Evidence that renal and chorionic tissues contain similar nuclear binding proteins that recognize the human renin promoter

Kidney International, VoL 50 (1996), pp. 1515—1524

Evidence that renal and chorionic tissues contain similar nuclear binding proteins that recognize the human renin promoter TADASHI KONOSHJTA,1 STEPHANE GERMAIN, JOSEYFE PHILIPPE, PIERRE CORVOL, and FLORENCE PINET INSERM Unit 36, College de France, Paris, France

Evidence that renal and chorionic tissues contain similar nuclear binding proteins that recognize the human renin promoter. This study examines whether the human renal cortex, the major renin producing site, contains nuclear factors that bind to the human renin proximal promoter.

Footprint analysis of the human renin promoter region showed that human renal cortex cell nuclear extracts interacted with 6 putative cis-elements (the Ets domain-protein, a Pit-i like binding site, a CRE sequence, an ARP-i like binding site, an AGE3 like region, and a unknown consensus region, designated element C). Transient DNA transfection studies on chorionic cells implicated the CRE and Pit-i consensus sites in the regulation of renin gene transcription by cAMP. Electromobility shift assays showed that renal proteins bind specifically to

these sequences, and that one of them is CREB; two others seem to be Ets-1 and ARP-1. These results raise the possibility that the human renal cortex and human chorionic cells have the same trans-acting factors that bind to the proximal human renin promoter.

have now examined the similarity between the transcription factors from chorionic and renal cells that bind to the human renin promoter in order to identify the proteins binding to the cis-acting sites. Kidney extracts were prepared from ischemic kidneys removed surgically for their very high renin secretion. The renin-producing cortex was then carefully dissected from the rest of kidney. Our results suggest that human renal cortex and chorionic cells have several trans-acting factors in common that specifically bind to the human renin promoter region at the same cis-regulatory elements and are probably involved in regulating the renin gene.

Methods Preparation of nuclear extracts of human renal cortex Renal cortex nuclear extracts were prepared essentially accord-

The renin-angiotensin system plays a major role in blood ing to Gorski, Carneiro and Shibler [101. The renal cortex was pressure regulation and electrolyte metabolism [1]. The first and rate limiting step in the production of angiotensin II, the conver-

sion of angiotensinogen to angiotensin I, is catalyzed by the aspartyl protease, renin (E. C. 3. 4. 23. 15), which is synthesized by

the renal juxtaglomerular (JG) cells. Since there is no established JG cell line, several cell lines of other origins have been used as models of renin-producing cells; one of this is human chorionic cell line [21. We have mapped six protein-binding sites in the proximal human renin promoter region (—336 to +16) by footprint analysis using human chorionic cell nuclear extracts [3]. These footprints all have similar consensus sequences for several known transcription factors, including the Ets-domain (—291—6) [4], Pit-i consensus binding site (—797—62) [5], CRE (—234/ —214) [6], ARP-i binding site (—2597—245) [71, AGE3 binding site (—2937—272) [81 and an unknown consensus region, designated element C (—1077—83). We have also demonstrated that the CRE and Pit-i consensus sites are implicated in the regulation of renin gene transcription by cAMP [9]. Lastly, we have shown that distinct Pit-i factors are present in chorionic and renal cortex cells, which both specifically bind to the renin Pit-I-like motif. We

Present address: Japan Advanced Institute of Science and Technology, 15 Asahidai, Tatsunokuchi, Ishikawa, 923-12, Japan.

carefully dissected from the rest of the kidney. All manipulaions

were carried out at 4°C. Minced kidney (10 to 20 g) was homogenized in 30 ml modified Schibler homogenization buffer (SHB) [10 mvt Hepes (pH 7.6), 15 mrvt KCI, 2 msi EDTA, 2.4 M sucrose, 0.5 mM DTT containing cocktail of inhibitors (0.15 mist spermine, 0.5 mM spermidine, 0.5 misi PMSF, 2 misi benzamidine,

5 sgIml aprotinin, 5 sg/ml pepstatin, 5 jig/mI leupeptin)] using a motor-driven Teflon-glass homogenizer. The homogenate was filtered through four layers of gauze, giving a final volume of 85 ml. This was layered (in three 27 ml aliquots) over three 10 ml cushion solutions (2 M sucrose, 10% glycerol, 0.5 mist DTT and the

same cocktail of inhibitors described above) in three tubes and centrifuged for 45 minutes at 24,000 rpm in a SW27 rotor at 0°C. The nuclear pellets were resuspended in 50 ml SHB/water (9:1 vol/vol). This suspension was layered onto 10 ml cushion solution

and centrifuged as before. Nuclear extracts were prepared from the pelleted nuclei by the method of Shapiro et a! [111. The protein concentration was determined according to Lowry et al [121, and the extracts were stored in liquid nitrogen. Preparation of extracts from Cos-1 tran,sfected cells

Extracts of Ets-i and ARP-l cells were prepared according to Kumar and Chambon [13]. Cos-i cells were maintained as stocks in Dulbecco's modified Eagle's medium supplemented with 10%

fetal calf serum. The cells at 50 to 60% confluence in 225

Received for publication April 17, 1996 and in revised form June 6, 1996 Accepted for publication June 10, 1996

cm2-flasks were transfected with 63 jig of Ets-i [14] or ARP-1 [15]

© 1996 by the International Society of Nephrology

pH 7.4, 1 mist EDTA, 0.15 M NaCI, collected by low speed

eDNA plasmid by calcium phosphate/DNA copreeipitation for forty hours [16]. The cells were then harvested in 40 mist Tris-HCI

1515

Konoshita et al: Renal nuclear proteins binding renin promoter

1516

Table 1. Sequences of the oligonueleotides used for EMSA _______________ ______________________________ OGAW Ets consensus GGAW —34 CACTGTATAAAAGGGGAAGGGCTAAGGGAGCCACAG Ets-REN GAGTOTATAAAAGG TTGACGGCTAAGGGAGCCACAG Ets-Mi Ets-M2 GAGTCTATAAAP.GGGGAAGGGCTAAGTTGCCACAG

Pit.! consensus

Electromobilily shift assays (EMSAs)

+2

ATGNATAAWT

Binding reactions for Ets-REN, Pit-1-REN, element C and

Pit-i .REN —88 CACGOTAATAAATCAGGGCAGAGCAGAATTGCA.AT

Pit-1-M! Pit-1-M2

CACGOCGGCAAATCAGCGCAGAGCACAATTGCAAT

CAGGGTAATGGCAGCGCAGAGCAGAATTGCAAT

Element C —!!6 GAGATTTATTGCTOACTGCCCTGCCATCTACCCCAG —80

CRE

TGACGTCA

CRE-REN —235 GAGGGCTGCTAGCGTCACTGGACACAAGATTGCTTT —199 CRE-SOM —68 CTGGGGGCGCCTCCTTGGCTGACGTCAGAGAGAGAG —32

CRE-MUT

GAGGGCTCCTAG TCGGAOTGGACACAAGATTGCTTT

ARP1

AGGGGTCANAGGGNTCA

ARPIREN —264 GCTCCAGGGGTCACAGGGCCAAGCCAGATAGAGGGC —228 ARPIMUT GCTCCAGGGCAGGGGTCCCGGGT1AGATAGAGGGC

AGE3

AGCTGTGCTTGT AGE3-REN —299 CCCTGAGCAGTGCTGTTTCTCATCAOCCTCTGC AGE3-MUT CCCTCGTTGATGCQ0TTTCTCATCAGCCTCTGC

_______________

Table I summarizes the sequences of each oligonucleotide used for EMSA. Double-stranded oligonucleotides were synthesized (Applied Biosystems) and end-labeled with [y-32P]ATP and T4 polynucleotide kinase.

—266

___________________

Bold face letters in renin sequence indicate homologies with the A + T, N = 0 + A + T + C.

consensus sequence. W =

centrifugation, and resuspended in 400 jil of a buffer containing 20 mist Tris-HC1, pH 7.4, 0.4 M KCI, 2 mist DTT, 10% glycerol. They were broken by freezing and thawing (3X), cell debris were removed by centrifugation (800 g for 10 mm) at 4°C, and the

supernatant (whole cell extract) was aliquoted and stored at —70°C.

DNase I footprinting assays

DNase I footprint analysis was performed as previously described [31 The —336 to +16 fragment of the human renin gene promoter was inserted in Bluescript. The synthetic DNA fragment corresponding to —336 to + 16 was obtained by PCR amplification

CRE-REN, was performed by incubating 3 jig human renal cortex nuclear extract or with I jil Cos-1 cell extract (for Ets-REN) with 20 fmole (about 20,000 cpm) end-labeled double-stranded oligonucleotides for 15 minutes at 4°C in 18 jil buffer containing 10 mivi Hepes (pH 7.8), 1 mist Na2HPO4 (pH 7.2), 0.1 mist EDTA, 50 mist KCI, 4 mist MgCI2, 4 mist spermidine, 2.5% glycerol, 0.75-2 jig

double-stranded poly(dl-dC) and 0 to 1 jig sonicated salmon sperm DNA. The specificity of the DNA/protein binding was determined by running the same binding reaction using different competitor oligonucleotides (homologous and heterologous; Table 1). The bound and free elements were separated by electrophoresis in 6% polyacrylamide gels in 22 mist Tris/borate/0.5 mM EDTA at 250 volt for two to three hours. ARP-1-REN, EMSA binding reactions was performed accord-

ing to Ladias et al [151 using 60 ni ARP-1 transfected Cos-1 extract, or 3 jig human renal cortex nuclear extract. These were incubated with 20 fmole (about 20,000 cpm) labeled oligonucleotide for 30 minutes at 4°C in 20 jil buffer containing 25 mM Hepes (pH 7.6), 8% Ficoll 400, 40 mist KCI, 1 mist DTF, 5 mM

MgCl2, 1 jig of double-stranded poly(dI-dC) with or without competitor oligonucleotides (Table 1). The components were separated by electrophoresis in denaturing 4% polyacrylamide gels run in 44 mist Tris/borate/1 mist EDTA at 10 volts/cm for two

to three hours. EMSA binding reactions for AGE3-REN [8] were performed by incubating 3 jig human renal cortex nuclear extract with 20 fmole (about 20,000 cpm) labeled oligonucleotide for 30 minutes at room temperature in 20 jil buffer [12 mist Hepes (pH 7.9), 60 mM KCI, 0.1 mist EDTA, 0.5 mist DTI, 0.5 mist PMSF, 12%

using the Bluescript SK and KS universal primers. The SK or KS glycerol and 0.5 jig of double-stranded poly(dI-dC) with or 32 primer were labeled with [y- PIATP and T4 polynucleotide without competitor oligonucleotides]. The components were sepkinase before PCR amplification. Footprint analysis was per- arated by electrophoresis in non-denaturing 5% polyacrylamide formed in a 10 jil reaction mixture containing 4 mist MgCI2 4 mM gels run in 88 mist Tris/borate/2 mist EDTA at 140 volts for three spermidine, 10 mist Hepes (pH 7.9), 50 mist KCI, 0.1 mist EDTA, hours. 0.1 mM EGTA, 2.5% glycerol, 0.5 jig of double-stranded poly(dlWestern blot analysis dC), 30 jig of nuclear extract, and 15,000 cpm of end-labeled Purified CREB (provided by Dr. G. Schutz, Heidelberg, Gerfragment. Samples were incubated for 20 minutes at 4°C, and digested with 2 jil DNase I (Boehringer Mannheim, 10 lU/mi; many) and nuclear extracts from human chorionic and kidney various dilutions) for one minute at 20°C. The reaction was cells were analyzed by SDS-PAGE followed by Western blotting. stopped by adding 30 jil stop solution (50 mist EDTA, 0.1% SDS, SDS-PAGE was carried out on a 7.5% polyacrylamide gel [171.

0.2 mg/mI yeast tRNA, and 10 mg/mI proteinase K) and incubated The clectrophoresed proteins were transferred to a polyvinylidene

for 45 minutes at 42°C. DNA was extracted once with phenol/ difluoride membrane (Immobilon P, Millipore) and the memchloroform, precipitated with 2 volumes of ethanol, resuspended brane was incubated for one hour in 50 mist Tris buffer (pH 8), in 98% formamide dye and electrophoresed on a 6% acrylamide/7 containing 150 mM NaCI, 0.05% Tween 20 and 5% skim milk powder, and then for one hour at room temperature with 244 M urea sequencing gel.

Fig. 1. DNase I Jbotprinting assays of the 5'-proximal region of the human renin gene (—336 to + 16) with human kidney cortex nuclear extracts. A. From + 11 to - 160 nucleotides. B. From —180 to —364 nuclcotides. Lanes I to 3 represent reactions performed without nuclear extracts —)J hut with 0.1 U, 0.05 U and 0025 U of DNase 1; lanes 4 to 6 represent reaction performed with 30 jig nuclear extracts [NE(+)] and decreasing amounts of DNase

1(1 U, 0.5 U and 0.25 U). Protected regions are indicated on the right of the figure. Panel C shows the sequences of the DNase I protected regions of the human renin promoter in the presence of human kidney cortex cell extract. C, T, A and G are the sequencing ladder.

1517

Konoshita et at: Renal nuclear proteins binding renin promoter

C

Pit!

!I.I

I

II I

I

dSVI

I

I

I

I

I

.

I

11111

1151

'spIt'.,.,-

wr"1n II INd

4 I.

1111111

III, lilt , pI Il'iil III I III Iii Ilu I N IS

ii Mlii

mi IIIill

-r asia nfl UtSilt Utile!

U

L-

I-

C

0

'—

rnrmui

'3

now

sill II I

I I

I

S

I

I

I

II

SI

SI

I

III,

I

-364 GGGGITGGGTCTGGGCTAGGGAGCTGGAAACCTAGGTmACGC1-TGTCCCAGTT-1-1-GAT

AGE3 A9P-1 -304 GTTAGCCCTGGCAGTGcTG1TrCTCATCAGCqrCTGCCTGCTCqAGGGGTCACAGGGCq

-244 AAGCCAGATAGAGGTGCTAG9CACTGGACACAGAUGCTT-TCCCACAGCTGTCCT - I 84 TCCTCCAGCCCCTCTGCTCCCCATCCGGAAACCTGGGTACCCUCACCCACCTAGCTCTG -124

-64 CAGAGCAGAAUGCAATCACCCCATGCATGGAGTqTATAAAAGGGGGGGCTAAGGGp -4 CCACAGAACCTCAGTGGATC +1

1518

Konoshita ci al: Renal nuclear proteins binding renin promoter

antiserum (diluted 1:250; provided by Dr. M. Montminy, La Jolla,

Extracts

-

Renal cortex

CA, USA). The 244 antiserum was raised against a synthetic peptide 126- 162 of the CREB protein 1181. The subsequent steps

were carried out with the biotin-streptavidin kit (Biorad), as

Competitor

- Element C CRE-REN I

recommended by the manufacturer.

0 Li)

00 I I 0 00

I

Li)

S • •S •x Sx x

Results Footprint analysis of the human renin promoter using nuclear

><

extracts of kidney cortex cells

The similarity between the renal cortex and chorionic cell binding proteins was examined by the DNase I footprinting assay, using human kidney cortex cell nuclear extracts and the promoter sequence spanning —336 to +16. The same six protected regions found in human chorionic cell nuclear extracts [3] were identified (Fig. 1). The first footprint comprised sequences from —29 to —6

——

and contained a central purine rich sequence (GGAA) that is a conserved recognition site for Ets-domain proteins [4]. The

—a

second footprint (—77 to —63) was similar to the Pit-I binding site

consensus sequence (ATGNATAAWT) [5]. The third footprint (—123 to —86) was not homologous to any described regulatory elements. The fourth footprint (—229 to —209) was very similar to the CRE (TGACGTCA) [6]. The footprint 5 (—259 to —245)

was similar to the binding site for ARP-1 (AGGGGTCAAGGGNTCA) [71. Footprint 6 (—294 to —272) was very similar (75%) to the sequence AGE3 (AGCTGTGCTTGT) described by Tamura et al [81 in the human angiotensinogen gene. The specificity of the interactions between the nuclear proteins

.

and the binding sites determined by footprint analysis were assessed by EMSAs using the oligonucleotides listed in Table 1. Binding of renal cortex nuclear extracts at the C element of the human renin promoter

The binding of renal cortex proteins to the human renin promoter element C was measured by EMSA using a doublestranded oligonucleotide element C (—116 to —80) as the probe. One of the two DNA/protein complexes revealed was specific, as

shown by competition experiments using excess homologous Fig. 2. Electromobility shift assay of human kidney cortex nuclear extracts unlabeled DNA (Element C); even a 100-fold excess did not with the human renin promoter (Element C: —116 GAGA TTTA TTGCTcompete for the entire binding. Formation of this complex was not

GACTGCCCTGCCATCTACCCCAG -80). A double-stranded oligonucle-

blocked by non-specific unlabeled DNA (CRE-REN) (Fig. 2).

otide containing element C was used as the probe. Competitions were

These results suggest that renal protein(s) form a specific complex with the human renin sequence corresponding to the element C. Binding of renal cortex nuclear extracts at the AGE3-like sequence

performed with homologous DNA (Element C) or with non-specific compet-

itor oligonucleotide (CRE-REN: —234 GAGATVI7AfF(KTGAD'GCCCTGCCATCTACCCCAG -80). Arrow indicates the specific DNA/protein complex. The molar excess (x-fold) of each competitor sequence is indicated.

in the human renin promoter The binding of renal cortex proteins to the AGE3-like region in

the human renin promoter was examined by EMSA using a labeled double-stranded oligonucleotide AGE3-REN (—299 to —266) containing the renin AGE3-like sequence as probe. One specific DNA/protein complex was formed, and its formation was completely blocked by the homologous unlabeled probe (AGE3REN). But the complex was still formed in the presence of box

The renal proteins binding to the human renin CRE and Pit-I-like motif Two specific high affinity DNA/protein complexes are formed

between the CRE-REN and the proteins in kidney extracts [9].

excess of unlabeled probe (AGE3-MUT) (Fig. 3). Thus, the AGE3-like sequence of the human renin promoter may form a

These two complexes, similar to those observed with chorionic cell nuclear extracts [31 represent sequence-specific interactions, as shown by competition experiments using excess unlabeled CREREN. Supershift experiments [91 using anti-CREB serum 244 dem-

specific complex with renal proteins.

onstrated that CREB from renal and chorionic cells binds to the

1519

Konoshita et a!: Renal nuclear proteins binding renin promoter

Renal cortex

Extracts

Competitor

AGE3-REN AGE3-MUT I

00

0 U,

II

><

• a. be

-

0U)

00

><

•

2 97.4 —

— 97.4

66 —

—66

S

45

4

1 5O.25

—

'S

31 —

—45

—31

Fig. 4. Western blot analysis of human chorionic cell and kidney cortex nuclear extracts. The samples applied are shown at the top; 25 ng purified CREB (lane 1), 2 pg and I pg of kidney cortex (lanes 2 and 3) and 1, 0.5

and 0.25 pg of chorionic cells (lanes 4 to 6) nuclear extracts are also indicated. Molecular weight of standard proteins are indicated in each margin. CREB antiserum 244 was used diluted 1:250.

molecular weight (42 kDa) as purified CREB. The other bands revealed with higher concentrations of nuclear extracts were nonspecific binding of the antibody raised against a synthetic peptide. This result, combined with EMSA competition experiments, indicates that CREB binds to the CGTCA element of the human renin gene promoter. Previous EMSAs with kidney cortex nuclear extracts and a labeled oligonucleotide (—88 to —54) corresponding to the renin Pit-I site (Pit-1-REN) showed two specific DNA/protein complexes [91. Two mutations were used to test whether the nucleotides known to be important in the Pit-i consensus binding site were involved in the formation of the complexes. Mutation of the Pit-1-REN oligonucleotide to Pit-i-Mi (which corresponds to the Pit-i-1 of [91) eliminates its ability to compete for the DNA! protein complexes obtained with Pit-i-REN (Fig. 5). The same results were obtained with mutation of the other part of Pit-i consensus binding site (Pit-1-M2; Fig. 5). This second mutation has been already described by Sun et al [19], who found competition using GC cell extracts. Our studies with renal nuclear extracts showed that the entire motif TAATAAATCAG of the Pit-i consensus sequence in the human renin promoter is necessary for binding. Fig. 3. Electromobility shift assay of human kidney cortex nuclear extracts with the human renin promoter (AGE3-REN: —299 CCCTGAGCAGT-

GCTGTTTCTAT(/AGCCTCTGC --266). A double-stranded oligonucleotide containing the renin AGE3-like site (AGE3-REN) was used as the probe. Competitions were performed with homologous DNA (AGE3REN), or with a mutated consensus site oligonucleotide (AGE3-MUT: -299 CCCTGGTTGATGCGITI'CTCATCAGCCTCTGC -266). Arrow indicates the specific DNA/protein complex. The molar excess of of each competitor sequence is indicated.

Binding of kidney cortex cell nuclear extracts to the Ets protein recognition site of the human renin promoter

The renal proteins binding to the human renin Ets site were identified by EMSA using a labeled double-stranded oligonucleotide Ets-REN (—34 to +12) corresponding to the renin Ets site. Two specific high-affinity DNA/protein complexes were formed,

and their formation could be blocked by excess homologous

unlabeled Ets-REN. The DNA sequence involved in binding was identified by competition experiments with mutated Ets binding

CGTCA element of the human renin promoter. Western blot site oligonucleotides (Ets-Mi and Ets-M2). Ets-REN contains analyses were carried out to identify the protein binding to the two GGA, one of which were changed to ITO in Ets-MI and the human renin CRE (Fig. 4). The major kidney cortex or chorionic

other in Ets-M2 oligonucleotides (Table 1). As shown in Figure 6,

cell proteins revealed by the anti-CREB serum, had the same 50- to 200-fold molar excesses unlabeled Ets-Mi or Ets-M2 did

1520

Konoshita et al: Renal nuclear proteins binding renin promoter

Extracts

-

Renal cortex

Pit-i-Mi

Pit-i -REN

Competitor

.CJ

><

Pit-i-M2

I,

U)U)0 0000C'JU)U) 0 00 00C\l U) U) 0 00 0 0 x >< xx >(

I

('.1

><

>

><

•A—a———a

• — sa • S 4

a

i:r firsa' —

a

Fig. 5. Electromobilily shift assay of human kidney cortex nuclear extracts with the human renin promoter 'Pit-1-REN: —88 cAGGGTAATAAAT-

CAGGGCAGAGCAGAATTGCAAT —54). A double-stranded oligonucleotide containing the renin Pit-i binding consensus site (Pit-1-REN) was used as the probe. Competitions were performed with homologous DNA (Pit-1-REN) or with mutated consensus site oligonucleotides (Pit-i-Mi: —88 CAGGGCGGCAAATCAGGGCAGAGCAGAATTGCAAT -54 and Pit-i -M2: -54 CAGGGTAATGGGCCAGGGCAGAGCAGAATFGCAAT —54). Arrows indicate the specific DNA/protein complexes. The molar excess of each competitor sequence is indicated.

not block the complex formation, showing that the two GGA are Binding of kidney cortex cell nuclear extracts to the ARP-1 binding involved in binding to the human renin promoter. consensus site of human renin promoter EMSAs were also run using the same labeled double-stranded oligonucleotide (Ets-REN) plus Ets-1 transfected Cos-1 cell exThe renal proteins binding to the human renin ARP-l site, were identified by EMSA using a labeled double-stranded oligonucletracts (Fig. 6). The same specific DNA/protein complexes were observed, and their formation was blocked by homologous probe, otide ARP-1-REN (—264 to —228). One specific DNA/protein but not by the two mutated oligonucleotides (Ets-MI and Ets- complex was formed, which was competitively inhibited by excess M2). Thus, these two DNA/protein complexes are specific for the unlabeled homologous probe, ARP-1-REN (Fig. 7). The specific-

renin Ets-1 domain protein recognition site-like sequence, as mutation of each GGA did not prevent binding. Comparison of the two EMSA experiments also suggests that renal cortex extracts contain Ets-1 protein(s), which bind(s) to the human renin promoter.

ity of binding was examined in experiments using the doublestranded oligonucleotide ARP-1-MUT, corresponding to the mu-

tation of ARP-i binding site and with CRE-REN, as nonhomologous probe. Neither probe prevented complex formation (Fig. 7).

Konoshita et al: Renal nuclear proteins binding renin promoter

Extracts

-

Renal cortex

Ets-1 UI

Competitor

- REN Ml M2 )<

)<

1521

)<

88888 REN

)<

><

II

Ml

>< X

II

M2

>( )<

-Fig. 6. Electromobility shift assay of Ets-] transfected Cos-1 cell extracts and human kidney cortex nuclear extracts with the human renin promoter (—34 to +2). A double-stranded

oligonucleotide containing the renin Ets protein recognition site like region (Ets-REN: —34 GAGTGTATAAAAGGGGAAGGGCTAAGGGAGCCACAG +2) was used as the probe. Competitions were performed with homologous DNA (Ets-REN) or with mutated consensus site oligonucleotides (Ets-Mi: —34 GAGTGTATAAAGGTTGAGGGCTAAGGGAGCCACAG +2 and Ets-M2: -34 GAGTGTATAAAAGGGGAAGGGCTAAGTTGGCCACAG +2). Arrows indicate the specific DNA/protein complexes. The molar excess of each competitor sequence is indicated.

Lastly, EMSA was performed using the labeled double- to determine whether that transcription factors in the kidney, which is the main site of renin synthesis, bind to the renin promoter elements identified using chorionic cells. Ischemic

stranded oligonucleotide (ARP-1-REN) with ARP-1 transfected Cos-1 cell extracts. The same specific DNA/protein complex was found, and its formation was blocked by the homologous probe, but not by the oligonucleotides, ARP-1-MUT and CRE-REN (Fig. 7). Hence, the DNA/protein complex observed with EMSA

is a specific interaction between the ARP-1 binding site likesequence in the human renin promoter and renal proteins.

human kidneys removed because of renovascular hypertension are considerably enriched in renin [211. Cortex cell nuclear extracts were prepared from these kidneys although the cell population is heterogeneous. These kidneys were chosen for their high renin content (between 0.5 to 15 jxg/g of tissue) compared to normal kidneys (1.6 ng/g of tissue). The limited number of JG

Discussion cells in the cortex (less than 1/100,000 of renal cells) prevented the The nuclear proteins binding the human renin promoter have preparation of JG cell nuclear extracts, and proteins from other not yet been examined using human JG cells because no suitable renal cells (endothelial, mesangial, proximal tubular, distal cells, culture model is available. Due to the very low capacity of etc.) may have bound to the human renin promoter. The overall goal of this study was to identify the cis-regulatory division, the only human JG cell line previously published [201 is not suitable to perform the present studies. Cells derived from elements and trans-activating factors involved in the expression of human chorion tissue have been used to study renin gene tran- the human renin gene using human kidney cortex nuclear extracts. scription despite the fact they are of extra-renal origin. Recent The first step was to determine whether the same transcription studies demonstrate that human chorionic cells are suitable for factors from human chorionic cells and kidney cortex cells bind to studying the transcriptional regulatory elements in renin gene the human renin proximal promoter. The renin promoter seexpression [3]. This model was also used to demonstrate that the quence spanning —336 to + 16 was subjected to DNase I footprint CRE and Pit-i consensus sites are implicated in the regulation of analysis and showed the same six footprints as with chorionic cell rcnin gene transcription by cAMP [9]. However, it was necessary nuclear extracts [3]. These putative cis-elements consist of an

1522

Extracts

Competitor

Konoshita et al: Renal nuclear proteins binding renin promoter

ARP-1

Renal cortex

888888 • esa ca •I

- NP-i MUT CRE -

888 X

)<

><

ARP-1

'-

>< )<

MUT

ii

p

><

>(

cJ

><

CRE

ii

)<

><

->
s_ •

• .•SfleSeeSee 0a'.e• Fig. 7. Electromobilily shift assay of ARP-1 transfected Cos-1 cell extracts and human kidney cortex nuclear extracts with the human renin promoter (—264 to —228). A double-stranded labeled oligonucleotide containing the renin ARP-1 binding site-like region (ARP-1-REN: -264 GCTCCAGGGGTCACAGGGCCAAGC-

CAGATAGAGGGC -228) was used as the probe. Competitions were performed with homologous DNA (ARP-1-REN), with a mutated consensus site oligonucleotide (ARP-1MUT: -264 GCrCCAGGGCAGGGGTCCCGGGTFCAGATAGAGGGC -228) or with a non-

As_ Ets-domain protein (—291—6) [4], a Pit-i-like binding site (—79/ —62) [5], a CRE sequence (—2341—214) [6], an ARP-l like binding site (—2591—245) [7], an AGE3 like region (—293/—272) [81, and an unknown region (— 107/—83), designated element C.

This study shows that nuclear proteins from the human kidney cortex hind to the human renin proximal promoter. The same sequences on the human renin promoter bind factors from both chorionic cells and human kidney cells. The proteins and their binding to the human renin promoter were characterized by EMSAs and the consensus site was determined by footprint analysis. The DNA sequence corresponding to the element C footprint is unlike any previously described regulatoTy element consensus sequence. Renal cortex nuclear extracts

formed a complex with the element C sequence, hut as no function for element C was found in chorionic cells [3], the nucleotides binding kidney proteins were not examined further. Footprint 6 (—294 to —272) is very similar to a sequence of the mouse angiotensinogen gene that binds the constitutive factor,

AGF-3 [8]. This factor could play an important role in the

specific oligonucleotide (CRE-REN: 1—235 GAGGGCITG(ITAGCGTCACTGGACACAAGATTGCFTT —199). Arrow indicates the specific DNA/protein complex. The molar excess of each competitor sequence is indicated.

differentiation-dependent promoter activation of the mouse angiotensinogen gene in adipocytes [22]. We have used transient DNA transfections of various renin/luciferase constructs in chorionic cells to demonstrate that an "AGF3-like" protein negatively regulates renin gene expression [3]. The present EMSA studies show that renal cortex nuclear proteins hind to this region. The same factor may interact with the renin and angiotensinogen gene promoters to regulate their expression reciprocally and hence play

an important role in regulating the entire renin-angiotensin system.

Ets domain proteins are proto-oncogenes and transcription

activators [14, 23—261. We have shown that the first 67 bp of the renin promoter are sufficient to direct expression in chorionic cells [31. This study now shows that renal cortex nuclear proteins bind

to this region and that both GGA nucleotides are important for the interactions. Thus, Ets-1 from both chorionie and renal cells hinds to the human renin gene promoter and positively regulates renin gene expression Our recent transient DNA transfection studies using chorionic

1523

Konoshita et al: Renal nuclear proteins binding renin promoter

cells show that full activation of renin gene transcription by cAMP

is due to interactions of trans-activating factors with the two binding sequences, the CRE and the Pit-I motif [9]. We showed that the migration patterns of the DNA/protein interactions with chorionic and kidney cortex cell extracts are similar, indicating that the CGTCA sequence motif is essential for the binding, as described by Fink et al [27]. The present study confirms the

Appendix The abbreviations used in this study are: Pit-I, pituitary-specific transacting factor; CRE, cAMP response element; CREB, cAMP response element binding protein; ARP-1, apoAl regulatory protein-i; EMSA, electromobility shift assay.

presence of immunoreactive CREB with the same molecular

References

weight (42 kDa) in both extracts. Both renal and chorionic CREB binds to the CRE element of the human renin promoter and play a role in renin regulation by cAMP. Pit-i is a member of the POU family of transcription factor that influence the proliferation of certain cells and their expression of

1. HACKENTI-IAL E, PAuL DG, TAUGNER R: Morphology, physiology and molecular biology. Physiol Rev 70:1067—1116, 1990 2. PINUT F, CORVOL M-T, BOURGUIGNON 1, CORVOL P: Isolation and

specific genes [28]. A Pit-I binding motif is involved in the

3. BORENSZTEIN P, GERMAIN S, FUCHS S, PtIILIPPE J, Couvot P, PINET F:

regulation of the human rerun gene in GC cells by cAMP [19] and in human chorionic cell [9]. Tamura et al [29, 30] demonstrated

that a nuclear factor in the Pit-I deficient cell line, the human embryonal kidney 293 cell, interacts with the RP-2 element whose

sequence is very similar to the Pit-i binding site [31]. We have shown that distinct nuclear proteins from both kidney cells and chorionic cells specifically bind to the renin Pit-i element [9], and that by several EMSA experiments the protein binding to this site is not Pit-i. The present results show that all the DNA sequence TAATAAAT is needed for binding of renal proteins, unlike the finding of Sun et al [19] for GC cells, who show that only the second part of the Pit-i consensus sequence is required. ARP-1 protein is a member of the orphan steroid receptor superfamily that inhibits expression of the apoAl gene [7]. Our previous DNA transfection experiments using chorionic cells suggested that the ARP-1 binding site-like region of the renin promoter negatively regulates reniri gene expression [3]. The present study indicates that renal proteins interacts specifically with the ARP-1 binding site. The same complex was formed with enriched ARP-1 nuclear extracts. In contrast to the findings of Horiuchi et al [32] with mouse kidney extracts, the interaction was

not blocked by an oligonucleotide containing the renin CRE (CRE-REN). This could be due to the different species of DNA involved. Our results suggest that renal cortex extracts contain ARP-i protein(s) that bind(s) to the human renin promoter. In conclusion, human renal cortex proteins interact with six putative cis-elements of the human renin promoter. One of them is CREB, two others seem to be Ets-1 and ARP-1, and one binds the Pit-i-like motif, but it is different from Pit-I. Thus the human renal cortex and chorionic cells both contain the same factors that bind to the proximal human renin promoter, showing that the chorionic cell line is a suitable model for studying the functionality

of the human renin promoter. Some of transcription factors described may be implicated in the tissue-specific expression of renin and in the regulation of its production in vivo. Ackiiowledgments We thank Dr. B. Wasylyk (INSERM U184) for Ets-i cDNA containing expression vector, Dr. J. Ladias (Harvard Medical School, Boston, MA, USA) for ARP-l eDNA containing expression vcctor, Dr. M. Montminy (The Salk Institute for Biological Studies, San Diego, CA, USA) for the

CREB antiserum, Dr. G. Schütz (Heidelberg University, Heidelberg, Germany) for purified CREB and Dr. 1. B. Michel (INSERM U367) for providing the human ischemic kidneys. The English text was corrected hy Dr. Owen Parkcs.

Reprint requests to Dr. Florence Pinet, INSERM Unit 36, France, 3 rue d'Ulm, 75005 Paris, France.

College

de

characterization of renin-producing human chorionic cells in culture. J Clin Endocrinol Metab 67:1211—1220, 1988

cis-regulatory elements and trans-acting factors directing basal and cAMP-stimulated human renin gene expression in chorionic cells. Circ Re,s 74:764—773, 1994

4. WASYLYK B, HAHN SL, GIOVANE A: The Ets family of transcription factors. Eur J Biochem 211:7—18, 1993 5. NELSON C, ALBERT VR, ELSHOLTZ HP, Lu LI-W, ROSENFELD MG:

Activation of cell-specific expression of rat growth hormone and prolactin genes by a common transcription factor. Science 239: 1400— 1405, 1988 6. MONTMINY MR, SEVARINO KA, WAGNER JA, MANDEL G, GOODMAN

RH: Identification of a cyclic-AMP-responsive element within the rat somatostatin gene. Proc NatlAcad Sci USA 83:6682—6686, 1986 7. LADIAS JAA, KARATHANASIS SK: Regulation of the apolipoprotein Al

gene by ARP-1, a novel member of the steroid receptor superfamily. Science 251:561—565, 1991 8. TAMURA K, TANIMOTO K, IsHli M, MURAKAMI K, FUKAMIZU A:

Proximal and core DNA elements are required for efficient angiotensinogen promoter activation during adipogenic differentiation.

J Biol Chem 268:15024—15032, 1993

9. GERMAIN S, KONOSHITA T, PHILIPPE J, CORVOL F, PINET F: Transcrip-

tional induction of the human renin gene by cAMP requires CREB and a factor binding a Pit-i motif. Biochem J 316:107—113, 1996 10. G0RsKI K, CARNEIRO M, SHIELER U: Tissue-specific in vitro transcrip-

tion from the mouse albumin promoter. Cell 47:767—776, 1986 Ii. SHAPIRO Di, SHARP PA, WAHI.I WW, KELLER M: A high efficiency Hela cell nuclear transcription extract. DNA 7:47—55, 1988 12. LOWRY 0, ROSEBROUGH N, FARR A, RANDALL R: Protein measurement with the folin phenol reagent. J Biol Chem 193:265—275, 1951 13. KUMAR V, CHAMB0N P: The estrogen receptor binds tightly to its responsive element as a ligand-induced homodimer. Cell 55:145—156, 1988 14. WASYLYK C, GUTMAN A, NICHOLSON R, WASYLYK B: The c-Ets

oncoprotein activates the stromelysin promoter through the same elements as several non-nuclear oncoproteins. EMBOJ 10:1127—1134, 1991 15. LADIAS JAA, HADZOPOULOU-CLADARAS M, KARDASSIS D, CARDOT P,

CHENG J, ZANNIS V, CLADARAS C: Transcriptional regulation of human apolipoprotein genes ApoB, ApoCIIT, and Ap0AII by mem-

bers of the steroid hormone receptor superfamily HNF-4, ARP-i, EAR-2, and EAR-3. J Biol Chem 267:15849—15860, 1992

16. GRAHAM F, VAN DER EB AJ: A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52:456—476, 1975 17. LAEMMLI UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680—685, 1970 18. HAGIWARA H, ALBERTS A, BRINDLE P, MEINKOTH J, JERAMISCO F, DUNG T, KARIN M, SHEN0I.IKAR S, MONTMINY M: Transcriptional

attenuation following eAMP induction requires PP-I mediated dephosphorylation of CREB. Cell 70:105—113, 1992 19. SUN J, ODDOUX C, LAZARUS A, GILBERT MT, CATANZAISO DF:

Promoter activity of human renin 5-flanking DNA sequences is activated by the pituitary-specific transcription factor Pit-I. J Biol Chem 268:1505—1508, 1993 20. PINET F, CoRvol. M-T, DENCH F, BOURGUIGNON J, FEUNTEUN J,

MENARD J, Covo. F: Isolation of renin producing human cells by transfection with three simian virus 40 mutants. Proc Nati Acad Sci USA 82:8505—8507, 1985

1524

Konoshita ci al: Renal nuclear proteins binding renin promoter

21. CAMILLERI J, Hn'ictis N, NOCHY D, PHA1 V, BARIETY J: Immunohistochemistry in human diseased kidney. Clin Exp Hypertens A5: 1179—1 190, 1983

RH: The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer. Proc IVatlAcad Sci USA 85:6662—6666, 1988

22. TAMURA K, UMEMURA S, Isi-in M, TANIMOTO K, MURAKAMI K,

28. HE X, TREACY MN, SIMMONS DM, INGRAHAM HA, SWANSON LW,

FuIc.MIzu A: Molecular mechanism of transcriptional activation of angiotensinogen gene by proximal promoter. J C/in Invest 93:1370—

ROSENFELD MG: Expression of a large family of POU-domain regu-

1379, 1994 23. WATSON DK, McwILLIAMs MJ, LAPI5 P, LAUTENBERGER JA,

SCHWEINFEST CW, PAPAS TS: Mammalian ets-l and ets-2 genes encode highly conserved proteins. Proc Nail Acad Sci USA 85:7862— 7866, 1988

latory genes in mammalian brain development. Nature 340:35—42, 1989 29. TAMURA K, UMEMURA S, YAMAGUCHI 5, IWAMOTO T, KOBAYASI-IJ 5,

FUKAMIZU A, MURAKAMI K, IsHli M: Mechanism of cAMP regulation

of rcnin gene transcription by proximal promoter. J Clin Invest 94:1959—1967, 1994

24. WASYLYK B, WASYLYK C, FLORES F, BEGUE A, LEPRINCE D, STEHELIN

30. TAMURA K, TANIMOTO K, MURAKAMI K, FUKAMIZU A: A combination

D: The c-ets proto-oncogenes encode transcription factors that coop-

of upstream and proximal elements is required for efficient expression

erate with c-Fos and c-Jun for transcriptional activation. Nature 346:191—193, 1990 25. LAMARCO K, THOMPSON CC, BYERS BP, WALTON EM, MCKNIGHT SL:

Identification of Ets- and Notch-related subunits in GA binding

protein. Science 253:789—792, 1991 26. AHE DVD, NISCHAN C, KUNZ C, OTTE J, KNIES U, ODERWALD H,

WASYLYK B: Ets transcription factor binding site is required for positive and TNFa-induced negative promoter regulation. NuclAcids Res 21:5636—5643, 1993 27. FINK JS, VERHAVE M, KASPER S, TSUKAOA T, MANDEL G, GOODMAN

of the mouse renin promoter in cultured cells. Nucl Acids Res 20:3617—3623, 1992 31. STEINFELDER H, RADONIK S, WONDISFORD F: Hormonal regulation of

the thyrotropin 13-subunit gene by phosphorylation of the pituitaryspecific transcription factor Pit-i. Proc Nail Acad Sci USA 89:5 942— 5945, 1992 32. FIORIUCHI M, PRATr R, NAKAMURA N, DZAU V: Distinct nuclear proteins competing for an overlapping sequence of cyclic adenosine

monophosphate and negative regulatory elements regulates tissuespecific mouse renin gene expression. J Clin In vest 92:1805—1811, 1993