary Fig. 1) and in Arabidopsis(Sire et al., 2009). 3.2. Impact of miR403 in development of tomato Eight positive plants were obtained in this work, 3 of which showed severe defects in flowering (miR403-1#, miR403-4# and miR403-7#). Reproducible seeds could not be harvested from miR403-1# and miR403-7#, and limited seeds were obtained from miR403-4#. T1 (4 positive plants with normal meristem) and T2 (4 positive plants with normal meristem) generation of miR403-4# exhibited slow growth (Supplementary Fig. 2C), and the flowering time was more than 60 days post germination, while the normally wild type flowered on about 40 days post germination in the controlled growth chamber (Supplementary Fig. 2A, B). Moreover, leaf shape of miR403-4# and miR403-8# were changed. The ratio of wide/leaf varied from 48.67% in the wild type to 72.28% in miR403-4# and 58.28% in miR403-8# (Supplementary Fig. 2D, E). Interestingly, no obvious difference existed in the amount of reproducible seeds in other 5 miR403 transgenic plants. miR403-3#, miR403-6# and miR403-8# were used for further analysis. Flowering delay was observed in the three miR403 transgenic plants (Table 1) and the height of miR403 transgenic plants was significantly decreased compared to that of the wild type on 25 days post germination (Fig. 2). Low frequency of meristem abnormality was observed in miR403-6# (2 out of 20 in T3 and 1 out of 40 in T4, Supplementary Fig. 3C), which was also observed in the T2 of miR403-4# (2 out of 6 in T2, Supplementary Fig. 3B, D). Ger-
To confirm the over-expression of miR403 in transgenic plants, miR403 were detected in miR403-3#, miR403-6#, miR403-8# and the wild type using leaves harvested from 5th leaf of 25 day post germination (dpg) plants by qPCR. Generally, miR403 was overexpressed in the detected transgenic plants (Fig. 4A). MiR406-6# showed the highest germination rate under ABA treatment, did not overexpressed the highest level of miR403 (only about 1.7 fold higher than the wild type), while expression of miR403 in miR4033# and miR403-8# showed about 2.2 and 7.9 fold compared to that in the wild type (Fig. 4A). Moreover, the expression of miR403 in the transgenic plants exhibiting severe defects (miR403-4#) were also detected, which was slightly increased compared to the wild type (about 1.25 fold, Fig. 4B). To further explore the mechanism how miR403 induced defects in the transgenic plants, the expression of SlAGO2 was investigated using qPCR. Expression of SlAGO2 was reduced in miR403-3#, miR403-6# and miR403-8# compared to the wild type (Fig. 5A), and expression of SlAGO2 was down-regulated in miR403-4# (about 0.61 fold) compared to the wild type (Fig. 5B). As the defects observed in miR403 transgenic plants were similar to the defects observed in 4m-SlAGO1A/1B in our previous work (Xian et al., 2014), SlAGO1Aand SlAGO1Bwere investigated in miR4033#, miR403-6# and miR403-8#. Expression levels of SlAGO1Awere 1.51–2.98 fold higher compared to the wild type and expression levels of SlAGO1B were 1.60–2.66 fold higher compared to the wild type (Fig. 5A). As the defects of miR403 transgenic plants in height and delay of floral timing compared to wild type (Fig. 2 and Table 1) and the resistance to ABA during Germination (Fig. 3), related miRNA was investigated. MiR156, which was considered as regulator in plants growth regulation and phase transition (Wu et al., 2009), was detected in wild type and miR403 transgenic plant. MiR156 was up-regulated in miR403-OX lines compared to wild type (2.5–3.5 fold, Fig. 6). And two miRNA, miR159 and miR394, which participated in ABA signaling in plant was examined (Song et al., 2013; Reyes and Chua, 2007). miR159 was 2.9–4.1 fold up-regulated and miR394 was 1.3–2.0 fold up-regulated in miR403-OX compared to wild type (Fig. 6). 4. Discussion AGO2 was thought as the important regulator in viral defense other than its biological functions in plant’s development, but recently researcher noted that it was possible to participate in miRNA regulation. miR403 and miR168 two miRNAs which negatively feedback regulate expression of AGO proteins. miR168 could regulate AGO1 which was proved to play important roles in plant development (Vaucheret et al., 2006). Perhaps due to complexity of
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
623
Fig. 3. Resistance of miR403 transgenic plants to ABA during germination. (A) Germination rate of the wild type and three independent miR403 transgenic plants after 240 h treatments on 1/2MS with 0 M, 1 M and 10 M ABA. (B) The wild type and three independent miR403 transgenic plants on 0 M and 10 M ABA after 8 days treatment.
Fig. 4. Accumulation of miR403 in miR403 transgenic plants.
the regulatory network in AGO2, the biological functions of miR403 in plant development are still unrevealed. In this study, slower growth rate, delay of floral transition and resistance to ABA during germination were observed in three independent transgenic lines of miR403 (Figs. 2 and 3 and Table 1).
Moreover, 3 positive lines of miR403 (miR403-1#, miR403-4# and miR403-7#) transgenic plants showed served defects in leaf morphology and flower formation, and only miR403-4# could generate limited reproductive seeds. The defects in leaves, floral transition and production of seeds were stable in T1 and T2 generation of
624
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
Fig. 5. Expressions ofSlAGO2, SlAGO1Aand SlAGO1Bin the wild type and miR403 transgenic plants. (A) Decrease ofSlAGO2, increase of SlAGO1Aand SlAGO1Bin miR403 transgenic plants compared to the wild type. Leaves were harvested from 5th compound leaves of 25 dpg old seedlings. Each value represents the mean ± standard error, and at least three independent experiments were performed with similar results. (B) Decrease of SlAGO2in miR403-4# transgenic plant, due to limitation of the reproductive ability of miR403-4#. The experiment was carried out only once.
miR403-4#. The accumulation of miR403 was only about 1.25 fold in miR403-4# compared to control while the accumulation in other miR403 transgenic plants was more than 1.5 fold compared to control. Accumulation of mature miRNA decreased indcl1, while over-expression of 4m-AGO1 resulted in accumulation of miRNAs, indicating that the content of RISC would eventually influence the expression of mature miRNA. As the resistance to ABA during germination observed in miR403 transgenic plants was similar to resistance to ABA during germination of transgenic plants which accumulated AGO1 in Arabidopsis(Li et al., 2012) and in tomato (Supplementary Fig. 4), and the defects in development of miR403 transgenic plants were also similar to defects observed in 4mSlAGO1s in tomato (Xian et al., 2014), mRNAs levels of SlAGO1Aand SlAGO1Bwere evaluated in miR403 transgenic plants (Fig. 6A). As shown, SlAGO1Aand SlAGO1Bwere accumulated in miR403 transgenic plants, indicating that the defects in miR403 over-expression transgenic plants might be caused by over-accumulation ofSlAGO1s. Evidences in Arabidopsismight explain the unrevealed mechanism. First of all, AGO2 have the ability to bind with miR168 (Zhu et al., 2011), while miR403 was found in the database of AGO1
associated small RNAs [NCBI:GSE22252]; furthermore, both ago1 and ago2were considered to play crucial roles in virus defense (Harvey et al., 2011; Morel et al., 2002; Diermann et al., 2010). All these evidences suggested that AGO1 and AGO2 might cooperate with miR168 and miR403 during virus infection. Secondly, constitutive expression of miR403 in tomato (Fig. 1) indicating that miR403 might have important roles in routine regulation, but lossof-function of AGO2 did not show obvious defects in development (Harvey et al., 2011), demonstrating that AGO2 and miR403 might act like assistant of AGO1. Thirdly, the null-ago1mutation and overexpression of miR168-resistance AGO1 would resulted in severe defects in both situation (Vaucheret et al., 2004; Bohmert et al., 1998), implying that the balance of AGO1 protein would be critical in growth controlling and in the case of virus infection. It is notable that organism evolve a series of mechanism to avoid accident by regulation of endogenous genes. For example, the Dead End1 (DND1) bound to polyA to release the mRNA from RISCsmall RNA (Ketting, 2007). Moreover, the activity of exoribonuclease to cytoplasmic RNA decay module significantly reduced the chance of PTGS in endogenous genes (Zhang et al., 2015). It is likely that overexpression of AGO1 would increase the risk of PTGS in endogenous genes. So the expression of AGO1 should be controlled under a selfcheck regulator (miR168) to maintain the perfect expression level of AGO1. But virus developed a series molecule to crack this system. For example, polerovirus F-box protein P0 degraded AGO1, P21 bound to miRNA/miRNA* and siRNA duplex to inhibit formation of active RISCsmall RNA and P19 had ability to increase level of the endogenous miR168 level to inhibit translational capacity of AGO1 mRNA (Bortolamiol et al., 2007; Chapman et al., 2004; Varallyay et al., 2010). Thus, AGO2 could be considered as a secondary defense layer of plants, in case that the first defense layer component AGO1 was cracked by virus. But the evidences that the binding ability of AGO2 to miR168 and our results of defects in miR403 transgenic plants were similar to the defects observed in miR168-resistance SlAGO1s transgenic plants and miR168 loss-of-function transgenic plants, indicating that miR403 and AGO2 might participate in plant development via influencing expression of AGO1 in the form of AGO2miR168 . Furthermore, miRNA related to the defects observed in miR403OX transgenic lines were investigated. The miR156, miR159 and miR394 were increased in miR403-OX lines compared to wild type (Fig. 6). MiR156 is a regulator in plant growth and phase transition, over expression of miR156 resulted in vegetable phase delay (Jung et al., 2007, 2011) and could influence floral transition in switchgrass (Fu et al., 2012), the increase of miR156 in miR403-OX lines
Fig. 6. Expression of miR156, miR394 and miR159 in wild type and miR403-OX. Each value represents the mean ± standard error, and at least three independent experiments were performed with similar results.
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
might resulted in decease in height and the delay of floral timing. miR159 and miR394 were both accumulated in miR403-OX lines (Fig. 6), both of which was considered participated in ABA signaling, over expression of miR159 and miR394 showed resistance to ABA during germination (Song et al., 2013; Reyes and Chua, 2007). Notably, the transgenic line with the highest expression of miR403 (Fig. 4A) was not the transgenic line with severe defects in development (Figs. 2 and 3, Supplementary Figs. 2 and 3). The relationship between miRNA and AGO proteins was very complicated. As known, miRNAs could direct AGO proteins to repress the expression of target genes, and miRNAs are selected by different AGO proteins (Mi et al., 2008). Moreover, in the analysis of the function of AGO7 and miR390 in TAS3tasiRNA biogenesis, miR390 was found to specifically bind to AGO7 (Montgomery et al., 2008). The binding efficiency of miR165/miR166 to AGO10 was significantly higher than miR165/miR166 to AGO1, so miR165/miR166 was blocked by AGO10 against binding to AGO1 in Arabidopsis(Zhu et al., 2011). The presented evidences showed that the efficiency of different combination of AGO proteins and miRNAs would be different from each other. The contradiction among miR168, miR403, AGO1 and AGO2 was AGO proteins could stabilize the express of miR168 and miR403 (Vaucheret et al., 2006), but miR168 and miR403 could reduce the protein levels of AGO1 and AGO2. It means the increase of miR168 or miR403 would down-regulate AGO1 or AGO2, but reduction of AGO1 or AGO2 might decrease the expression of miR168 or miR403, which finally reduces increase of miR168 or miR403. Moreover, the “. . . AGO2-miR168-AGO1-miR403. . .” loop is vulnerable and tend to lose balance, so even slight change of any element in this loop would be amplified constantly. It is believed that transcriptional regulation of AGO1 and AGO2 by miR168 and miR403 and unknown regulatory factors helps to keep the balance of this loop. 5. Conclusion In this work, defects of development (decease in height and delay of flowering) and resistance to ABA during germination were observed in miR403 transgenic plants, and the decrease of SlAGO2 and increase of SlAGO1 implied that miR403 might participate in development regulation of plant via affect the expression of SlAGO1s, further influence the downstream miRNAs which participated in development of tomato. Acknowledgments This work is supported by National High Technology Research and Development Program of China (2012AA101702), National Basic Research Program of China (2013CB127101, 2013CB127106), National Natural Science Foundation of China (31272166) and Fundamental Research Funds for the Central Universities (CDJXS102311 18). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.scienta.2015. 10.027. References Baumberger, N., Baulcombe, D.C., 2005. Arabidopsis ARGONAUTE1 is an RNA slicer that selectively recruits microRNAs and short interfering RNAs. Proc. Natl. Acad. Sci. U. S. A. 102 (33), 11928–11933. Bohmert, K., et al., 1998. AGO1 defines a novel locus of Arabidopsis controlling leaf development. EMBO J. 17 (1), 170–180. Bortolamiol, D., et al., 2007. The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing. Curr. Biol. 17 (18), 1615–1621.
625
Castle, L.A., et al., 1993. Genetic and molecular characterization of embryonic mutants identified following seed transformation in Arabidopsis. Mol. Gen. Genet. 241 (5–6), 504–514. Chapman, E.J., et al., 2004. Viral RNA silencing suppressors inhibit the microRNA pathway at an intermediate step. Genes Dev. 18 (10), 1179–1186. Chellappan, P., et al., 2010. siRNAs from miRNA sites mediate DNA methylation of target genes. Nucleic Acids Res. 38 (20), 6883–6894. Chen, X., et al., 2002. HEN1 functions pleiotropically in Arabidopsis development and acts in C function in the flower. Development 129 (5), 1085–1094. Chen, M., et al., 2010. Functional characterization of plant small RNAs based on next-generation sequencing data. Comput. Biol. Chem. 34 (5–6), 308–312. Diermann, N., et al., 2010. Characterization of plant miRNAs and small RNAs derived from potato spindle tuber viroid (PSTVd) in infected tomato. Biol. Chem. 391 (12), 1379–1390. Errampalli, D., et al., 1991. Embryonic lethals and T-DNA insertional mutagenesis in Arabidopsis. Plant Cell 3 (2), 149–157. Fu, C., et al., 2012. Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production. Plant Biotechnol. J. 10 (4), 443–452. Harvey, J.J., et al., 2011. An antiviral defense role of AGO2 in plants. PLoS One 6 (1), e14639. Jaubert, M., et al., 2011. ARGONAUTE2 mediates RNA-silencing antiviral defenses against Potato virus X in Arabidopsis. Plant Physiol. 156 (3), 1556–1564. Jones-Rhoades, M.W., Bartel, D.P., 2004. Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol. Cell 14 (6), 787–799. Jung, J.H., et al., 2007. The GIGANTEA-regulated microRNA172 mediates photoperiodic flowering independent of CONSTANS in Arabidopsis. Plant Cell 19 (9), 2736–2748. Jung, J.H., et al., 2011. miR172 signals are incorporated into the miR156 signaling pathway at the SPL3/4/5 genes in Arabidopsis developmental transitions. Plant Mol. Biol. 76 (1-2), 35–45. Ketting, R.F., 2007. A dead end for microRNAs. Cell 131 (7), 1226–1227. Kim, J.H., et al., 2009. Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis. Science 323 (5917), 1053–1057. Koyama, T., et al., 2007. TCP transcription factors control the morphology of shoot lateral organs via negative regulation of the expression of boundary-specific genes in Arabidopsis. Plant Cell 19 (2), 473–484. Koyama, T., et al., 2010. TCP transcription factors regulate the activities of ASYMMETRIC LEAVES1 and miR164, as well as the auxin response, during differentiation of leaves in Arabidopsis. Plant Cell 22 (11), 3574–3588. Kurihara, Y., Watanabe, Y., 2004. Arabidopsis micro-RNA biogenesis through Dicer-like 1 protein functions. Proc. Natl. Acad. Sci. U. S. A. 101 (34), 12753–12758. Lang, J.D., Ray, S., Ray, A., 1994. sin 1, a mutation affecting female fertility in Arabidopsis, interacts with mod 1, its recessive modifier. Genetics 137 (4), 1101–1110. Li, J., et al., 2005. Methylation protects miRNAs and siRNAs from a 3 -end uridylation activity in Arabidopsis. Curr. Biol. 15 (16), 1501–1507. Li, W., et al., 2012. Transcriptional regulation of Arabidopsis MIR168a and argonaute1 homeostasis in abscisic acid and abiotic stress responses. Plant Physiol. 158 (3), 1279–1292. Lobbes, D., et al., 2006. SERRATE: a new player on the plant microRNA scene. EMBO Rep. 7 (10), 1052–1058. Lu, C., Fedoroff, N., 2000. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin. Plant Cell 12 (12), 2351–2366. Maunoury, N., Vaucheret, H., 2011. AGO1 and AGO2 act redundantly in miR408-mediated plantacyanin regulation. PLoS One 6 (12), e28729. McElver, J., et al., 2001. Insertional mutagenesis of genes required for seed development in Arabidopsis thaliana. Genetics 159 (4), 1751–1763. Mi, S., et al., 2008. Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5 terminal nucleotide. Cell 133 (1), 116–127. Montgomery, T.A., et al., 2008. Specificity of ARGONAUTE7-miR390 interaction and dual functionality in TAS3 trans-acting siRNA formation. Cell 133 (1), 128–141. Morel, J.B., et al., 2002. Fertile hypomorphic ARGONAUTE (ago1) mutants impaired in post-transcriptional gene silencing and virus resistance. Plant Cell 14 (3), 629–639. Palatnik, J.F., et al., 2003. Control of leaf morphogenesis by microRNAs. Nature 425 (6955), 257–263. Park, W., et al., 2002. CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana. Curr. Biol. 12 (17), 1484–1495. Qi, Y., Denli, A.M., Hannon, G.J., 2005. Biochemical specialization within Arabidopsis RNA silencing pathways. Mol. Cell 19 (3), 421–428. Rajagopalan, R., et al., 2006. A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Genes Dev. 20 (24), 3407–3425. Reyes, J.L., Chua, N.H., 2007. ABA induction of miR159 controls transcript levels of two MYB factors during Arabidopsis seed germination. Plant J. 49 (4), 592–606. Rhoades, M.W., et al., 2002. Prediction of plant microRNA targets. Cell 110 (4), 513–520. Robinson-Beers, K., Pruitt, R.E., Gasser, C.S., 1992. Ovule development in wild-type Arabidopsis and two female-sterile mutants. Plant Cell 4 (10), 1237–1249. Rubio-Somoza, I., Weigel, D., 2011. MicroRNA networks and developmental plasticity in plants. Trends Plant Sci. 16 (5), 258–264.
626
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
Scholthof, H.B., et al., 2011. Identification of an ARGONAUTE for antiviral RNA silencing in Nicotiana benthamiana. Plant Physiol. 156 (3), 1548–1555. Schommer, C., et al., 2008. Control of jasmonate biosynthesis and senescence by miR319 targets. PLoS Biol. 6 (9), e230. Shao, C., et al., 2014. Is Argonaute 1 the only effective slicer of small RNA-mediated regulation of gene expression in plants? J. Exp. Bot. 65 (22), 6293–6299. Sire, C., et al., 2009. Diurnal oscillation in the accumulation of Arabidopsis microRNAs, miR167, miR168, miR171 and miR398. FEBS Lett. 583 (6), 1039–1044. Song, J.B., et al., 2013. miR394 and LCR are involved in Arabidopsis salt and drought stress responses in an abscisic acid-dependent manner. BMC Plant Biol. 13, 210. Takeda, A., et al., 2008. The mechanism selecting the guide strand from small RNA duplexes is different among argonaute proteins. Plant Cell Physiol. 49 (4), 493–500. Varallyay, E., et al., 2010. Plant virus-mediated induction of miR168 is associated with repression of ARGONAUTE1 accumulation. EMBO J. 29 (20), 3507–3519. Vaucheret, H., et al., 2004. The action of ARGONAUTE1 in the miRNA pathway and its regulation by the miRNA pathway are crucial for plant development. Genes Dev. 18 (10), 1187–1197. Vaucheret, H., Mallory, A.C., Bartel, D.P., 2006. AGO1 homeostasis entails coexpression of MIR168 and AGO1 and preferential stabilization of miR168 by AGO1. Mol. Cell 22 (1), 129–136. Vernon, D.M., Meinke, D.W., 1994. Embryogenic transformation of the suspensor in twin, a polyembryonic mutant of Arabidopsis. Dev. Biol. 165 (2), 566–573. Voinnet, O., 2009. Origin, biogenesis, and activity of plant microRNAs. Cell 136 (4), 669–687. Wang, H., et al., 2005. The tomato Aux/IAA transcription factor IAA9 is involved in fruit development and leaf morphogenesis. Plant Cell 17 (10), 2676–2692.
Wang, J.W., Czech, B., Weigel, D., 2009. miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. Cell 138 (4), 738–749. Wang, X.B., et al., 2011. The 21-nucleotide, but not 22-nucleotide, viral secondary small interfering RNAs direct potent antiviral defense by two cooperative argonautes in Arabidopsis thaliana. Plant Cell 23 (4), 1625–1638. Wu, G., et al., 2009. The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. Cell 138 (4), 750–759. Wu, L., et al., 2010. DNA methylation mediated by a microRNA pathway. Mol. Cell 38 (3), 465–475. Xian, Z., et al., 2013. Molecular cloning and characterisation of SlAGO family in tomato. BMC Plant Biol. 13 (1), 126. Xian, Z., et al., 2014. miR168 influences phase transition, leaf epinasty, and fruit development via SlAGO1s in tomato. J. Exp. Bot. 65 (22), 6655–6666. Xie, Z., Kasschau, K.D., Carrington, J.C., 2003. Negative feedback regulation of Dicer-Like1 in Arabidopsis by microRNA-guided mRNA degradation. Curr. Biol. 13 (9), 784–789. Zhang, X., et al., 2011. Arabidopsis Argonaute 2 regulates innate immunity via miRNA393(*)-mediated silencing of a Golgi-localized SNARE gene, MEMB12. Mol. Cell. 42 (3), 356–366. Zhang, X., et al., 2015. Suppression of endogenous gene silencing by bidirectional cytoplasmic RNA decay in Arabidopsis. Science 348 (6230), 120–123. Zhu, H., et al., 2011. Arabidopsis Argonaute10 specifically sequesters miR166/165 to regulate shoot apical meristem development. Cell 145 (2), 242–256.
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Evidence for the biological function of miR403 in tomato development Chao Zhang a,b,1 , Zhiqiang Xian a,1 , Wei Huang a , Zhengguo Li a,∗ a b
Genetic Engineering Research Center, School of Life Science, Chongqing University, Chongqing 400044, People’s Republic of China Life Science and Food Engineering College, Yibin University, 644000 Sichuan, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 6 July 2015 Received in revised form 14 October 2015 Accepted 16 October 2015 Available online 10 November 2015 Keywords: miR403 Argonaute 2 Tomato Germination Floral transition
a b s t r a c t miRNAs are important regulators in plants, animals and worms. AGO proteins bound to miRNAs by recognition of complimentary sequence to repress expression of target genes. In plants, two miRNAs, miR168 and miR403 were identified as repressors of AGO1 and AGO2 respectively. miR168 was confirmed to play a key role in development of plants. However, the function of miR403 had not been illuminated yet. Previously, we investigated the cleavage of SlAGO2at the complimentary sequence of miR403. In this study, over-expression of miR403 in tomato showed flowering delay, leaf morphology and resistance to ABA during germination. Besides, two of transgenic plants exhibited defects in shooting meristem maintenance which were similar as the defects observed in 4m-SlAGO1s transgenic plants. Decrease of SlAGO2and increase of SlAGO1A/1Bwere found in miR403 transgenic plants. Moreover, miR156, miR159 and miR394 were accumulated in miR403 transgenic plants. Our results revealed the function of miR403 in tomato development via affecting expression ofSlAGO2, which might further alter the homeostasis between SlAGO1A/1Band miR168, then influence the balance of down-stream miRNA. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Small RNAs (sRNA) are well known for participation in transcriptional and post-transcriptional regulation of target genes, which affect all levels of genetic information in plants (Rubio-Somoza and Weigel, 2011). As an endogenous sRNA, microRNA (miRNA) can modify both chromatin state and translational progress of their target genes by directing RNA Induced RNA Silencing Complex (RISC) (Voinnet, 2009; Chellappan et al., 2010; Wu et al., 2010). Unlike miRNAs in animals which usually have hundreds of target genes, miRNAs in plants tend to have fewer targets and most of their targets have been identified as important regulators, such as transcription factors and F-box proteins (Rhoades et al., 2002; Jones-Rhoades and Bartel, 2004; Chen et al., 2010). Moreover, miRNAs were found to drive phase transition in Arabidopsis(Wu et al., 2009; Wang et al., 2009), control senescence (Kim et al., 2009; Schommer et al., 2008), regulate cell proliferation (Palatnik et al.,
Abbreviations: AGO, Argonaut; RISC, RNA induced silencing complex; sRNA, small RNA; miRNA, micro RNA; ABA, abscisic acid; dpa, days post anthesis; dpg, days post germination. ∗ Corresponding author. Present address: Shazheng Street 174#, Shapingba 400030, Chongqing, People’s Republic of China. Fax: +86 23 6512 0483. E-mail addresses: [email protected] (C. Zhang), [email protected] (Z. Xian), [email protected] (W. Huang), [email protected], [email protected] (Z. Li). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.scienta.2015.10.027 0304-4238/© 2015 Elsevier B.V. All rights reserved.
2003; Koyama et al., 2007; Koyama et al., 2010) and almost all stages of plant development (see reviews by Rubio-Somoza and Weigel (2011)). miRNAs are synthesized, modified and act via RISC (Park et al., 2002; Vaucheret et al., 2004; Baumberger and Baulcombe, 2005; Qi et al., 2005). As the importance of miRNA directed genes regulation, components of RISC, such as DICERS and AGOs were identified as key regulators in plants. Being part of RNase III family, Dicer cleaved double-strand RNA or pre-miRNA into siRNA/siRNA* or miRNA/miRNA* duplex respectively. Among four Dicer-like proteins (DCL1, DCL2, DCL3 and DCL4) inArabidopsis, DCL1 played major roles in miRNA biosynthesis (Kurihara and Watanabe, 2004) and mutations of DCL1 showed defects in embryo development (Errampalli et al., 1991; Robinson-Beers et al., 1992; Castle et al., 1993; Lang et al., 1994; Vernon and Meinke, 1994; McElver et al., 2001). HYL1 encoded a double strand RNA binding proteins participating in synthesis of miRNA/miRNA* duplex. Mutation of HYL1 had pleiotropic effects on growth and development ofArabidopsis, meanwhile had altered sensitivity to abscisic acid (ABA), auxin and cytokinin (Lu and Fedoroff, 2000). HEN1 participated in modification of miRNA (Li et al., 2005) and its mutation exhibited reduced leaf size, height, carpel fusion, fertilization rate (Chen et al., 2002). Mutations of AGO1 altered leaf shape and architecture of flower (Bohmert et al., 1998). Interestingly, some miRNA were found to be involved in regulation of RISC. DCL1 mRNA was negatively feedback regulated by miR162 (Xie et al., 2003), and miR838 was derived from a
620
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
hairpin in the 14 intron of DCL1 mRNA which led to truncated fragments of DCL1 mRNA (Xie et al., 2003). Argonaut (AGO) proteins are core elements of RISC, which could recognize target genes by guiding miRNAs and then repress expression of target genes via inducing modification of genomic sequence, suppressing translation of mRNA or cleaving at complementary sequence. Transcript of AGO1was regulated by miR168, as both null-ago1 and 4m-AGO1 resulted in defects inArabidopsis. Thus, AGO1 homeostasis regulated by co-expression of miR168 and AGO1 itself was important for plant development (Vaucheret et al., 2006). InArabidopsis, there are ten AGOgenes, among which AGO1 is regulated by miR168 and AGO2 is a potential target of miR403. AGO1 is considered to be the major element acting in the miRNA directed target genes regulation of plants, because AGO1 preferentially binds to small RNAs with 5 U terminal nucleotide (Mi et al., 2008) which most of miRNAs harbor (Rajagopalan et al., 2006). However, biological functions of AGO2 in development of plants are not so clear. AGO2lack DDH motif in the cleavage site (Baumberger and Baulcombe, 2005) and mutations of AGO2showed no significant defects in development (Lobbes et al., 2006). Besides, AGO2 was found to bind to viral siRNA (Takeda et al., 2008) and mutations of AGO2was hyper-susceptible to plant virus (Harvey et al., 2011; Jaubert et al., 2011; Scholthof et al., 2011; Wang et al., 2011), thus AGO2 was considered as a player in antiviral defense, rather than having biological function in development. Interestingly, most of small RNAs that AGO2 binds to is 21 nt, the same length as the major small RNAs that AGO1 binds to (Mi et al., 2008). Recently, AGO2 was found to participate in miRNA or miRNA* guided activity in plants. miR393b* bound to AGO2 to function in antibacterial immunity (Zhang et al., 2011). Moreover, AGO1 and AGO2 were redundant in miR408-mediated plantacyaninregulation (Maunoury and Vaucheret, 2011). At the meantime, a part of miRNAs was found in the AGO2-enriched small RNA database (Shao et al., 2014). As the miRNA which have ability to regulate RISC core-element AGO2 protein, miR403 was supposed to have important function in plants development. But the exact function of miR403 in plant developmental progresses remains unknown. In this study, tomato pre-miR403 was isolated and transferred into tomato. The transgenic plants exhibited flowering delay, leaf morphology and resistance to ABA during germination, which were similar to transgenic of miR168 loss-of-function in tomato. The findings presented a novel idea that miR403 might participate in developmental progress of tomato via a miR403–AGO2–miR168–AGO1 loop. 2. Materials and methods 2.1. Plant materials and growth conditions Tomato (Solamum lycopersicum cv. Micro-Tom) plants were grown in a standard culture chamber under the following conditions: 16/8 h day/night cycle, 23 ◦ C, 80% humidity and 2000 mol s−1 m−2 light density. Seeds were sterilized and then planted on 1/2 MS with 0.8% agar, pH 5.9 for 7 days and the seedlings with similar status were transferred to soil. The tissues of root, stem, leaf, flower bud, flower and different parts of the flower (ovary, stamen, petal, and sepal) were harvested from a 10-weekold tomato plant, and the fruit in different developmental stages (immature green, mature green, breaker, yellow and ripening) were collected according to size or color. Ovaries taken from bud [−2 days post anthesis (−2 dpa)], anthesis flowers (0 dpa), and 4 days post-anthesis flowers (4 dpa). 2.2. Diurnal expression of miR403 and light treatment For examination of relative expression of miR403 in day/night changes, 15 days-old seedlings were harvested at 0 h in day (0 h),
4 h in day (4 h), 8 h in day (8 h), 12 h in day (12 h), 16 h in day (16 h), 4 h in dark (20 h) and 8 h in dark (8 h). 20 days-old seedlings were pre-treated in dark for 7 days, and then transferred to constitutive light for 72 h. Leaves from seedlings were harvested at 0 h (0 h), 0.5 h (0.5 h), 1 h (1 h), 2 h (2 h), 5 h (5 h), 10 h (10 h), 24 h (24 h) and 72 h (72 h) after light treatment. 2.3. Plasmid construction and plant transformation Putative mature sequence and precursor of SlmiR403 was previously identified (Xian et al., 2013). According to putative mature sequence of SlmiR403 (CTAGATTCACGCACAAGCTCG), a series of mature small RNA were identified by local blast with tomato unique small RNAs downloaded from tomato functional genomic database (http://ted.bti.cornell.edu/cgi-bin/ TFGD/sRNA/download.cgi, see results in Supplementary Table 1). The sequence with highestreads (S14362631: CUAGAUUCACGCACAAGCUCG, 6229 total reads with average 51.46 RPM) was identified as the mature sequence of miR403. Pre-miR403 (Sl.50ch01: 78368844–78369169) which contained the sequence of SlmiR403 was amplified with tomato genomic DNA and then directly linked to pBi121 with miR403-SENSE (TAAAAGAGGGCTTATCCATTTCC) and miR403-ANTISENSE (CCTTCATTAGGTATCCGCCGTAC). The positive clones were identified by PCR with the 35S-F (GCTCCTACAAATGCCATCATTGC) and miR403-ANTISENSE, which were subsequently sequenced by Genscript Crop., (Nanjing, China). Pre-miR403 was constructed under the control of the cauliflower mosaic virus 35S promoter and Nos terminator. Transgenic plants were generated according to Wang et al. (2005). Positive plants were selected by kanamycin and PCR amplification with 35S-F and miR403-antisense. 2.4. ABA treatment Seeds of wild type and three independent miR403 transgenic plants were harvested at the same time. After half an hour treatment of 1% HCl (v/v), seeds were washed and dried for 2 days, and then stored at same condition until experiment. Newly harvested seeds were sterilized by 70% ethanol for 30 s, followed by 30 min sterilization with 5% NaCl and washing twice with sterilized water. Sterilized seeds were transferred onto 1/2 MS with 0 M, 1 M and 10 M ABA (10 × 10 cm square dish, 72 seeds on each dish). After 240 h of incubation under the condition of 16/8 h light/dark cycle, 24 ◦ C in light and 16 ◦ C in dark, germination rate of the seeds with each treatment was counted. 2.5. RNA isolation and quantitative real-time PCR Total RNA was isolated from each tissue using Trizol Reagent (Invitrogen, USA). RNAs used for cDNA synthesis were pre-treated with DNaseI(Fermentas, Thermo, USA). cDNAs were reversely transcripted by First Aid cDNA synthesis Kit (Fermentas, Thermo, USA). For miRNA detection, PolyA was added before reverse transcription and adaptor was added by oligo (dT)-adaptor (AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTVN) (Xian et al., 2014). Quantitative real-time PCR (q-PCR) was performed using cDNAs corresponding to 2.5 ng of total RNA in a 20 l reaction using Fast SYBR Mixture (CWBIO, China) on Bio-Rad CFX connect. Slactin-51 (accession number Q96483) was used as reference gene for mRNA and truncated mRNA ofSlAGO2.U6(accession number X51447.1) was used as reference gene for miRNA detection. For target gene analysis, qPCR was performed with primers flanking the miRNAs target sites. Gene accession numbers and primers for qPCR are listed in Supplementary Table 2.
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
621
Fig. 1. Expression partern of miR403 in tomato. (A) Expression of miR403 in different tissues of tomato. Root, leaf, stem, FB (flower bud) and flower were collected from at least 5 flowering tomato plants (about 50 days past germination); IG (imature green) was the fruit harvested on about 15 dpa, MG (mature green) was the fruit harvested on about 30 dpa, Br (breaker) was the fruit harvested on about 42 dpa, YF (yellow fruit) was the fruit harvested on about 45 dpa, RF (red fruit) was the fruit harvested on about 50 dpa. (B) Expression of miR403 in different parts of flower. Ovary, stamen, petal and sepal were havested from flowers of 3 dpa. (C) Examination of miR403 during early fruit development: 2 days before anthesis (−2 days), ovary at anthesis (0 dpa), 4 days post anthesis (4 days) and 6 days post anthesie (6 days). (D) Expression of miR403 during diural cycle: 0–16 h were samples under light period of 0–16 h, 16–24 h were samples under dark period of 0–8 h. (E) Expression of miR403 under light treatment. After treatment under dark for 7 days, 22 dpg old plants were treated under constitant light for 72 h, and then the samples were harvested 0 h (0 h), half an hour (0.5 h), an hour (1 h), 2 h (2 h), 5 h (5 h), 10 h (10 h), 24 h (24 h) and 72 h (72 h) after light treatment. Each sample was harvested from at least 5 individual plants, and each value represents the mean ± standard error of three replicates.
3. Results 3.1. Constitutively expression in different tissues and diurnal oscillation of miR403 in tomato Expression of miR403 was detected in different tissues of tomato (root, stem, leaf, floral bud, flower, immature fruit, breaker fruit, yellow fruit and red fruit), four parts of flower (ovary, stamen, petal sepal) and early developmental progress of fruit (2 days before
anthesis, the day on anthesis, and 4 days after anthesis). According to our results (Fig. 1A–C) and the data from tomato small RNA database (Supplementary Table 3), miR403 was constitutively expressed in the detected tissues and the developmental progress of tomato which expressed 3.85, 4.72 fold in mature green fruit and yellow fruit respectively, while expressed 0.83 fold in the breaker fruit (Fig. 1A). miR403 was found highly accumulated in stamen (14.04 fold) which was dramatically higher than ovary (1.00 fold, Fig. 1B). Moreover, the decrease of miR403 accumulation was inves-
622
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
Table 1 Flowering time of the wild type and miR403 transgenic plants. Name
Flowering time (dpg)
P-value
WT miR403-3# miR403-6# miR403-8#
40.76 47.38 46.28 43.38
NT <0.0001 <0.0001 0.0048
mination efficiency of seeds was counted on MS with different concentration of ABA (0 M, 1 M or 10 M) for 240 h after sterilization. Significant decrease of germination efficiency was found in the wild type accompany with the increase of ABA concentration (83.44% in 0 M, 74.13% in 1 M and 46.53% in 10 M). While three independent miR403 transgenic plants exhibited resistance to ABA during germination. About 93.40%, 94.79% and 92.28% seeds of miR403-3#, miR403-6# and miR403-8# were germinated on 1/2 MS with 0 M ABA; about 88.19%, 85.57% and 70.83% seeds of miR403-3#, miR403-6# and miR403-8# were germinated on 1/2 MS with 1 M ABA; about 70.83%, 84.20% and 64.22% seeds of miR403-3#, miR403-6# and miR403-8# were germinated on 1/2 MS with 10 M ABA (Fig. 3). Due to the low production of miR4034# seeds, the germination efficiency was not detected. 3.3. Expression of relative genes in miR403 transgenic plants
Fig. 2. Defects in growth rate of three independent miR403 transgenic plants. Height of the wild type, miR403-3#, miR403-6# and miR403-8# were measured on 25 dpg. Each value represents the mean ± standard error. Significance was analyzed by Student’s t-test. * indicate p value ≤ 0.05, N ≥ 15, and 4 generations of miR403-3#, miR403-6# and miR403-8# exhibited similar trends of slow growth rate according to observation.
tigated during early fruit development (Fig. 1C). Multiple miRNAs including miR168 had diurnal oscillation in Arabidopsis(Sire et al., 2009), and flowering delay was observed in the 4m-SlAGO1A/4mSlAGO1B transgenic plants of tomato (Xian et al., 2014), indicating that the miRNA network might participate in the light sensing progress which is important for floral transition. Thus the expression of miR403 during day/night change was investigated. miR403 reached expression peak at 12 h after day change (Fig. 1D), which was similar to the expression of miR168 during diurnal change in tomato (Supplementary Fig. 1) and in Arabidopsis(Sire et al., 2009). 3.2. Impact of miR403 in development of tomato Eight positive plants were obtained in this work, 3 of which showed severe defects in flowering (miR403-1#, miR403-4# and miR403-7#). Reproducible seeds could not be harvested from miR403-1# and miR403-7#, and limited seeds were obtained from miR403-4#. T1 (4 positive plants with normal meristem) and T2 (4 positive plants with normal meristem) generation of miR403-4# exhibited slow growth (Supplementary Fig. 2C), and the flowering time was more than 60 days post germination, while the normally wild type flowered on about 40 days post germination in the controlled growth chamber (Supplementary Fig. 2A, B). Moreover, leaf shape of miR403-4# and miR403-8# were changed. The ratio of wide/leaf varied from 48.67% in the wild type to 72.28% in miR403-4# and 58.28% in miR403-8# (Supplementary Fig. 2D, E). Interestingly, no obvious difference existed in the amount of reproducible seeds in other 5 miR403 transgenic plants. miR403-3#, miR403-6# and miR403-8# were used for further analysis. Flowering delay was observed in the three miR403 transgenic plants (Table 1) and the height of miR403 transgenic plants was significantly decreased compared to that of the wild type on 25 days post germination (Fig. 2). Low frequency of meristem abnormality was observed in miR403-6# (2 out of 20 in T3 and 1 out of 40 in T4, Supplementary Fig. 3C), which was also observed in the T2 of miR403-4# (2 out of 6 in T2, Supplementary Fig. 3B, D). Ger-
To confirm the over-expression of miR403 in transgenic plants, miR403 were detected in miR403-3#, miR403-6#, miR403-8# and the wild type using leaves harvested from 5th leaf of 25 day post germination (dpg) plants by qPCR. Generally, miR403 was overexpressed in the detected transgenic plants (Fig. 4A). MiR406-6# showed the highest germination rate under ABA treatment, did not overexpressed the highest level of miR403 (only about 1.7 fold higher than the wild type), while expression of miR403 in miR4033# and miR403-8# showed about 2.2 and 7.9 fold compared to that in the wild type (Fig. 4A). Moreover, the expression of miR403 in the transgenic plants exhibiting severe defects (miR403-4#) were also detected, which was slightly increased compared to the wild type (about 1.25 fold, Fig. 4B). To further explore the mechanism how miR403 induced defects in the transgenic plants, the expression of SlAGO2 was investigated using qPCR. Expression of SlAGO2 was reduced in miR403-3#, miR403-6# and miR403-8# compared to the wild type (Fig. 5A), and expression of SlAGO2 was down-regulated in miR403-4# (about 0.61 fold) compared to the wild type (Fig. 5B). As the defects observed in miR403 transgenic plants were similar to the defects observed in 4m-SlAGO1A/1B in our previous work (Xian et al., 2014), SlAGO1Aand SlAGO1Bwere investigated in miR4033#, miR403-6# and miR403-8#. Expression levels of SlAGO1Awere 1.51–2.98 fold higher compared to the wild type and expression levels of SlAGO1B were 1.60–2.66 fold higher compared to the wild type (Fig. 5A). As the defects of miR403 transgenic plants in height and delay of floral timing compared to wild type (Fig. 2 and Table 1) and the resistance to ABA during Germination (Fig. 3), related miRNA was investigated. MiR156, which was considered as regulator in plants growth regulation and phase transition (Wu et al., 2009), was detected in wild type and miR403 transgenic plant. MiR156 was up-regulated in miR403-OX lines compared to wild type (2.5–3.5 fold, Fig. 6). And two miRNA, miR159 and miR394, which participated in ABA signaling in plant was examined (Song et al., 2013; Reyes and Chua, 2007). miR159 was 2.9–4.1 fold up-regulated and miR394 was 1.3–2.0 fold up-regulated in miR403-OX compared to wild type (Fig. 6). 4. Discussion AGO2 was thought as the important regulator in viral defense other than its biological functions in plant’s development, but recently researcher noted that it was possible to participate in miRNA regulation. miR403 and miR168 two miRNAs which negatively feedback regulate expression of AGO proteins. miR168 could regulate AGO1 which was proved to play important roles in plant development (Vaucheret et al., 2006). Perhaps due to complexity of
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
623
Fig. 3. Resistance of miR403 transgenic plants to ABA during germination. (A) Germination rate of the wild type and three independent miR403 transgenic plants after 240 h treatments on 1/2MS with 0 M, 1 M and 10 M ABA. (B) The wild type and three independent miR403 transgenic plants on 0 M and 10 M ABA after 8 days treatment.
Fig. 4. Accumulation of miR403 in miR403 transgenic plants.
the regulatory network in AGO2, the biological functions of miR403 in plant development are still unrevealed. In this study, slower growth rate, delay of floral transition and resistance to ABA during germination were observed in three independent transgenic lines of miR403 (Figs. 2 and 3 and Table 1).
Moreover, 3 positive lines of miR403 (miR403-1#, miR403-4# and miR403-7#) transgenic plants showed served defects in leaf morphology and flower formation, and only miR403-4# could generate limited reproductive seeds. The defects in leaves, floral transition and production of seeds were stable in T1 and T2 generation of
624
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
Fig. 5. Expressions ofSlAGO2, SlAGO1Aand SlAGO1Bin the wild type and miR403 transgenic plants. (A) Decrease ofSlAGO2, increase of SlAGO1Aand SlAGO1Bin miR403 transgenic plants compared to the wild type. Leaves were harvested from 5th compound leaves of 25 dpg old seedlings. Each value represents the mean ± standard error, and at least three independent experiments were performed with similar results. (B) Decrease of SlAGO2in miR403-4# transgenic plant, due to limitation of the reproductive ability of miR403-4#. The experiment was carried out only once.
miR403-4#. The accumulation of miR403 was only about 1.25 fold in miR403-4# compared to control while the accumulation in other miR403 transgenic plants was more than 1.5 fold compared to control. Accumulation of mature miRNA decreased indcl1, while over-expression of 4m-AGO1 resulted in accumulation of miRNAs, indicating that the content of RISC would eventually influence the expression of mature miRNA. As the resistance to ABA during germination observed in miR403 transgenic plants was similar to resistance to ABA during germination of transgenic plants which accumulated AGO1 in Arabidopsis(Li et al., 2012) and in tomato (Supplementary Fig. 4), and the defects in development of miR403 transgenic plants were also similar to defects observed in 4mSlAGO1s in tomato (Xian et al., 2014), mRNAs levels of SlAGO1Aand SlAGO1Bwere evaluated in miR403 transgenic plants (Fig. 6A). As shown, SlAGO1Aand SlAGO1Bwere accumulated in miR403 transgenic plants, indicating that the defects in miR403 over-expression transgenic plants might be caused by over-accumulation ofSlAGO1s. Evidences in Arabidopsismight explain the unrevealed mechanism. First of all, AGO2 have the ability to bind with miR168 (Zhu et al., 2011), while miR403 was found in the database of AGO1
associated small RNAs [NCBI:GSE22252]; furthermore, both ago1 and ago2were considered to play crucial roles in virus defense (Harvey et al., 2011; Morel et al., 2002; Diermann et al., 2010). All these evidences suggested that AGO1 and AGO2 might cooperate with miR168 and miR403 during virus infection. Secondly, constitutive expression of miR403 in tomato (Fig. 1) indicating that miR403 might have important roles in routine regulation, but lossof-function of AGO2 did not show obvious defects in development (Harvey et al., 2011), demonstrating that AGO2 and miR403 might act like assistant of AGO1. Thirdly, the null-ago1mutation and overexpression of miR168-resistance AGO1 would resulted in severe defects in both situation (Vaucheret et al., 2004; Bohmert et al., 1998), implying that the balance of AGO1 protein would be critical in growth controlling and in the case of virus infection. It is notable that organism evolve a series of mechanism to avoid accident by regulation of endogenous genes. For example, the Dead End1 (DND1) bound to polyA to release the mRNA from RISCsmall RNA (Ketting, 2007). Moreover, the activity of exoribonuclease to cytoplasmic RNA decay module significantly reduced the chance of PTGS in endogenous genes (Zhang et al., 2015). It is likely that overexpression of AGO1 would increase the risk of PTGS in endogenous genes. So the expression of AGO1 should be controlled under a selfcheck regulator (miR168) to maintain the perfect expression level of AGO1. But virus developed a series molecule to crack this system. For example, polerovirus F-box protein P0 degraded AGO1, P21 bound to miRNA/miRNA* and siRNA duplex to inhibit formation of active RISCsmall RNA and P19 had ability to increase level of the endogenous miR168 level to inhibit translational capacity of AGO1 mRNA (Bortolamiol et al., 2007; Chapman et al., 2004; Varallyay et al., 2010). Thus, AGO2 could be considered as a secondary defense layer of plants, in case that the first defense layer component AGO1 was cracked by virus. But the evidences that the binding ability of AGO2 to miR168 and our results of defects in miR403 transgenic plants were similar to the defects observed in miR168-resistance SlAGO1s transgenic plants and miR168 loss-of-function transgenic plants, indicating that miR403 and AGO2 might participate in plant development via influencing expression of AGO1 in the form of AGO2miR168 . Furthermore, miRNA related to the defects observed in miR403OX transgenic lines were investigated. The miR156, miR159 and miR394 were increased in miR403-OX lines compared to wild type (Fig. 6). MiR156 is a regulator in plant growth and phase transition, over expression of miR156 resulted in vegetable phase delay (Jung et al., 2007, 2011) and could influence floral transition in switchgrass (Fu et al., 2012), the increase of miR156 in miR403-OX lines
Fig. 6. Expression of miR156, miR394 and miR159 in wild type and miR403-OX. Each value represents the mean ± standard error, and at least three independent experiments were performed with similar results.
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
might resulted in decease in height and the delay of floral timing. miR159 and miR394 were both accumulated in miR403-OX lines (Fig. 6), both of which was considered participated in ABA signaling, over expression of miR159 and miR394 showed resistance to ABA during germination (Song et al., 2013; Reyes and Chua, 2007). Notably, the transgenic line with the highest expression of miR403 (Fig. 4A) was not the transgenic line with severe defects in development (Figs. 2 and 3, Supplementary Figs. 2 and 3). The relationship between miRNA and AGO proteins was very complicated. As known, miRNAs could direct AGO proteins to repress the expression of target genes, and miRNAs are selected by different AGO proteins (Mi et al., 2008). Moreover, in the analysis of the function of AGO7 and miR390 in TAS3tasiRNA biogenesis, miR390 was found to specifically bind to AGO7 (Montgomery et al., 2008). The binding efficiency of miR165/miR166 to AGO10 was significantly higher than miR165/miR166 to AGO1, so miR165/miR166 was blocked by AGO10 against binding to AGO1 in Arabidopsis(Zhu et al., 2011). The presented evidences showed that the efficiency of different combination of AGO proteins and miRNAs would be different from each other. The contradiction among miR168, miR403, AGO1 and AGO2 was AGO proteins could stabilize the express of miR168 and miR403 (Vaucheret et al., 2006), but miR168 and miR403 could reduce the protein levels of AGO1 and AGO2. It means the increase of miR168 or miR403 would down-regulate AGO1 or AGO2, but reduction of AGO1 or AGO2 might decrease the expression of miR168 or miR403, which finally reduces increase of miR168 or miR403. Moreover, the “. . . AGO2-miR168-AGO1-miR403. . .” loop is vulnerable and tend to lose balance, so even slight change of any element in this loop would be amplified constantly. It is believed that transcriptional regulation of AGO1 and AGO2 by miR168 and miR403 and unknown regulatory factors helps to keep the balance of this loop. 5. Conclusion In this work, defects of development (decease in height and delay of flowering) and resistance to ABA during germination were observed in miR403 transgenic plants, and the decrease of SlAGO2 and increase of SlAGO1 implied that miR403 might participate in development regulation of plant via affect the expression of SlAGO1s, further influence the downstream miRNAs which participated in development of tomato. Acknowledgments This work is supported by National High Technology Research and Development Program of China (2012AA101702), National Basic Research Program of China (2013CB127101, 2013CB127106), National Natural Science Foundation of China (31272166) and Fundamental Research Funds for the Central Universities (CDJXS102311 18). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.scienta.2015. 10.027. References Baumberger, N., Baulcombe, D.C., 2005. Arabidopsis ARGONAUTE1 is an RNA slicer that selectively recruits microRNAs and short interfering RNAs. Proc. Natl. Acad. Sci. U. S. A. 102 (33), 11928–11933. Bohmert, K., et al., 1998. AGO1 defines a novel locus of Arabidopsis controlling leaf development. EMBO J. 17 (1), 170–180. Bortolamiol, D., et al., 2007. The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing. Curr. Biol. 17 (18), 1615–1621.
625
Castle, L.A., et al., 1993. Genetic and molecular characterization of embryonic mutants identified following seed transformation in Arabidopsis. Mol. Gen. Genet. 241 (5–6), 504–514. Chapman, E.J., et al., 2004. Viral RNA silencing suppressors inhibit the microRNA pathway at an intermediate step. Genes Dev. 18 (10), 1179–1186. Chellappan, P., et al., 2010. siRNAs from miRNA sites mediate DNA methylation of target genes. Nucleic Acids Res. 38 (20), 6883–6894. Chen, X., et al., 2002. HEN1 functions pleiotropically in Arabidopsis development and acts in C function in the flower. Development 129 (5), 1085–1094. Chen, M., et al., 2010. Functional characterization of plant small RNAs based on next-generation sequencing data. Comput. Biol. Chem. 34 (5–6), 308–312. Diermann, N., et al., 2010. Characterization of plant miRNAs and small RNAs derived from potato spindle tuber viroid (PSTVd) in infected tomato. Biol. Chem. 391 (12), 1379–1390. Errampalli, D., et al., 1991. Embryonic lethals and T-DNA insertional mutagenesis in Arabidopsis. Plant Cell 3 (2), 149–157. Fu, C., et al., 2012. Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production. Plant Biotechnol. J. 10 (4), 443–452. Harvey, J.J., et al., 2011. An antiviral defense role of AGO2 in plants. PLoS One 6 (1), e14639. Jaubert, M., et al., 2011. ARGONAUTE2 mediates RNA-silencing antiviral defenses against Potato virus X in Arabidopsis. Plant Physiol. 156 (3), 1556–1564. Jones-Rhoades, M.W., Bartel, D.P., 2004. Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol. Cell 14 (6), 787–799. Jung, J.H., et al., 2007. The GIGANTEA-regulated microRNA172 mediates photoperiodic flowering independent of CONSTANS in Arabidopsis. Plant Cell 19 (9), 2736–2748. Jung, J.H., et al., 2011. miR172 signals are incorporated into the miR156 signaling pathway at the SPL3/4/5 genes in Arabidopsis developmental transitions. Plant Mol. Biol. 76 (1-2), 35–45. Ketting, R.F., 2007. A dead end for microRNAs. Cell 131 (7), 1226–1227. Kim, J.H., et al., 2009. Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis. Science 323 (5917), 1053–1057. Koyama, T., et al., 2007. TCP transcription factors control the morphology of shoot lateral organs via negative regulation of the expression of boundary-specific genes in Arabidopsis. Plant Cell 19 (2), 473–484. Koyama, T., et al., 2010. TCP transcription factors regulate the activities of ASYMMETRIC LEAVES1 and miR164, as well as the auxin response, during differentiation of leaves in Arabidopsis. Plant Cell 22 (11), 3574–3588. Kurihara, Y., Watanabe, Y., 2004. Arabidopsis micro-RNA biogenesis through Dicer-like 1 protein functions. Proc. Natl. Acad. Sci. U. S. A. 101 (34), 12753–12758. Lang, J.D., Ray, S., Ray, A., 1994. sin 1, a mutation affecting female fertility in Arabidopsis, interacts with mod 1, its recessive modifier. Genetics 137 (4), 1101–1110. Li, J., et al., 2005. Methylation protects miRNAs and siRNAs from a 3 -end uridylation activity in Arabidopsis. Curr. Biol. 15 (16), 1501–1507. Li, W., et al., 2012. Transcriptional regulation of Arabidopsis MIR168a and argonaute1 homeostasis in abscisic acid and abiotic stress responses. Plant Physiol. 158 (3), 1279–1292. Lobbes, D., et al., 2006. SERRATE: a new player on the plant microRNA scene. EMBO Rep. 7 (10), 1052–1058. Lu, C., Fedoroff, N., 2000. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin. Plant Cell 12 (12), 2351–2366. Maunoury, N., Vaucheret, H., 2011. AGO1 and AGO2 act redundantly in miR408-mediated plantacyanin regulation. PLoS One 6 (12), e28729. McElver, J., et al., 2001. Insertional mutagenesis of genes required for seed development in Arabidopsis thaliana. Genetics 159 (4), 1751–1763. Mi, S., et al., 2008. Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5 terminal nucleotide. Cell 133 (1), 116–127. Montgomery, T.A., et al., 2008. Specificity of ARGONAUTE7-miR390 interaction and dual functionality in TAS3 trans-acting siRNA formation. Cell 133 (1), 128–141. Morel, J.B., et al., 2002. Fertile hypomorphic ARGONAUTE (ago1) mutants impaired in post-transcriptional gene silencing and virus resistance. Plant Cell 14 (3), 629–639. Palatnik, J.F., et al., 2003. Control of leaf morphogenesis by microRNAs. Nature 425 (6955), 257–263. Park, W., et al., 2002. CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana. Curr. Biol. 12 (17), 1484–1495. Qi, Y., Denli, A.M., Hannon, G.J., 2005. Biochemical specialization within Arabidopsis RNA silencing pathways. Mol. Cell 19 (3), 421–428. Rajagopalan, R., et al., 2006. A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Genes Dev. 20 (24), 3407–3425. Reyes, J.L., Chua, N.H., 2007. ABA induction of miR159 controls transcript levels of two MYB factors during Arabidopsis seed germination. Plant J. 49 (4), 592–606. Rhoades, M.W., et al., 2002. Prediction of plant microRNA targets. Cell 110 (4), 513–520. Robinson-Beers, K., Pruitt, R.E., Gasser, C.S., 1992. Ovule development in wild-type Arabidopsis and two female-sterile mutants. Plant Cell 4 (10), 1237–1249. Rubio-Somoza, I., Weigel, D., 2011. MicroRNA networks and developmental plasticity in plants. Trends Plant Sci. 16 (5), 258–264.
626
C. Zhang et al. / Scientia Horticulturae 197 (2015) 619–626
Scholthof, H.B., et al., 2011. Identification of an ARGONAUTE for antiviral RNA silencing in Nicotiana benthamiana. Plant Physiol. 156 (3), 1548–1555. Schommer, C., et al., 2008. Control of jasmonate biosynthesis and senescence by miR319 targets. PLoS Biol. 6 (9), e230. Shao, C., et al., 2014. Is Argonaute 1 the only effective slicer of small RNA-mediated regulation of gene expression in plants? J. Exp. Bot. 65 (22), 6293–6299. Sire, C., et al., 2009. Diurnal oscillation in the accumulation of Arabidopsis microRNAs, miR167, miR168, miR171 and miR398. FEBS Lett. 583 (6), 1039–1044. Song, J.B., et al., 2013. miR394 and LCR are involved in Arabidopsis salt and drought stress responses in an abscisic acid-dependent manner. BMC Plant Biol. 13, 210. Takeda, A., et al., 2008. The mechanism selecting the guide strand from small RNA duplexes is different among argonaute proteins. Plant Cell Physiol. 49 (4), 493–500. Varallyay, E., et al., 2010. Plant virus-mediated induction of miR168 is associated with repression of ARGONAUTE1 accumulation. EMBO J. 29 (20), 3507–3519. Vaucheret, H., et al., 2004. The action of ARGONAUTE1 in the miRNA pathway and its regulation by the miRNA pathway are crucial for plant development. Genes Dev. 18 (10), 1187–1197. Vaucheret, H., Mallory, A.C., Bartel, D.P., 2006. AGO1 homeostasis entails coexpression of MIR168 and AGO1 and preferential stabilization of miR168 by AGO1. Mol. Cell 22 (1), 129–136. Vernon, D.M., Meinke, D.W., 1994. Embryogenic transformation of the suspensor in twin, a polyembryonic mutant of Arabidopsis. Dev. Biol. 165 (2), 566–573. Voinnet, O., 2009. Origin, biogenesis, and activity of plant microRNAs. Cell 136 (4), 669–687. Wang, H., et al., 2005. The tomato Aux/IAA transcription factor IAA9 is involved in fruit development and leaf morphogenesis. Plant Cell 17 (10), 2676–2692.
Wang, J.W., Czech, B., Weigel, D., 2009. miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. Cell 138 (4), 738–749. Wang, X.B., et al., 2011. The 21-nucleotide, but not 22-nucleotide, viral secondary small interfering RNAs direct potent antiviral defense by two cooperative argonautes in Arabidopsis thaliana. Plant Cell 23 (4), 1625–1638. Wu, G., et al., 2009. The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. Cell 138 (4), 750–759. Wu, L., et al., 2010. DNA methylation mediated by a microRNA pathway. Mol. Cell 38 (3), 465–475. Xian, Z., et al., 2013. Molecular cloning and characterisation of SlAGO family in tomato. BMC Plant Biol. 13 (1), 126. Xian, Z., et al., 2014. miR168 influences phase transition, leaf epinasty, and fruit development via SlAGO1s in tomato. J. Exp. Bot. 65 (22), 6655–6666. Xie, Z., Kasschau, K.D., Carrington, J.C., 2003. Negative feedback regulation of Dicer-Like1 in Arabidopsis by microRNA-guided mRNA degradation. Curr. Biol. 13 (9), 784–789. Zhang, X., et al., 2011. Arabidopsis Argonaute 2 regulates innate immunity via miRNA393(*)-mediated silencing of a Golgi-localized SNARE gene, MEMB12. Mol. Cell. 42 (3), 356–366. Zhang, X., et al., 2015. Suppression of endogenous gene silencing by bidirectional cytoplasmic RNA decay in Arabidopsis. Science 348 (6230), 120–123. Zhu, H., et al., 2011. Arabidopsis Argonaute10 specifically sequesters miR166/165 to regulate shoot apical meristem development. Cell 145 (2), 242–256.