- Email: [email protected]
Evidence of Neospora caninum DNA in wild rodents
Veterinary Parasitology 148 (2007) 346–349 www.elsevier.com/locate/vetpar
Short communication
Evidence of Neospora caninum DNA in wild rodents E. Ferroglio a,*, M. Pasino a, A. Romano a, D. Grande a, P. Pregel b, A. Trisciuoglio a a
Dipartimento di Produzioni Animali, Epidemiologia ed Ecologia, Universita` di Torino, Via L. Da Vinci 44, 10095 Grugliasco (TO), Italy b Dipartimento di Patologia Animale, Universita` di Torino, Via L. Da Vinci 44, 10095 Grugliasco (TO), Italy Received 7 May 2007; received in revised form 20 June 2007; accepted 21 June 2007
Abstract Seventy-five house mice (Mus musculus), 103 rats (Rattus norvegicus) and 55 field mice (Apodemus sylvaticus) from NorthWest Italy were PCR analysed for Neospora caninum infection. Brain, kidney and muscle tissues collected from the above mentioned animals were tested by PCR using Np6 and Np21 primers. The brain tissue from 2 house mice and 2 rats, the kidney from 4 rats, 1 house mouse and 1 field mouse and muscle from 10 rats, 8 house mice and 1 field mouse were tested positive for N. caninum. Sequencing showed a 96–97% identity of PCR products with N. caninum NC1 sequence. Our findings support previous report on house mouse and rat, and for the first time, provides the evidence of the infection also in field mice. Based on our data, it could be hypothesized that mice can act as a reservoir of N. caninum, and they can play a role in maintaining/spreading N. caninum infection also in the sylvatic cycle. The possibility that dogs could be infected by eating infected house mice suggests new opportunities for N. caninum prophylaxis and control. # 2007 Elsevier B.V. All rights reserved. Keywords: Neospora caninum; House mouse; Rat; Field mouse; PCR; Intermediate host
Neospora caninum is a protozoan parasite of dog and livestock recognised for the first time in 1988 (Dubey et al., 1988). In cattle N. caninum infection was recognized for the first time in 1989 (Thilsted and Dubey, 1989) and it is actually reported as a primary abortion pathogen in cattle herds worldwide (Dubey, 2003). The cycle has been only recently clarified with dog (McAllister et al., 2000; Lindsay et al., 1999) and coyote (Canis latrans) (Gondim et al., 2004) as known definitive host, and cattle or other species as the intermediate host. Cattle can be vertically infected, but also horizontal, point-source transmission, due to oocystis elimination by dogs, can occur (McAllister
* Corresponding author. Tel.: +39 011 6709002; fax: +39 011 6709000. E-mail address: [email protected] (E. Ferroglio). 0304-4017/$ – see front matter # 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2007.06.031
et al., 2000). Dogs eliminate oocystis in faeces after ingestion of experimentally infected mice, but apart from vertical transmission, the main source of infection for dogs has been considered aborted foetal fluids or placental material (Dijskstra et al., 2002). The life cycle of protozoa (family Sarcocystidae) closely related to N. caninum is a predator-prey type, with carnivorous that shed oocysts in the faeces after consumption of tissue cysts in intermediate host, which became infected by ingestion of oocysts (Current et al., 1990). The possibility that small mammals could act as a potential reservoir of infection has been suggested by Wouda et al. (1999), and has been recently demonstrated in rat (Rattus norvegicus) and house mice (Mus musculus) from Taiwan (Huang et al., 2004), U.K. (Huges et al., 2006) and United States (Jenkins et al., 2007). Considering that no data are available on the presence of N. caninum in feral rodents in continental Europe and
E. Ferroglio et al. / Veterinary Parasitology 148 (2007) 346–349
in field mice (Apodemus sylvaticus), we deemed it interesting to evaluate, by means of PCR, the presence of infection in house mice, field mice and rats from Piedmont (North-West Italy). In this region previous studies have evidenced the presence of N. caninum infection in both domestic and wild animals (Ferroglio and Rossi, 2001; Ferroglio et al., 2001, 2005, 2007; Ferroglio and Trisciuoglio, 2003). Seventy-five house mice (M. musculus), 103 rats (R. norvegicus) and 55 field mice (A. sylvaticus) were captured with snap traps as part of pest control program around cattle farms in Piedmont with a previous history of abortion due to N. caninum (North-West Italy, 44.58N; 7.58E). Captured rodents were dissected under clean laboratory conditions with sterile scalpels, one for each animal and tissue, in order to avoid cross contaminations. Liddel et al. (1999) reported that the predominant site of infection in experimentally infected mice was the brain and previous reports on wild rodents (Huang et al., 2004; Huges et al., 2006; Jenkins et al., 2007) exanimate only the brain of captured animals. However, a lot of reports showed N. caninum presence in other tissues such as lung, skeletal muscles, heart and kidney (Barber et al., 1996; Ho et al., 1997; Wyss et al., 2000; Peters et al., 2000, 2001; Dubey et al., 2004; Basso et al., 2005; McInnes et al., 2006). So, we collected brain, kidney and skeletal muscle (gluteal muscle) from captured rodents and samples were immediately frozen in single vials at 20 8C. DNA extraction was performed from 25 mg of brain, kidney and gluteal muscle tissue of sampled animals, using the Gen EluteTM Mammalian genomic DNA extraction kit (Sigma–Aldrich, St. Louis, MO, USA) according to manufacturer’s protocol. DNA extracted from cultured N. caninum (NC1) tachyzoites was used as a positive control for the PCR reaction. The used primers were Np6 plus (50 CTCGCCAGTCAACCTACGTCTTCT30 ) and Np21 plus (50 CCCAGTGCGTCCAATCCTGTAAC30 ), as suggested by Muller et al. (1996). DNA amplification was performed in 50 ml reaction mix, containing 8 ml of DNA extract (approximately 50 ng of DNA), 0.5 mM each primer and 25 ml of RedTaqTM Ready MixTM PCR Reaction Mix (Sigma–Aldrich, St. Louis, MO, USA). Amplifications were carried out in a Bio-Rad iCycler thermal cycler. Samples were initially denaturated at 94 8C for 1 min, then submitted to 40 amplification cycles at a denaturing temperature of 94 8C for 1 min, an annealing temperature of 63 8C for 1 min, and an extension temperature of 74 8C for 3 min. A final extension step of 72 8C for 10 min was performed. After amplification, 10 ml aliquots from each reaction were analysed by
347
electrophoresis on 2% agarose gel, in comparison with molecular weight markers (DNA Molecular Weight Marker V, Roche Diagnostics, Mannheim, Germany; PCR 100 bp Low Ladder, Sigma–Aldrich, St. Louis, MO, USA). Gels were stained with MegaFluor kit (Euroclone, Milano, Italy) under the conditions suggested by the manufacturer and photographed on a 254 nm UV transilluminator using a CCD Camera (Gel-Doc Bio-Rad). Positive controls (DNA extracted from N. caninum NC1 culture) and negative controls (distilled water) were included in each step (extraction, amplification and electrophoresis run). Samples were considered positive when a 337 bp specific Np6–Np21 product (Muller et al., 1996) was present (Fig. 1). Fourteen rats (13.6%), nine house mice (13.8%) and two field mice (3.6%) were positive for N. caninum. In detail, PCR positives were found from the brain tissue of 2 house mice and 2 rats, from the kidney of 4 rats, 1 house mouse and 1 field mouse and from skeletal muscle of 10 rats, 8 house mice and 1 field mouse. The two brain positive mice were positive also in muscle, but negative in kidney, while the brain samples from the two positive rat were negative in both kidney and muscle tissues. Fifteen animals tested positive only in muscle (eight rats and five mice), four only in kidney (two rats, one house and one field mouse) and two rats were positive in both muscle and kidney tissues. Two amplicons from rats, one from house mouse and one from field mouse were cloned using the Quiagen PCR CloningPlus kit and sequenced by BMR Genomics, University of Padova (Accession nos. are: EF202081, EF202080, EF202082 and EF202079,
Fig. 1. Agarose gel electrophoresis of PCR products (Np6 plus and Np21 plus primers) from muscle in a rat captured from farm with a previous history of abortion attributable to Neospora caninum (lane 2), from brain in a house mouse (lane 3) and from kidney in a field mouse (lane 4). Positive control DNA prepared from cultured N. caninum NC1 (lane 6) and negative control (distilled water, lane 9 and reagents used for DNA extraction, lane 8). Lane 1 represents PCR 100 bp Low Ladder marker (Sigma–Aldrich, St. Louis, MO, USA). Lanes 5 and 7 represent negative samples. Note the specific amplification products of 337 bp in lanes 2–4 and 6, corresponding to muscle of a rat, brain of a house mouse, kidney of a field mouse and to the positive control.
348
E. Ferroglio et al. / Veterinary Parasitology 148 (2007) 346–349
respectively). The obtained sequences showed a 97% (EF202082, EF202080) and a 96% (EF202081, EF202079) homology with the published N. caninum NC5 sequence (Accession no. X84238). To the best of our knowledge this is the first report of N. caninum infection in field mice. Our results evidenced around farms with an history of N. caninum abortion a percentage of N. caninum infected wild rodents of about 14% in rat and house mice, while field mice showed a lower prevalence (3.6%). The lower prevalence in field mice, compared to both house mice and rat, can be due to their different diet which, in the studied area, is mainly based on seeds with a low proportion of animal component (Canova and Fasola, 1993). Moreover, house mice and rat cohabit with domestic animals and can more easily ingest oocysts eliminated by dogs or infected cattle tissues (i.e. foetuses, foetal fluids or placental material). The prevalences found in our research are greater than the ones reported by Huang et al. (2004) and Huges et al. (2006), but comparable, or lower in rat, to results obtained by Jenkins et al. (2007). The high prevalence obtained may be explained by the fact that we have tested also kidney and muscles tissue. In fact 21 out of 25 animals were brain tissue negative at PCR. Of these, 15 animals tested positive only in muscle, 4 only in kidney and 2 in both tissues. Considering only brain tissue positive rodents we found 4 positive animals, in spite of 25, and our data will be in the range reported, analysing only CNS tissue, by Huang et al. (2004) and Huges et al. (2006). The presence of cysts or N. caninum DNA in tissues other than the CNS has been reported by many authors (Barber et al., 1996; Peters et al., 2000, 2001; Dubey et al., 2004; Basso et al., 2005; McInnes et al., 2006). Peters et al. (2001) evidenced that in dog and cattle N. caninum tissue cysts can be found not only in neural tissues, but also in skeletal muscles and this finding has been confirmed in intermediate host by other authors (Ho et al., 1997; Wyss et al., 2000). Dogs’ role in cattle neosporosis has been highlighted also by seroepidemiological studies (Pare´ et al., 1998; Wouda et al., 1999) and the importance to avoid contamination of cattle feed by oocysts shed by dogs has been discussed by McAllister et al. (2000). Seroprevalence to N. caninum was usually higher in dogs living in farms than in dogs living in urban areas (Sawada et al., 1998; Wouda et al., 1999), and this was confirmed also in the area where the present study has been carried out (Ferroglio et al., 2007). Even if the most common source of infection in dogs still needs to be determined, it is suggested that dogs acquire
infection from cattle by ingesting placenta or foetal tissues and fluids (McAllister, 1999; Dijskstra et al., 2001, 2002). However, Bergeron et al. (2001) showed that the transmission of N. caninum infection to dogs by feeding them with naturally infected bovine foetuses did not occur. Amongst experimental animals, mouse is a known intermediate host for N. caninum and vertical transmission has been demonstrated in laboratory in this species in both acute and chronic infection (Omata et al., 2004). In a study, up to 100% of pups per litter could be vertically infected (Liddel et al., 1999). Considering that in experimental trial the consumption of infected mice lead to the elimination of oocysts in dogs’ faeces (McAllister et al., 1998; Lindsay et al., 1999) and that dogs are frequently reported to eat rodents in farms, the risk that rodent could be a source of infection for dogs, which can subsequently infect cattle by oocysts shedding, must be evaluated. Even if further studies are needed to clarify the epidemiological role of wild rodents in the N. caninum cycle, we hypothesize that mice and rats can act as a source of infection and can play a role in maintaining/ spreading N. caninum infection in both domestic and sylvatic cycles. The possibility that dogs acquire infection by consumption of N. caninum infected wild rodents suggests new opportunities for N. caninum prophylaxis and control. Acknowledgements This study was supported by the Faculty of Veterinary Medicine, University of Turin (Fondi Ricerca Locale ex 60%) and by the Ministero Istruzione, Universita` e Ricerca, MIUR (PRIN 2005). References Barber, J.S., Payne-Johnson, C.E., Trees, A.J., 1996. Distribution of Neospora caninum within the central nervous system and other tissues of six dogs with clinical neosporosis. J. Small Anim. Pract. 37, 568–574. Basso, W., Venturini, M.C., Bacigalupe, D., Kienast, M., Unzaga, J.M., Larsen, A., Machuca, M., Venturini, L., 2005. Confirmed clinical Neospora caninum infection in a boxer puppy from Argentina. Vet. Parasitol. 131, 299–303. Bergeron, N., Fecteau, G., Villenueve, A., Girard, C., Pare´, J., 2001. Failure of dogs to shed oocysts after being fed bovine foetuses naturally infected by Neospora caninum. Vet. Parasitol. 97, 145– 152. Canova, L., Fasola, M., 1993. Food-habits and trophic relationships of small mammals in six habitats of the northern Po plain (Italy). Mammalia 57, 188–199.
E. Ferroglio et al. / Veterinary Parasitology 148 (2007) 346–349 Current, W.L., Upton, S.J., Long, P.L., 1990. Taxonomy and life cycles. In: Long, P.L. (Ed.), Coccidiosis of Man and Domestic Animals. CRC Press, Boca Raton, pp. 1–16. Dijskstra, T., Eysker, M., Schares, G., Conraths, F.J., Wouda, W., Barkema, H.W., 2001. Dogs shed Neospora caninum oocysts after ingestion of naturally infected bovine placenta, but not after ingestion of colostrum spiked with Neospora caninum tachyzoites. Int. J. Parasitol. 31, 747–752. Dijskstra, T., Barkema, H.W., Eysker, M., Hesselink, J.W., Wouda, W., 2002. Natural transmission routes of Neospora caninum between farm dogs and cattle. Vet. Parasitol. 105, 99–104. Dubey, J.P., 2003. Neosporosis in cattle. J. Parasitol. 89, 42–56. Dubey, J.P., Carpenter, J.L., Speer, C.A., Topper, M.J., Uggla, A., 1988. Newly recognized fatal protozoan disease of dogs. J. Am. Vet. Med. Assoc. 192, 1269–1285. Dubey, J.P., Sreekumar, C., Knickman, E., Miska, K.B., Vianna, M.C., Kwok, O.C., Hill, D.E., Jenkins, M.C., Lindsay, D.S., Greene, C.E., 2004. Biologic, morphologic, and molecular characterisation of Neospora caninum isolates from littermate dogs. Int. J. Parasitol. 34, 1157–1167. Ferroglio, E., Rossi, L., 2001. Prevalence of Neospora caninum antibodies in wild ruminants from the Italian Alps. Vet. Rec. 148, 754–755. Ferroglio, E., Trisciuoglio, A., 2003. Antibodies to Neospora caninum in European brown hare (Lepus europaeus). Vet. Parasitol. 115, 75–78. Ferroglio, E., Bassano, B., Trisciuoglio, A., Rossi, L., 2001. Antibodies to Neospora caninum in Alpine ibex from the Italian Alps. Zeitsch. Jagdwissen. 47, 226–228. Ferroglio, E., Guiso, P., Pasino, M., Accossato, A., Trisciuoglio, A., 2005. Antibodies to Neospora caninum in stray cats from north Italy. Vet. Parasitol. 131, 31–34. Ferroglio, E., Pasino, M., Ronco, F., Bena`, A., Trisciuoglio, A., 2007. Seroprevalence of antibodies to Neospora caninum in urban and rural dogs in north-west Italy. Zoonoses Public Health 54, 135–139. Gondim, L.F., McAllister, M.M., Pitt, W.C., Zemlicka, D.E., 2004. Coyotes (Canis latrans) are definitive hosts of Neospora caninum. Int. J. Parasitol. 34, 159–161. Ho, M.S., Barr, B.C., Rowe, J.D., Anderson, M.L., Sverlow, K.W., Packham, A., Marsh, A.E., Conrad, P.A., 1997. Detection of Neospora sp. from infected bovine tissues by PCR and probe hybridization. J. Parasitol. 83, 508–514. Huang, C.C., Yang, C.H., Watanabe, Y., Liao, Y.K., Ooi, H.K., 2004. Finding of Neospora caninum in the wild brown rat (Rattus norvegicus). Vet. Res. 35, 283–290. Huges, J.M., Williams, R.H., Morlet, E.K., Cook, D.A.N., Terry, R.S., Murphy, R.G., Smith, E., Hide, G., 2006. The prevalence of Neospora caninum and co-infection with Toxoplasma gondii by PCR analysis in naturally occurring mammal populations. Parasitology 132, 29–36. Jenkins, M.C., Parker, C., Hill, D., Pinckney, R.D., Dyer, R., Dubey, J.P., 2007. Neospora caninum detected in feral rodents. Vet. Parasitol. 143, 161–165.
349
Liddel, S., Jenkins, M.C., Dubey, J.P., 1999. Vertical transmission of Neospora caninum in BALB/c mice determined by polymerase chain reaction detection. J. Parasitol. 85, 550–555. Lindsay, D.S., Dubey, J.P., Duncan, R.B., 1999. Confirmation that the dog is a definitive host for Neospora caninum. Vet. Parasitol. 82, 327–333. McAllister, M.M., Dubey, J.P., Lindsay, D.S., Jolley, W.R., Wills, R.A., McGuire, A.M., 1998. Dogs are definitive hosts of Neospora caninum. Int. J. Parasitol. 28, 1473–1478. McAllister, M.M., 1999. Uncovering the biology and epidemiology of Neospora caninum. Parasitol. Today 15, 216–217. McAllister, M.M., Bio¨rkman, C., Anderson-Sprecher, R., Rogers, D.G., 2000. Evidence of point-source exposure to Neospora caninum and protective immunity in a herd of beef cows. J. Am. Vet. Med. Assoc. 217, 881–887. McInnes, L.M., Irwin, P., Palmer, D.G., Ryan, U.M., 2006. In vitro isolation and characterisation of the first canine Neospora caninum isolate in Australia. Vet. Parasitol. 137, 355–363. Muller, N., Zimmermann, V., Hentrich, B., Gottstein, B., 1996. Diagnosis of Neospora caninum and Toxoplasma gondii infection by PCR and DNA hybridization immunoassay. J. Clin. Microbiol. 34, 2850–2852. Omata, Y., Nidaira, M., Kano, R., Kopbayashi, Y., Koyama, T., Furuoka, H., Maeda, R., Matsui, T., Saito, A., 2004. Vertical transmission of Neospora caninum in BALB/c mice in both acute and chronic infection. Vet. Parasitol. 121, 323– 328. Pare´, J., Fecteau, G., Fortin, M., Marsolais, G., 1998. Seroepidemiological study of Neospora caninum in dairy herds. J. Am. Vet. Med. Assoc. 213, 1595–1598. Peters, M., Wagner, F., Schares, G., 2000. Canine neosporosis: clinical and pathological findings and first isolation of Neospora caninum in Germany. Parasitol. Res. 86, 1–7. Peters, M., Lutkefels, E., Heckeroth, A.R., Schares, G., 2001. Immunohistochemical and ultrastructural evidence for Neospora caninum tissue cysts in skeletal muscles of naturally infected dogs and cattle. Int. J. Parasitol. 31, 1144–1148. Sawada, M., Park, C., Kondo, H., Morita, T., Shimana, A., Yamane, I., Umenura, T., 1998. Serological survey of antibody to Neospora caninum in Japanese dogs. J. Vet. Med. Sci. 60, 853–854. Thilsted, J.P., Dubey, J.P., 1989. Neosporosis-like abortions in a herd of dairy cattle. J. Vet. Diagn. Invest. 1, 205–209. Wouda, W., Dijkstra, T., Kramer, A.M.H., van Maanen, C., Brinkhof, J.M.A., 1999. Seroepidemiological evidence for a relationship between Neospora caninum infections in dogs and cattle. Int. J. Parasitol. 29, 1677–1682. Wyss, R., Sager, W.R., Muller, N., Inderbitzin, F., Konig, M., Audige, L., Gottstein, B., 2000. Untersuchungen zum Vorkommen von Toxoplasma gondii und Neospora caninum unter fleishhygienischen Aspekten. Schweiz. Arch. Tierheilkd. 142, 95–108.
Short communication
Evidence of Neospora caninum DNA in wild rodents E. Ferroglio a,*, M. Pasino a, A. Romano a, D. Grande a, P. Pregel b, A. Trisciuoglio a a
Dipartimento di Produzioni Animali, Epidemiologia ed Ecologia, Universita` di Torino, Via L. Da Vinci 44, 10095 Grugliasco (TO), Italy b Dipartimento di Patologia Animale, Universita` di Torino, Via L. Da Vinci 44, 10095 Grugliasco (TO), Italy Received 7 May 2007; received in revised form 20 June 2007; accepted 21 June 2007
Abstract Seventy-five house mice (Mus musculus), 103 rats (Rattus norvegicus) and 55 field mice (Apodemus sylvaticus) from NorthWest Italy were PCR analysed for Neospora caninum infection. Brain, kidney and muscle tissues collected from the above mentioned animals were tested by PCR using Np6 and Np21 primers. The brain tissue from 2 house mice and 2 rats, the kidney from 4 rats, 1 house mouse and 1 field mouse and muscle from 10 rats, 8 house mice and 1 field mouse were tested positive for N. caninum. Sequencing showed a 96–97% identity of PCR products with N. caninum NC1 sequence. Our findings support previous report on house mouse and rat, and for the first time, provides the evidence of the infection also in field mice. Based on our data, it could be hypothesized that mice can act as a reservoir of N. caninum, and they can play a role in maintaining/spreading N. caninum infection also in the sylvatic cycle. The possibility that dogs could be infected by eating infected house mice suggests new opportunities for N. caninum prophylaxis and control. # 2007 Elsevier B.V. All rights reserved. Keywords: Neospora caninum; House mouse; Rat; Field mouse; PCR; Intermediate host
Neospora caninum is a protozoan parasite of dog and livestock recognised for the first time in 1988 (Dubey et al., 1988). In cattle N. caninum infection was recognized for the first time in 1989 (Thilsted and Dubey, 1989) and it is actually reported as a primary abortion pathogen in cattle herds worldwide (Dubey, 2003). The cycle has been only recently clarified with dog (McAllister et al., 2000; Lindsay et al., 1999) and coyote (Canis latrans) (Gondim et al., 2004) as known definitive host, and cattle or other species as the intermediate host. Cattle can be vertically infected, but also horizontal, point-source transmission, due to oocystis elimination by dogs, can occur (McAllister
* Corresponding author. Tel.: +39 011 6709002; fax: +39 011 6709000. E-mail address: [email protected] (E. Ferroglio). 0304-4017/$ – see front matter # 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2007.06.031
et al., 2000). Dogs eliminate oocystis in faeces after ingestion of experimentally infected mice, but apart from vertical transmission, the main source of infection for dogs has been considered aborted foetal fluids or placental material (Dijskstra et al., 2002). The life cycle of protozoa (family Sarcocystidae) closely related to N. caninum is a predator-prey type, with carnivorous that shed oocysts in the faeces after consumption of tissue cysts in intermediate host, which became infected by ingestion of oocysts (Current et al., 1990). The possibility that small mammals could act as a potential reservoir of infection has been suggested by Wouda et al. (1999), and has been recently demonstrated in rat (Rattus norvegicus) and house mice (Mus musculus) from Taiwan (Huang et al., 2004), U.K. (Huges et al., 2006) and United States (Jenkins et al., 2007). Considering that no data are available on the presence of N. caninum in feral rodents in continental Europe and
E. Ferroglio et al. / Veterinary Parasitology 148 (2007) 346–349
in field mice (Apodemus sylvaticus), we deemed it interesting to evaluate, by means of PCR, the presence of infection in house mice, field mice and rats from Piedmont (North-West Italy). In this region previous studies have evidenced the presence of N. caninum infection in both domestic and wild animals (Ferroglio and Rossi, 2001; Ferroglio et al., 2001, 2005, 2007; Ferroglio and Trisciuoglio, 2003). Seventy-five house mice (M. musculus), 103 rats (R. norvegicus) and 55 field mice (A. sylvaticus) were captured with snap traps as part of pest control program around cattle farms in Piedmont with a previous history of abortion due to N. caninum (North-West Italy, 44.58N; 7.58E). Captured rodents were dissected under clean laboratory conditions with sterile scalpels, one for each animal and tissue, in order to avoid cross contaminations. Liddel et al. (1999) reported that the predominant site of infection in experimentally infected mice was the brain and previous reports on wild rodents (Huang et al., 2004; Huges et al., 2006; Jenkins et al., 2007) exanimate only the brain of captured animals. However, a lot of reports showed N. caninum presence in other tissues such as lung, skeletal muscles, heart and kidney (Barber et al., 1996; Ho et al., 1997; Wyss et al., 2000; Peters et al., 2000, 2001; Dubey et al., 2004; Basso et al., 2005; McInnes et al., 2006). So, we collected brain, kidney and skeletal muscle (gluteal muscle) from captured rodents and samples were immediately frozen in single vials at 20 8C. DNA extraction was performed from 25 mg of brain, kidney and gluteal muscle tissue of sampled animals, using the Gen EluteTM Mammalian genomic DNA extraction kit (Sigma–Aldrich, St. Louis, MO, USA) according to manufacturer’s protocol. DNA extracted from cultured N. caninum (NC1) tachyzoites was used as a positive control for the PCR reaction. The used primers were Np6 plus (50 CTCGCCAGTCAACCTACGTCTTCT30 ) and Np21 plus (50 CCCAGTGCGTCCAATCCTGTAAC30 ), as suggested by Muller et al. (1996). DNA amplification was performed in 50 ml reaction mix, containing 8 ml of DNA extract (approximately 50 ng of DNA), 0.5 mM each primer and 25 ml of RedTaqTM Ready MixTM PCR Reaction Mix (Sigma–Aldrich, St. Louis, MO, USA). Amplifications were carried out in a Bio-Rad iCycler thermal cycler. Samples were initially denaturated at 94 8C for 1 min, then submitted to 40 amplification cycles at a denaturing temperature of 94 8C for 1 min, an annealing temperature of 63 8C for 1 min, and an extension temperature of 74 8C for 3 min. A final extension step of 72 8C for 10 min was performed. After amplification, 10 ml aliquots from each reaction were analysed by
347
electrophoresis on 2% agarose gel, in comparison with molecular weight markers (DNA Molecular Weight Marker V, Roche Diagnostics, Mannheim, Germany; PCR 100 bp Low Ladder, Sigma–Aldrich, St. Louis, MO, USA). Gels were stained with MegaFluor kit (Euroclone, Milano, Italy) under the conditions suggested by the manufacturer and photographed on a 254 nm UV transilluminator using a CCD Camera (Gel-Doc Bio-Rad). Positive controls (DNA extracted from N. caninum NC1 culture) and negative controls (distilled water) were included in each step (extraction, amplification and electrophoresis run). Samples were considered positive when a 337 bp specific Np6–Np21 product (Muller et al., 1996) was present (Fig. 1). Fourteen rats (13.6%), nine house mice (13.8%) and two field mice (3.6%) were positive for N. caninum. In detail, PCR positives were found from the brain tissue of 2 house mice and 2 rats, from the kidney of 4 rats, 1 house mouse and 1 field mouse and from skeletal muscle of 10 rats, 8 house mice and 1 field mouse. The two brain positive mice were positive also in muscle, but negative in kidney, while the brain samples from the two positive rat were negative in both kidney and muscle tissues. Fifteen animals tested positive only in muscle (eight rats and five mice), four only in kidney (two rats, one house and one field mouse) and two rats were positive in both muscle and kidney tissues. Two amplicons from rats, one from house mouse and one from field mouse were cloned using the Quiagen PCR CloningPlus kit and sequenced by BMR Genomics, University of Padova (Accession nos. are: EF202081, EF202080, EF202082 and EF202079,
Fig. 1. Agarose gel electrophoresis of PCR products (Np6 plus and Np21 plus primers) from muscle in a rat captured from farm with a previous history of abortion attributable to Neospora caninum (lane 2), from brain in a house mouse (lane 3) and from kidney in a field mouse (lane 4). Positive control DNA prepared from cultured N. caninum NC1 (lane 6) and negative control (distilled water, lane 9 and reagents used for DNA extraction, lane 8). Lane 1 represents PCR 100 bp Low Ladder marker (Sigma–Aldrich, St. Louis, MO, USA). Lanes 5 and 7 represent negative samples. Note the specific amplification products of 337 bp in lanes 2–4 and 6, corresponding to muscle of a rat, brain of a house mouse, kidney of a field mouse and to the positive control.
348
E. Ferroglio et al. / Veterinary Parasitology 148 (2007) 346–349
respectively). The obtained sequences showed a 97% (EF202082, EF202080) and a 96% (EF202081, EF202079) homology with the published N. caninum NC5 sequence (Accession no. X84238). To the best of our knowledge this is the first report of N. caninum infection in field mice. Our results evidenced around farms with an history of N. caninum abortion a percentage of N. caninum infected wild rodents of about 14% in rat and house mice, while field mice showed a lower prevalence (3.6%). The lower prevalence in field mice, compared to both house mice and rat, can be due to their different diet which, in the studied area, is mainly based on seeds with a low proportion of animal component (Canova and Fasola, 1993). Moreover, house mice and rat cohabit with domestic animals and can more easily ingest oocysts eliminated by dogs or infected cattle tissues (i.e. foetuses, foetal fluids or placental material). The prevalences found in our research are greater than the ones reported by Huang et al. (2004) and Huges et al. (2006), but comparable, or lower in rat, to results obtained by Jenkins et al. (2007). The high prevalence obtained may be explained by the fact that we have tested also kidney and muscles tissue. In fact 21 out of 25 animals were brain tissue negative at PCR. Of these, 15 animals tested positive only in muscle, 4 only in kidney and 2 in both tissues. Considering only brain tissue positive rodents we found 4 positive animals, in spite of 25, and our data will be in the range reported, analysing only CNS tissue, by Huang et al. (2004) and Huges et al. (2006). The presence of cysts or N. caninum DNA in tissues other than the CNS has been reported by many authors (Barber et al., 1996; Peters et al., 2000, 2001; Dubey et al., 2004; Basso et al., 2005; McInnes et al., 2006). Peters et al. (2001) evidenced that in dog and cattle N. caninum tissue cysts can be found not only in neural tissues, but also in skeletal muscles and this finding has been confirmed in intermediate host by other authors (Ho et al., 1997; Wyss et al., 2000). Dogs’ role in cattle neosporosis has been highlighted also by seroepidemiological studies (Pare´ et al., 1998; Wouda et al., 1999) and the importance to avoid contamination of cattle feed by oocysts shed by dogs has been discussed by McAllister et al. (2000). Seroprevalence to N. caninum was usually higher in dogs living in farms than in dogs living in urban areas (Sawada et al., 1998; Wouda et al., 1999), and this was confirmed also in the area where the present study has been carried out (Ferroglio et al., 2007). Even if the most common source of infection in dogs still needs to be determined, it is suggested that dogs acquire
infection from cattle by ingesting placenta or foetal tissues and fluids (McAllister, 1999; Dijskstra et al., 2001, 2002). However, Bergeron et al. (2001) showed that the transmission of N. caninum infection to dogs by feeding them with naturally infected bovine foetuses did not occur. Amongst experimental animals, mouse is a known intermediate host for N. caninum and vertical transmission has been demonstrated in laboratory in this species in both acute and chronic infection (Omata et al., 2004). In a study, up to 100% of pups per litter could be vertically infected (Liddel et al., 1999). Considering that in experimental trial the consumption of infected mice lead to the elimination of oocysts in dogs’ faeces (McAllister et al., 1998; Lindsay et al., 1999) and that dogs are frequently reported to eat rodents in farms, the risk that rodent could be a source of infection for dogs, which can subsequently infect cattle by oocysts shedding, must be evaluated. Even if further studies are needed to clarify the epidemiological role of wild rodents in the N. caninum cycle, we hypothesize that mice and rats can act as a source of infection and can play a role in maintaining/ spreading N. caninum infection in both domestic and sylvatic cycles. The possibility that dogs acquire infection by consumption of N. caninum infected wild rodents suggests new opportunities for N. caninum prophylaxis and control. Acknowledgements This study was supported by the Faculty of Veterinary Medicine, University of Turin (Fondi Ricerca Locale ex 60%) and by the Ministero Istruzione, Universita` e Ricerca, MIUR (PRIN 2005). References Barber, J.S., Payne-Johnson, C.E., Trees, A.J., 1996. Distribution of Neospora caninum within the central nervous system and other tissues of six dogs with clinical neosporosis. J. Small Anim. Pract. 37, 568–574. Basso, W., Venturini, M.C., Bacigalupe, D., Kienast, M., Unzaga, J.M., Larsen, A., Machuca, M., Venturini, L., 2005. Confirmed clinical Neospora caninum infection in a boxer puppy from Argentina. Vet. Parasitol. 131, 299–303. Bergeron, N., Fecteau, G., Villenueve, A., Girard, C., Pare´, J., 2001. Failure of dogs to shed oocysts after being fed bovine foetuses naturally infected by Neospora caninum. Vet. Parasitol. 97, 145– 152. Canova, L., Fasola, M., 1993. Food-habits and trophic relationships of small mammals in six habitats of the northern Po plain (Italy). Mammalia 57, 188–199.
E. Ferroglio et al. / Veterinary Parasitology 148 (2007) 346–349 Current, W.L., Upton, S.J., Long, P.L., 1990. Taxonomy and life cycles. In: Long, P.L. (Ed.), Coccidiosis of Man and Domestic Animals. CRC Press, Boca Raton, pp. 1–16. Dijskstra, T., Eysker, M., Schares, G., Conraths, F.J., Wouda, W., Barkema, H.W., 2001. Dogs shed Neospora caninum oocysts after ingestion of naturally infected bovine placenta, but not after ingestion of colostrum spiked with Neospora caninum tachyzoites. Int. J. Parasitol. 31, 747–752. Dijskstra, T., Barkema, H.W., Eysker, M., Hesselink, J.W., Wouda, W., 2002. Natural transmission routes of Neospora caninum between farm dogs and cattle. Vet. Parasitol. 105, 99–104. Dubey, J.P., 2003. Neosporosis in cattle. J. Parasitol. 89, 42–56. Dubey, J.P., Carpenter, J.L., Speer, C.A., Topper, M.J., Uggla, A., 1988. Newly recognized fatal protozoan disease of dogs. J. Am. Vet. Med. Assoc. 192, 1269–1285. Dubey, J.P., Sreekumar, C., Knickman, E., Miska, K.B., Vianna, M.C., Kwok, O.C., Hill, D.E., Jenkins, M.C., Lindsay, D.S., Greene, C.E., 2004. Biologic, morphologic, and molecular characterisation of Neospora caninum isolates from littermate dogs. Int. J. Parasitol. 34, 1157–1167. Ferroglio, E., Rossi, L., 2001. Prevalence of Neospora caninum antibodies in wild ruminants from the Italian Alps. Vet. Rec. 148, 754–755. Ferroglio, E., Trisciuoglio, A., 2003. Antibodies to Neospora caninum in European brown hare (Lepus europaeus). Vet. Parasitol. 115, 75–78. Ferroglio, E., Bassano, B., Trisciuoglio, A., Rossi, L., 2001. Antibodies to Neospora caninum in Alpine ibex from the Italian Alps. Zeitsch. Jagdwissen. 47, 226–228. Ferroglio, E., Guiso, P., Pasino, M., Accossato, A., Trisciuoglio, A., 2005. Antibodies to Neospora caninum in stray cats from north Italy. Vet. Parasitol. 131, 31–34. Ferroglio, E., Pasino, M., Ronco, F., Bena`, A., Trisciuoglio, A., 2007. Seroprevalence of antibodies to Neospora caninum in urban and rural dogs in north-west Italy. Zoonoses Public Health 54, 135–139. Gondim, L.F., McAllister, M.M., Pitt, W.C., Zemlicka, D.E., 2004. Coyotes (Canis latrans) are definitive hosts of Neospora caninum. Int. J. Parasitol. 34, 159–161. Ho, M.S., Barr, B.C., Rowe, J.D., Anderson, M.L., Sverlow, K.W., Packham, A., Marsh, A.E., Conrad, P.A., 1997. Detection of Neospora sp. from infected bovine tissues by PCR and probe hybridization. J. Parasitol. 83, 508–514. Huang, C.C., Yang, C.H., Watanabe, Y., Liao, Y.K., Ooi, H.K., 2004. Finding of Neospora caninum in the wild brown rat (Rattus norvegicus). Vet. Res. 35, 283–290. Huges, J.M., Williams, R.H., Morlet, E.K., Cook, D.A.N., Terry, R.S., Murphy, R.G., Smith, E., Hide, G., 2006. The prevalence of Neospora caninum and co-infection with Toxoplasma gondii by PCR analysis in naturally occurring mammal populations. Parasitology 132, 29–36. Jenkins, M.C., Parker, C., Hill, D., Pinckney, R.D., Dyer, R., Dubey, J.P., 2007. Neospora caninum detected in feral rodents. Vet. Parasitol. 143, 161–165.
349
Liddel, S., Jenkins, M.C., Dubey, J.P., 1999. Vertical transmission of Neospora caninum in BALB/c mice determined by polymerase chain reaction detection. J. Parasitol. 85, 550–555. Lindsay, D.S., Dubey, J.P., Duncan, R.B., 1999. Confirmation that the dog is a definitive host for Neospora caninum. Vet. Parasitol. 82, 327–333. McAllister, M.M., Dubey, J.P., Lindsay, D.S., Jolley, W.R., Wills, R.A., McGuire, A.M., 1998. Dogs are definitive hosts of Neospora caninum. Int. J. Parasitol. 28, 1473–1478. McAllister, M.M., 1999. Uncovering the biology and epidemiology of Neospora caninum. Parasitol. Today 15, 216–217. McAllister, M.M., Bio¨rkman, C., Anderson-Sprecher, R., Rogers, D.G., 2000. Evidence of point-source exposure to Neospora caninum and protective immunity in a herd of beef cows. J. Am. Vet. Med. Assoc. 217, 881–887. McInnes, L.M., Irwin, P., Palmer, D.G., Ryan, U.M., 2006. In vitro isolation and characterisation of the first canine Neospora caninum isolate in Australia. Vet. Parasitol. 137, 355–363. Muller, N., Zimmermann, V., Hentrich, B., Gottstein, B., 1996. Diagnosis of Neospora caninum and Toxoplasma gondii infection by PCR and DNA hybridization immunoassay. J. Clin. Microbiol. 34, 2850–2852. Omata, Y., Nidaira, M., Kano, R., Kopbayashi, Y., Koyama, T., Furuoka, H., Maeda, R., Matsui, T., Saito, A., 2004. Vertical transmission of Neospora caninum in BALB/c mice in both acute and chronic infection. Vet. Parasitol. 121, 323– 328. Pare´, J., Fecteau, G., Fortin, M., Marsolais, G., 1998. Seroepidemiological study of Neospora caninum in dairy herds. J. Am. Vet. Med. Assoc. 213, 1595–1598. Peters, M., Wagner, F., Schares, G., 2000. Canine neosporosis: clinical and pathological findings and first isolation of Neospora caninum in Germany. Parasitol. Res. 86, 1–7. Peters, M., Lutkefels, E., Heckeroth, A.R., Schares, G., 2001. Immunohistochemical and ultrastructural evidence for Neospora caninum tissue cysts in skeletal muscles of naturally infected dogs and cattle. Int. J. Parasitol. 31, 1144–1148. Sawada, M., Park, C., Kondo, H., Morita, T., Shimana, A., Yamane, I., Umenura, T., 1998. Serological survey of antibody to Neospora caninum in Japanese dogs. J. Vet. Med. Sci. 60, 853–854. Thilsted, J.P., Dubey, J.P., 1989. Neosporosis-like abortions in a herd of dairy cattle. J. Vet. Diagn. Invest. 1, 205–209. Wouda, W., Dijkstra, T., Kramer, A.M.H., van Maanen, C., Brinkhof, J.M.A., 1999. Seroepidemiological evidence for a relationship between Neospora caninum infections in dogs and cattle. Int. J. Parasitol. 29, 1677–1682. Wyss, R., Sager, W.R., Muller, N., Inderbitzin, F., Konig, M., Audige, L., Gottstein, B., 2000. Untersuchungen zum Vorkommen von Toxoplasma gondii und Neospora caninum unter fleishhygienischen Aspekten. Schweiz. Arch. Tierheilkd. 142, 95–108.