- Email: [email protected]
Evidence of ABL-kinase domain mutations in highly purified primitive stem cell populations of patients with chronic myelogenous leukemia
BBRC Biochemical and Biophysical Research Communications 323 (2004) 728–730 www.elsevier.com/locate/ybbrc
Evidence of ABL-kinase domain mutations in highly purified primitive stem cell populations of patients with chronic myelogenous leukemia N. Sorela, M.L. Bonnetc, M. Guillierc, F. Guilhotb, A. Brizarda, A.G. Turhanc,d,* a Laboratory of Hematology, Hoˆpital de la Miletrie, CHU Poitiers, France Department of Hematological Oncology and Cell Therapy, Hoˆpital de la Miletrie, CHU Poitiers, France Translational Research-Cell Therapy Laboratory, Department of Cell Biology, Institut Gustave Roussy, Villejuif, France d Inserm U362, Institut Gustave Roussy, Villejuif, France b
c
Received 23 August 2004 Available online 11 September 2004
Abstract To study the hierarchical levels of stem cell targets for ABL-kinase domain mutations in CML, highly purified CD34+CD38 and CD34+CD38+ cell populations and their LTC-IC-derived progeny were analyzed in four patients at diagnosis (n = 1) or in advanced phases (n = 3) of their disease. In the single patient with early phase CML who later developed an Imatinib Mesylate-resistance and a Y253H mutation, no mutation was detectable in purified cell fractions analyzed at diagnosis nor in their LTC-ICderived progeny. In contrast, in three patients in advanced phase CML, ABL-kinase mutations demonstrated in peripheral blood cells by sequencing (Q252E and M351T) were detectable in the FACS-sorted cells and became amplified in the LTC-IC-derived progeny of the primitive cells. These findings demonstrate that in late CP or advanced CML, ABL-kinase mutations occur as an intraclonal event in the primitive Ph1+ stem cell compartments with progression of this clone towards IM-resistant blast phase. 2004 Elsevier Inc. All rights reserved. Keywords: BCR-ABL; Chronic myelogenous leukemia; ABL-kinase domain mutations; Stem cells; Tyrosine kinase; Imatinib mesylate
The use of Imatinib mesylate (IM) has dramatically changed the treatment options in chronic myelogenous leukaemia (CML) [1]. However, the advantage of IM as a first line treatment in terms of survival as compared to IFN-a-ARA-C association has not been demonstrated, requiring longer follow-up. Moreover, several groups have pointed out the appearance of IM-resistance in a significant proportion of CML patients, especially but not exclusively in advanced phases [2–4]. Currently, in approximately 30% of patients with IM resistance, a mutation in the ABL-kinase domain of the BCR-ABL fusion gene is demonstrated [4]. The hier-
archical level of stem cell targets for ABL-kinase domain mutations has not been determined so far. This question is of major interest as it has been shown that the most primitive quiescent stem cell populations are resistant to IM [5]. The presence of an ABL-kinase mutation domain in the most-primitive stem cell population might not only predispose the patients to relapse but also to an up-front IM-resistance. Our data demonstrate that mutations of the ABL-kinase domain arise in a very primitive stem cell compartment in patients with CML.
Materials and methods *
Corresponding author. Fax: +33 1 42115303. E-mail address: [email protected] (A.G. Turhan).
0006-291X/$ - see front matter 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.08.169
Cell purification. MNC fractions were obtained from PB samples of all four patients after informed consent, and frozen either as MNC or
N. Sorel et al. / Biochemical and Biophysical Research Communications 323 (2004) 728–730 after CD34+ cell purification. Cell samples were thawed, labelled with anti-CD34 and anti-CD38 antibodies (Becton–Dickinson) in the presence of appropriate controls. After two washes, samples were sorted using a FACS-Vantage (Becton–Dickinson, San Jose, CA, USA). CD34+CD38 (6 · 103–7 · 105) and CD34+CD38+ (9.5 · 103– 9.2 · 105) cells were then used to extract RNA and to initiate long-term cultures. Long-term culture assays. Long-term culture (LTC) assays were performed according to previously described standard techniques in 96-well plates on MS-5 feeders [6]. LTC-initiating cell (LTC-IC)-derived progeny (clonogenic cells or non-adherent hematopoietic cells) were analyzed for ABL-kinase domain mutation at week 5 or week 10. RNA extraction, PCR amplification, and sequencing. Total RNA was extracted from PBMNC cells, highly purified CD34+/CD38+/ stem cells or LTC-IC-derived progeny of the purified cells using Extract-All reagent (Eurobio, Les Ullis, France). cDNA synthesis was performed using MMLV reverse transcriptase and random primers. Amplification of Bcr-Abl kinase domain was realized by two nested polymerase chain reactions using the B2B (BCR) forward primer [7] and either the 5 0 reverse Abl primer: GCAGTTTCGGGCAGCAAG AT or the 3 0 reverse ABL primer: TCCCAAAGCAATACT CCAAATG. The PCR product of this first round was reamplified using two couples of primers to amplify the SH1 domain (residues 225– 430) of ABL in two halves. The 5 0 half was amplified using the 5 0 forward ABL primer: CTGTCTATGGTGTGTCCCCC and the 5 0 reverse ABL primer with a 40 bp-GC clamp (477 bp). The 3 0 half of the SH1 domain was amplified using the 3 0 forward ABL primer: AAAG AGATCAAACACCCTAACC and the 3 0 reverse ABL primer with a 40 bp-GC clamp (462 bp). Sequencing of PCR products was performed using the Applied Biosystems sequencing system. Denaturing gradient gel electrophoresis. The DGGE system 2001 (CBS, Del Mar, CA) was used for the sequence-specific separation of the PCR products. Electrophoresis was performed in a 0.75 mm thick polyacrylamide gel [6.5% (v/v) acrylamide–Bis (37.5/1)] containing a 50–80% urea–formamide linear denaturant gradient (100% corresponds to 7 M urea and 40% (v/v) formamide) in 1· TAE buffer. The gel was subjected to a constant voltage of 150 V for 8 h at 60 C. After electrophoresis the gel was stained for 10 min in an ethidium bromide solution and analyzed under UV illumination.
Results and discussion Table 1 shows the characteristics of the patients included in the study. UPN1 was in first chronic phase (CP) and UPN2, UPN3, and UPN4 were in more advanced phases of their disease. Interestingly, UPN1 has
729
also later developed an IM-resistant phenotype with demonstration of a Y253H mutation using direct sequencing. DGGE analysis allowing detection of sequence-specific alterations in the mobility of the PCR products was used to compare the pattern generated by Y253H in the relapse PBMNC sample (Fig. 1A, lane 5) to that observed in FACS-purified CD34+CD38 or CD34+CD38+ cells obtained at diagnosis. The Y253H mutation generated in the relapse sample, two bands (Fig. 1A, lane 5) in addition to the germline band similar to control cDNA (Fig. 1A, lane 1). These additional bands were undetectable in the FACS-purified samples (lanes 6 and 7) or in the week +5 LTC-IC-derived hematopoietic progeny (five pools of six CFU-GM) (Fig. 1A, lanes 8 and 9). In UPN2, UPN3, and UPN4, the analysis of the FACS-purified cells revealed a different pattern: in UPN2, the mutated DGGE pattern generated by Q252E mutation (Fig. 1A, lane 2) was absent in the CD34+CD38 cells (Fig. 1A, lane 3) but clearly present in CD34+CD38+ fractions (Fig. 1A, lane 4). In UPN3, the direct analysis of FACS-purified cells showed no mutated pattern in CD34+CD38 cell populations whereas in UPN4, a barely detectable mutated pattern was present: a direct sequencing of the amplified product did not show any evidence of mutation (data not shown). On the other hand, in both UPN3 and UPN4, DGGE showed evidence of mutated pattern in purified CD34+CD38+ cells (Table 1). The analysis of the more primitive subsets of hematopoietic stem cells by long-term culture assays, revealed the presence of a mutated DGGE pattern in the LTCIC or extended-LTC-IC-derived hematopoietic progeny, originating from both the most primitive CD34+CD38 and the more committed CD34+CD38+ cells at 5 or 10 weeks of the LTC in all three patients (Fig. 1B and Table 1). Thus, in UPN2, UPN3, and UPN4, despite the absence of mutated DGGE pattern in the most primitive CD34+CD38 cell populations, ABL-kinase domainmutated cells were revealed by the LTC procedure, suggesting the occurrence of the mutation in a primitive Ph1+ stem cell.
Table 1 Characteristics of patients and status of ABL-kinase domain mutation analysis in highly purified stem cell subpopulations Patients
UPN1 UPN2 UPN3 UPN4
Status at sample
Treatment at analysis
Mutation in PBMNC
DGGE pattern of highly purified stem cell populations FACS-purified CD34+CD38
FACS-purified CD34+CD38+
LTC-IC-derived progeny from CD34+ CD38fraction
LTC-IC-derived progeny from CD34+CD38+ fraction
CP diagnosis AP CP-late AP
None IM,HU IM IM
Noa Q252E M351T M351T
Not Not Not Not
Not mutated Mutated Mutated Mutated
Not mutated Mutated (w5,w10) Mutated (w5,w10) Mutated (w5)
Not mutated Mutated (w5,w10) Mutated (w5,w10) Mutated (w5)
mutated mutated mutated mutated
CP, chronic phase; AP, accelerated phase; PBMNC, peripheral blood mononuclear cells; IM, Imatinib mesylate; HU, hydroxyurea; w5, LTC-IC derived hematopoietic cells analyzed at week 5; w10: LTC-IC-derived hematopoietic cells analyzed at week 10 (progeny of extended LTC-IC). a The patient UPN1 has later developed an IM-resistance with evidence of Y253H mutation (see text).
730
N. Sorel et al. / Biochemical and Biophysical Research Communications 323 (2004) 728–730
ing the mutation is less amplified in the most primitive CD34+CD38 cell population with amplification occurring in more committed stem cells and their LTC-IC-derived progeny. The absence of detectable Y253H mutation in the diagnosis sample or in the purified stem cell populations of UPN1 who later developed a IM-resistant relapse could be due either to the fact that the mutation occurred during the treatment or it pre-existed prior to IM therapy [8] but was below the threshold of detection by PCR. Our data demonstrate for the first time to our knowledge, the presence of ABL-kinase mutations in primitive stem cell subsets in patients with late CP or advanced CML. These findings also demonstrate that analysis of the mutational status of primitive stem cells using can be done using the DGGE as rapid surrogate assay to screen CP-CML patients, to understand the kinetics of the occurrence of IM-resistance and to design new therapeutic strategies. Fig. 1. DGGE analysis of highly purified stem cells from patients with CML. (A) Lane 1: control cDNA from a normal marrow with amplification of the 5 0 region of ABL domain giving rise to single homoduplex. Lane 2: in the PBMNC of the patient UPN2 in accelerated phase, the presence of a heteroduplex indicates the presence of a mutation. This DGGE pattern is generated by Q252E mutation which is confirmed by sequencing of the PCR product. Lane 3: FACS-sorted 34+38 cell populations analyzed after amplification show a single band identical to the control, whereas in the CD34+CD38+ cells (lane 4) a heteroduplex identical to the pattern seen in ABL-mutated total PBMNC. Lane 5: PBMNC of the patient UPN1 at the time of IM-resistance. A homoduplex is detectable with a non-mutated germline band identical to that seen in control cDNA (lane 1) and two other bands generated by the Y253H mutation, confirmed by sequencing. Lane 6: CD34+CD38 cells of the same patient obtained at diagnosis, showing a single non-mutated allele identical to the control cDNA. Lane 7: FACS-purified CD34+CD38+ cells of UPN1. Lanes 8 and 9: DGGE pattern of cDNA amplified from LTC-IC-derived CFU-GM pools (pool of six colonies) of CD34+CD34 and CD34+CD38+ origin, respectively. (B) Lanes 1 and 2: DGGE pattern of week 5 LTC-IC-derived hematopoietic cells originating from CD34+CD38 and CD34+CD38+ fractions in UPN2 revealing a mutated pattern [Q252E mutation pattern detected in (A), lane 2]. Lanes 3 and 4: mutated DGGE pattern revealed in the extended-LTC-IC (10 weeks) derived from CD34+CD38 and CD34+CD38+ cell, respectively. Lane 5: mutated DGGE pattern generated by M351T mutation in UPN3 MNC. This mutation generates, in addition to the germline band (A, control cDNA) a slowly migrating heteroduplex and a duplication of the germline band (homoduplex). Lanes 6 and 7: week +5 LTC-IC progeny, with evidence of mutated pattern. Lanes 8 and 9: week +10 extended-LTCIC-derived progeny with evidence of mutated pattern.
CML originates from the most primitive quiescent hematopoietic stem cell which is believed to be resistant to IM at least in vitro [5]. Our findings suggest that ABL-kinase mutations can occur in the Ph1+ primitive stem cell compartment leading eventually this clone to IM-resistance especially in patients with advanced CML (UPN2 and UPN4 were both in an IM-resistant accelerated phase and UPN3 had an IM-resistant late CP). Our data also suggest that the stem cell clone bear-
References [1] S.G. OÕBrien, F. Guilhot, R.A. Larson, I. Gathmann, M. Baccarani, F. Cervantes, J.J. Cornelissen, T. Fischer, A. Hochhaus, T. Hughes, K. Lechner, J.L. Nielsen, P. Rousselot, J. Reiffers, G. Saglio, J. Shepherd, B. Simonsson, A. Gratwohl, J.M. Goldman, H. Kantarjian, K. Taylor, G. Verhoef, A.E. Bolton, R. Capdeville, B.J. Druker, IRIS investigators. Imatinib compared with interferon and low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid leukemia, N. Engl. J. Med. 348 (2003) 994–1004. [2] M.E. Gorre, M. Mohammed, K. Ellwood, N. Hsu, R. Paquette, P.N. Rao, C.L. Sawyers, Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification, Science 293 (2001) 876–880. [3] S. Branford, Z. Rudzki, S. Walsh, A. Grigg, C. Arthur, K. Taylor, R. Herrmann, K.P. Lynch, T.P. Hughes, High frequency of point mutations clustered within the adenosine triphosphate-binding region of BCR/ABL in patients with chronic myeloid leukemia or Ph-positive acute lymphoblastic leukemia who develop Imatinib (STI571) resistance, Blood 99 (2002) 3472–3475. [4] A. Hochhaus, S. Kreil, A.S. Corbin, P. La Rosee, M.C. Muller, T. Lahaye, B. Hanfstein, C. Schoch, N.C. Cross, U. Berger, H. Gschaidmeier, B.J. Druker, R. Hehlmann, Molecular and chromosomal mechanisms of resistance to Imatinib (STI571) therapy, Leukemia 16 (2002) 2190–2196. [5] S.M. Graham, H.G. Jorgensen, E. Allan, C. Pearson, M.J. Alcorn, L. Richmond, T.L. Holyoake, Primitive, quiescent, Philadelphiapositive stem cells from patients with chronic myeloid leukemia are insensitive to STI571 in vitro, Blood 99 (2002) 319–325. [6] C. Tourino, F. Pflumio, S. Novault, A. Masse, M. Guiller, M.L. Bonnet, D. Valteau-Couanet, O. Hartmann, W. Vainchenker, F. Beaujean, L. Coulombel, A.G. Turhan, Efficient ex vivo expansion of NOD/SCID-repopulating cells with lympho-myeloid potential in hematopoietic grafts of children with solid tumors, Hematol. J. 2 (2001) 108–116. [7] N.C. Cross, J.V. Melo, L. Feng, J.M. Goldman, An optimized multiplex polymerase chain reaction (PCR) for detection of BCRABL fusion mRNAs in haematological disorders, Leukemia 8 (1994) 186–189. [8] C. Roche-Lestienne, V. Soenen-Cornu, N. Grardel-Duflos, J.L. Lai, N. Philippe, T. Facon, P. Fenaux, C. Preudhomme, Several types of mutations of the Abl gene can be found in chronic myeloid leukemia patients resistant to STI571, and they can pre-exist to the onset of treatment, Blood 100 (2002) 1014–1018.
Evidence of ABL-kinase domain mutations in highly purified primitive stem cell populations of patients with chronic myelogenous leukemia N. Sorela, M.L. Bonnetc, M. Guillierc, F. Guilhotb, A. Brizarda, A.G. Turhanc,d,* a Laboratory of Hematology, Hoˆpital de la Miletrie, CHU Poitiers, France Department of Hematological Oncology and Cell Therapy, Hoˆpital de la Miletrie, CHU Poitiers, France Translational Research-Cell Therapy Laboratory, Department of Cell Biology, Institut Gustave Roussy, Villejuif, France d Inserm U362, Institut Gustave Roussy, Villejuif, France b
c
Received 23 August 2004 Available online 11 September 2004
Abstract To study the hierarchical levels of stem cell targets for ABL-kinase domain mutations in CML, highly purified CD34+CD38 and CD34+CD38+ cell populations and their LTC-IC-derived progeny were analyzed in four patients at diagnosis (n = 1) or in advanced phases (n = 3) of their disease. In the single patient with early phase CML who later developed an Imatinib Mesylate-resistance and a Y253H mutation, no mutation was detectable in purified cell fractions analyzed at diagnosis nor in their LTC-ICderived progeny. In contrast, in three patients in advanced phase CML, ABL-kinase mutations demonstrated in peripheral blood cells by sequencing (Q252E and M351T) were detectable in the FACS-sorted cells and became amplified in the LTC-IC-derived progeny of the primitive cells. These findings demonstrate that in late CP or advanced CML, ABL-kinase mutations occur as an intraclonal event in the primitive Ph1+ stem cell compartments with progression of this clone towards IM-resistant blast phase. 2004 Elsevier Inc. All rights reserved. Keywords: BCR-ABL; Chronic myelogenous leukemia; ABL-kinase domain mutations; Stem cells; Tyrosine kinase; Imatinib mesylate
The use of Imatinib mesylate (IM) has dramatically changed the treatment options in chronic myelogenous leukaemia (CML) [1]. However, the advantage of IM as a first line treatment in terms of survival as compared to IFN-a-ARA-C association has not been demonstrated, requiring longer follow-up. Moreover, several groups have pointed out the appearance of IM-resistance in a significant proportion of CML patients, especially but not exclusively in advanced phases [2–4]. Currently, in approximately 30% of patients with IM resistance, a mutation in the ABL-kinase domain of the BCR-ABL fusion gene is demonstrated [4]. The hier-
archical level of stem cell targets for ABL-kinase domain mutations has not been determined so far. This question is of major interest as it has been shown that the most primitive quiescent stem cell populations are resistant to IM [5]. The presence of an ABL-kinase mutation domain in the most-primitive stem cell population might not only predispose the patients to relapse but also to an up-front IM-resistance. Our data demonstrate that mutations of the ABL-kinase domain arise in a very primitive stem cell compartment in patients with CML.
Materials and methods *
Corresponding author. Fax: +33 1 42115303. E-mail address: [email protected] (A.G. Turhan).
0006-291X/$ - see front matter 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.08.169
Cell purification. MNC fractions were obtained from PB samples of all four patients after informed consent, and frozen either as MNC or
N. Sorel et al. / Biochemical and Biophysical Research Communications 323 (2004) 728–730 after CD34+ cell purification. Cell samples were thawed, labelled with anti-CD34 and anti-CD38 antibodies (Becton–Dickinson) in the presence of appropriate controls. After two washes, samples were sorted using a FACS-Vantage (Becton–Dickinson, San Jose, CA, USA). CD34+CD38 (6 · 103–7 · 105) and CD34+CD38+ (9.5 · 103– 9.2 · 105) cells were then used to extract RNA and to initiate long-term cultures. Long-term culture assays. Long-term culture (LTC) assays were performed according to previously described standard techniques in 96-well plates on MS-5 feeders [6]. LTC-initiating cell (LTC-IC)-derived progeny (clonogenic cells or non-adherent hematopoietic cells) were analyzed for ABL-kinase domain mutation at week 5 or week 10. RNA extraction, PCR amplification, and sequencing. Total RNA was extracted from PBMNC cells, highly purified CD34+/CD38+/ stem cells or LTC-IC-derived progeny of the purified cells using Extract-All reagent (Eurobio, Les Ullis, France). cDNA synthesis was performed using MMLV reverse transcriptase and random primers. Amplification of Bcr-Abl kinase domain was realized by two nested polymerase chain reactions using the B2B (BCR) forward primer [7] and either the 5 0 reverse Abl primer: GCAGTTTCGGGCAGCAAG AT or the 3 0 reverse ABL primer: TCCCAAAGCAATACT CCAAATG. The PCR product of this first round was reamplified using two couples of primers to amplify the SH1 domain (residues 225– 430) of ABL in two halves. The 5 0 half was amplified using the 5 0 forward ABL primer: CTGTCTATGGTGTGTCCCCC and the 5 0 reverse ABL primer with a 40 bp-GC clamp (477 bp). The 3 0 half of the SH1 domain was amplified using the 3 0 forward ABL primer: AAAG AGATCAAACACCCTAACC and the 3 0 reverse ABL primer with a 40 bp-GC clamp (462 bp). Sequencing of PCR products was performed using the Applied Biosystems sequencing system. Denaturing gradient gel electrophoresis. The DGGE system 2001 (CBS, Del Mar, CA) was used for the sequence-specific separation of the PCR products. Electrophoresis was performed in a 0.75 mm thick polyacrylamide gel [6.5% (v/v) acrylamide–Bis (37.5/1)] containing a 50–80% urea–formamide linear denaturant gradient (100% corresponds to 7 M urea and 40% (v/v) formamide) in 1· TAE buffer. The gel was subjected to a constant voltage of 150 V for 8 h at 60 C. After electrophoresis the gel was stained for 10 min in an ethidium bromide solution and analyzed under UV illumination.
Results and discussion Table 1 shows the characteristics of the patients included in the study. UPN1 was in first chronic phase (CP) and UPN2, UPN3, and UPN4 were in more advanced phases of their disease. Interestingly, UPN1 has
729
also later developed an IM-resistant phenotype with demonstration of a Y253H mutation using direct sequencing. DGGE analysis allowing detection of sequence-specific alterations in the mobility of the PCR products was used to compare the pattern generated by Y253H in the relapse PBMNC sample (Fig. 1A, lane 5) to that observed in FACS-purified CD34+CD38 or CD34+CD38+ cells obtained at diagnosis. The Y253H mutation generated in the relapse sample, two bands (Fig. 1A, lane 5) in addition to the germline band similar to control cDNA (Fig. 1A, lane 1). These additional bands were undetectable in the FACS-purified samples (lanes 6 and 7) or in the week +5 LTC-IC-derived hematopoietic progeny (five pools of six CFU-GM) (Fig. 1A, lanes 8 and 9). In UPN2, UPN3, and UPN4, the analysis of the FACS-purified cells revealed a different pattern: in UPN2, the mutated DGGE pattern generated by Q252E mutation (Fig. 1A, lane 2) was absent in the CD34+CD38 cells (Fig. 1A, lane 3) but clearly present in CD34+CD38+ fractions (Fig. 1A, lane 4). In UPN3, the direct analysis of FACS-purified cells showed no mutated pattern in CD34+CD38 cell populations whereas in UPN4, a barely detectable mutated pattern was present: a direct sequencing of the amplified product did not show any evidence of mutation (data not shown). On the other hand, in both UPN3 and UPN4, DGGE showed evidence of mutated pattern in purified CD34+CD38+ cells (Table 1). The analysis of the more primitive subsets of hematopoietic stem cells by long-term culture assays, revealed the presence of a mutated DGGE pattern in the LTCIC or extended-LTC-IC-derived hematopoietic progeny, originating from both the most primitive CD34+CD38 and the more committed CD34+CD38+ cells at 5 or 10 weeks of the LTC in all three patients (Fig. 1B and Table 1). Thus, in UPN2, UPN3, and UPN4, despite the absence of mutated DGGE pattern in the most primitive CD34+CD38 cell populations, ABL-kinase domainmutated cells were revealed by the LTC procedure, suggesting the occurrence of the mutation in a primitive Ph1+ stem cell.
Table 1 Characteristics of patients and status of ABL-kinase domain mutation analysis in highly purified stem cell subpopulations Patients
UPN1 UPN2 UPN3 UPN4
Status at sample
Treatment at analysis
Mutation in PBMNC
DGGE pattern of highly purified stem cell populations FACS-purified CD34+CD38
FACS-purified CD34+CD38+
LTC-IC-derived progeny from CD34+ CD38fraction
LTC-IC-derived progeny from CD34+CD38+ fraction
CP diagnosis AP CP-late AP
None IM,HU IM IM
Noa Q252E M351T M351T
Not Not Not Not
Not mutated Mutated Mutated Mutated
Not mutated Mutated (w5,w10) Mutated (w5,w10) Mutated (w5)
Not mutated Mutated (w5,w10) Mutated (w5,w10) Mutated (w5)
mutated mutated mutated mutated
CP, chronic phase; AP, accelerated phase; PBMNC, peripheral blood mononuclear cells; IM, Imatinib mesylate; HU, hydroxyurea; w5, LTC-IC derived hematopoietic cells analyzed at week 5; w10: LTC-IC-derived hematopoietic cells analyzed at week 10 (progeny of extended LTC-IC). a The patient UPN1 has later developed an IM-resistance with evidence of Y253H mutation (see text).
730
N. Sorel et al. / Biochemical and Biophysical Research Communications 323 (2004) 728–730
ing the mutation is less amplified in the most primitive CD34+CD38 cell population with amplification occurring in more committed stem cells and their LTC-IC-derived progeny. The absence of detectable Y253H mutation in the diagnosis sample or in the purified stem cell populations of UPN1 who later developed a IM-resistant relapse could be due either to the fact that the mutation occurred during the treatment or it pre-existed prior to IM therapy [8] but was below the threshold of detection by PCR. Our data demonstrate for the first time to our knowledge, the presence of ABL-kinase mutations in primitive stem cell subsets in patients with late CP or advanced CML. These findings also demonstrate that analysis of the mutational status of primitive stem cells using can be done using the DGGE as rapid surrogate assay to screen CP-CML patients, to understand the kinetics of the occurrence of IM-resistance and to design new therapeutic strategies. Fig. 1. DGGE analysis of highly purified stem cells from patients with CML. (A) Lane 1: control cDNA from a normal marrow with amplification of the 5 0 region of ABL domain giving rise to single homoduplex. Lane 2: in the PBMNC of the patient UPN2 in accelerated phase, the presence of a heteroduplex indicates the presence of a mutation. This DGGE pattern is generated by Q252E mutation which is confirmed by sequencing of the PCR product. Lane 3: FACS-sorted 34+38 cell populations analyzed after amplification show a single band identical to the control, whereas in the CD34+CD38+ cells (lane 4) a heteroduplex identical to the pattern seen in ABL-mutated total PBMNC. Lane 5: PBMNC of the patient UPN1 at the time of IM-resistance. A homoduplex is detectable with a non-mutated germline band identical to that seen in control cDNA (lane 1) and two other bands generated by the Y253H mutation, confirmed by sequencing. Lane 6: CD34+CD38 cells of the same patient obtained at diagnosis, showing a single non-mutated allele identical to the control cDNA. Lane 7: FACS-purified CD34+CD38+ cells of UPN1. Lanes 8 and 9: DGGE pattern of cDNA amplified from LTC-IC-derived CFU-GM pools (pool of six colonies) of CD34+CD34 and CD34+CD38+ origin, respectively. (B) Lanes 1 and 2: DGGE pattern of week 5 LTC-IC-derived hematopoietic cells originating from CD34+CD38 and CD34+CD38+ fractions in UPN2 revealing a mutated pattern [Q252E mutation pattern detected in (A), lane 2]. Lanes 3 and 4: mutated DGGE pattern revealed in the extended-LTC-IC (10 weeks) derived from CD34+CD38 and CD34+CD38+ cell, respectively. Lane 5: mutated DGGE pattern generated by M351T mutation in UPN3 MNC. This mutation generates, in addition to the germline band (A, control cDNA) a slowly migrating heteroduplex and a duplication of the germline band (homoduplex). Lanes 6 and 7: week +5 LTC-IC progeny, with evidence of mutated pattern. Lanes 8 and 9: week +10 extended-LTCIC-derived progeny with evidence of mutated pattern.
CML originates from the most primitive quiescent hematopoietic stem cell which is believed to be resistant to IM at least in vitro [5]. Our findings suggest that ABL-kinase mutations can occur in the Ph1+ primitive stem cell compartment leading eventually this clone to IM-resistance especially in patients with advanced CML (UPN2 and UPN4 were both in an IM-resistant accelerated phase and UPN3 had an IM-resistant late CP). Our data also suggest that the stem cell clone bear-
References [1] S.G. OÕBrien, F. Guilhot, R.A. Larson, I. Gathmann, M. Baccarani, F. Cervantes, J.J. Cornelissen, T. Fischer, A. Hochhaus, T. Hughes, K. Lechner, J.L. Nielsen, P. Rousselot, J. Reiffers, G. Saglio, J. Shepherd, B. Simonsson, A. Gratwohl, J.M. Goldman, H. Kantarjian, K. Taylor, G. Verhoef, A.E. Bolton, R. Capdeville, B.J. Druker, IRIS investigators. Imatinib compared with interferon and low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid leukemia, N. Engl. J. Med. 348 (2003) 994–1004. [2] M.E. Gorre, M. Mohammed, K. Ellwood, N. Hsu, R. Paquette, P.N. Rao, C.L. Sawyers, Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification, Science 293 (2001) 876–880. [3] S. Branford, Z. Rudzki, S. Walsh, A. Grigg, C. Arthur, K. Taylor, R. Herrmann, K.P. Lynch, T.P. Hughes, High frequency of point mutations clustered within the adenosine triphosphate-binding region of BCR/ABL in patients with chronic myeloid leukemia or Ph-positive acute lymphoblastic leukemia who develop Imatinib (STI571) resistance, Blood 99 (2002) 3472–3475. [4] A. Hochhaus, S. Kreil, A.S. Corbin, P. La Rosee, M.C. Muller, T. Lahaye, B. Hanfstein, C. Schoch, N.C. Cross, U. Berger, H. Gschaidmeier, B.J. Druker, R. Hehlmann, Molecular and chromosomal mechanisms of resistance to Imatinib (STI571) therapy, Leukemia 16 (2002) 2190–2196. [5] S.M. Graham, H.G. Jorgensen, E. Allan, C. Pearson, M.J. Alcorn, L. Richmond, T.L. Holyoake, Primitive, quiescent, Philadelphiapositive stem cells from patients with chronic myeloid leukemia are insensitive to STI571 in vitro, Blood 99 (2002) 319–325. [6] C. Tourino, F. Pflumio, S. Novault, A. Masse, M. Guiller, M.L. Bonnet, D. Valteau-Couanet, O. Hartmann, W. Vainchenker, F. Beaujean, L. Coulombel, A.G. Turhan, Efficient ex vivo expansion of NOD/SCID-repopulating cells with lympho-myeloid potential in hematopoietic grafts of children with solid tumors, Hematol. J. 2 (2001) 108–116. [7] N.C. Cross, J.V. Melo, L. Feng, J.M. Goldman, An optimized multiplex polymerase chain reaction (PCR) for detection of BCRABL fusion mRNAs in haematological disorders, Leukemia 8 (1994) 186–189. [8] C. Roche-Lestienne, V. Soenen-Cornu, N. Grardel-Duflos, J.L. Lai, N. Philippe, T. Facon, P. Fenaux, C. Preudhomme, Several types of mutations of the Abl gene can be found in chronic myeloid leukemia patients resistant to STI571, and they can pre-exist to the onset of treatment, Blood 100 (2002) 1014–1018.