Evidences of the cooperative role of the chemokines CCL3, CCL4 and CCL5 and its receptors CCR1+ and CCR5+ in RANKL+ cell migration throughout experimental periodontitis in mice

Bone 46 (2010) 1122–1130

Contents lists available at ScienceDirect

Bone j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / b o n e

Evidences of the cooperative role of the chemokines CCL3, CCL4 and CCL5 and its receptors CCR1+ and CCR5+ in RANKL+ cell migration throughout experimental periodontitis in mice Carlos Eduardo Repeke a, Samuel B. Ferreira Jr. a, Marcela Claudino a, Elcia Maria Silveira a, Gerson Francisco de Assis a, Mario Julio Avila-Campos b, João Santana Silva c, Gustavo Pompermaier Garlet a,⁎ a b c

Department of Biological Sciences, School of Dentistry of Bauru, São Paulo University, FOB/USP, Al. Octávio Pinheiro Brisola, 9-75-CEP 17012-901, Bauru, SP, Brazil Department of Microbiology, Institute of Biolomedical Sciences, São Paulo University, ICB/USP, Brazil Department of Biochemistry and Immunology, School of Medicine of Ribeirão Preto, São Paulo University, FMRP/USP, Brazil

a r t i c l e

i n f o

Article history: Received 20 July 2009 Revised 23 November 2009 Accepted 23 December 2009 Available online 4 January 2010 Edited by: R. Eastell Keywords: Chemokines Chemokine receptors Cytokines Bone resorption Periodontal disease

a b s t r a c t Periodontal disease (PD) is characterized by the inflammatory bone resorption in response to the bacterial challenge, in a host response that involves a series of chemokines supposed to control cell influx into periodontal tissues and determine disease outcome. In this study, we investigated the role of chemokines and its receptors in the immunoregulation of experimental PD in mice. Aggregatibacter actinomycetemcomitans-infected C57Bl/6 (WT) mice developed an intense inflammatory reaction and severe alveolar bone resorption, associated with a high expression of CCL3 and the migration of CCR5+, CCR1+ and RANKL+ cells to periodontal tissues. However, CCL3KO-infected mice developed a similar disease phenotype than WT strain, characterized by the similar expression of cytokines (TNF-α, IFN-γ and IL-10), osteoclastogenic factors (RANKL and OPG) and MMPs (MMP-1, MMP-2, MMP-3, TIMP-1 and TIMP-3), and similar patterns of CCR1+, CCR5+ and RANKL+ cell migration. The apparent lack of function for CCL3 is possible due the relative redundancy of chemokine system, since chemokines such as CCL4 and CCL5, which share the receptors CCR1 and CCR5 with CCL3, present a similar kinetics of expression than CCL3. Accordingly, CCL4 and CCL5 kinetics of expression after experimental periodontal infection remain unaltered regardless the presence/absence of CCL3. Conversely, the individual absence of CCR1 and CCR5 resulted in a decrease of leukocyte infiltration and alveolar bone loss. When CCR1 and CCR5 were simultaneously inhibited by met-RANTES treatment a significantly more effective attenuation of periodontitis progression was verified, associated with lower values of bone loss and decreased counts of leukocytes in periodontal tissues. Our results suggest that the absence of CCL3 does not affect the development of experimental PD in mice, probably due to the presence of homologous chemokines CCL4 and CCL5 that overcome the absence of this chemokine. In addition, our data demonstrate that the absence of chemokine receptors CCR1+ and CCR5+ attenuate of inflammatory bone resorption. Finally, our data shows data the simultaneous blockade of CCR1 and CCR5 with MetRANTEs presents a more pronounced effect in the arrest of disease progression, demonstrating the cooperative role of such receptors in the inflammatory bone resorption process throughout experimental PD. © 2009 Elsevier Inc. All rights reserved.

Introduction Periodontal diseases (PD) are chronic inflammatory diseases characterized by the inflammatory bone resorption of the teeth supporting structures, being the most prevalent form of bone pathology in humans and a modifying factor of the systemic health of patients [1,2]. Inflammatory immune reactions in response to periodontopathogens are thought to protect the host against the infectious agents, but the persistent release of inflammatory mediators

⁎ Corresponding author. Fax: +55 14 3235 8274. E-mail address: [email protected] (G.P. Garlet). 8756-3282/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.bone.2009.12.030

result in the destruction of soft and mineralized periodontal tissues [3,4]. Among inflammatory mediators present in diseased periodontium, chemokines, a family of chemotactic cytokines, have been implicated in PD pathogenesis [5]. The chemokine CCL3 (also called macrophage inflammatory protein-1α, MIP-1α) is considered the most abundantly expressed chemokine in diseased periodontium [4,6]. This chemokine is a ligand for the chemokine receptors CCR1 and CCR5, being primarily associated with the chemoattraction of monocytes/macrophages and dendritic cells (through the binding to CCR1), and lymphocytes polarized into Th1 phenotype (through CCR5) [7]. Therefore, since macrophages and Th1 cells are characteristic sources of bone resorptive cytokines such as TNF-α and IFN-γ [8–10], CCL3 has a

C.E. Repeke et al. / Bone 46 (2010) 1122–1130

potential role in the inflammatory bone resorption in periodontal environment. Indeed, CCL3 positive cells increase in number with increasing severity of periodontal disease [6] and are associated with augmented proportion of lymphocytes in inflamed tissues [4]. Furthermore, it is important to consider that CCR1+ and CCR5+ cell populations include osteoclast precursors from monocytic lineage and RANKL+ lymphocytes [11–14], which can directly upregulate bone resorption activity. In addition, besides its classic role as a chemoattractant, CCL3 acts directly in osteoclasts differentiation, but not activation, in vitro [15]. In fact, in inflammatory diseases such as rheumatoid arthritis (RA), which share with periodontitis features as the chronic inflammation associated with bone resorption, the lack of CCL3 or the treatment with an specific antagonist for CCR5 and CCR1 (named met-RANTES) resulted in a significant decrease in bone resorption [16]. Thereby, due to the increased CCL3 expression in diseased periodontal tissues, and its characteristics as a leukocyte chemoattractant and potential regulator of osteoclasts differentiation, CCL3 is potentially involved in the immunopathogenesis of PD. However, these putative roles remain unknown, and to clarify these questions, wild-type and CCL3 genetically deficient C57Bl/6 mice were infected with the periodontopathogen Aggregatibacter actinomycetemcomitans and comparatively evaluated regarding experimental PD outcome. Materials and methods Experimental groups Experimental groups comprised 8-week-old male wild-type (WT) C57BL/6 mice, and mice with targeted disruption of the CCL3 (CCL3KO), CCR5 (CCR5KO) and CCR1 (CCR1KO), bred in the animal facilities of FMRP/USP and maintained during the experimental period in the animal facilities of FOB/USP. Throughout the period of the study the mice were fed with sterile standard solid mice chow (Nuvital, Curitiba, PR, Brazil) and sterile water. Experimental groups comprised 8 to 12 mice, depending upon the analyses performed at each time-point (5 for both flow cytometry and alveolar bone loss measurement, 3 for RealTime-PCR analyses, and 4 for ELISA) as described previously [9]. The experimental protocol was approved by the local Institutional Committee for Animal Care and Use. Periodontal infection Bacterial culture and periodontal infection were performed as described previously [17]. In brief, the animals received an oral delivery of 1 × 109 colony-forming units (CFU) of a diluted culture of A. actinomycetemcomitans JP2 (grown anaerobically in supplemented agar medium, TSBV), in 100 μl of phosphate-buffered saline (PBS) with 2% of carboxymethylcellulose, placed in the oral cavity of mice with a micropipette. After 48 and 96 h, this procedure was repeated. Negative controls included sham-infected mice, which received PBS with carboxymethylcellulose in solution without A. actinomycetemcomitans, and non-infected animals. Isolation of inflammatory cells from periodontal tissues and flow cytometric analysis The isolation and characterization of leucocytes present in the lesion site were performed as described previously [9]. The whole buccal and palatal periodontal tissues of upper molars were collected, weighed and incubated for 1 h at 37 °C, dermal side down, in RPMI1640, supplemented with NaHCO3, penicillin/streptomycin/gentamycin and 0.28 Wunsch units/ml of liberase blendzyme CI (Roche-F. Hoffmann-La Roche Ltd, Basel, Switzerland). The tissues of five mice, at each time-point per group, were processed in the presence of 0·05% DNase (Sigma-Aldrich, Steinhein, Germany) using Medimachine (BD

1123

Biosciences PharMingen, San Diego, CA, USA), according to the manufacturer's instructions. After processing, cell viability was assessed by Trypan blue exclusion, and the cell count was performed in a Neubauer chamber. For immunofluorescence staining, after cell counting the cells were stained for 20 min at 4 °C with the optimal dilution of each antibody; phycoerythrin (PE)- and fluorescein isothiocyanate (FITC)-conjugated antibodies against CCR1 or CCR5 paired with anti CD3, F4/80, Gr1, CXCR3, CCR4, CCR8 or CCR2 antibodies, as well with respective isotype controls (BD Biosciences PharMingen). Cells were washed again and analyzed by flow cytometry (fluorescence activated cell sorter (FACScan) and CellQuest software (BD Biosciences PharMingen). Results represent the number of cells ± SD in the periodontal tissues of each mouse, normalized by the tissue weight, for two independent experiments. Quantification of alveolar bone loss Evaluation of the extent of alveolar bone loss was performed as described previously [9]. The maxillae were hemisected, exposed overnight in 3% hydrogen peroxide and defleshed mechanically. The palatal faces of the molars were photographed at 20× magnification using a dissecting microscope (Leica, Wetzlar, Germany), with the occlusal face of the molars positioned perpendicularly to the base. The images were digitized and analyzed using ImageTool 2·0 software (University of Texas Health Science Center, San Antonio, TX, USA). Quantitative analysis was used for the measurement of the area between the cement–enamel junction (CEJ) and the alveolar bone crest (ABC) in the three posterior teeth, in arbitrary units of area (AUA). At each time-point five animals were analyzed, and for each animal the alveolar bone loss was defined as the average of CEJ-ABC between the right and the left arch. Real-time PCR reactions The extraction of total RNA from periodontal tissues was performed with Trizol reagent following the protocol recommended by the manufacturer (Life Technologies, Rockville, MD, USA), and the complementary DNA was synthesized using 3 μg of RNA through a reverse transcription reaction (Superscript III, Invitrogen Corporation, Carlsbad, CA, USA). For the quantification of A. actinomycetemcomitans, DNA extraction from periodontal tissue samples was performed with DNA Purification System (Promega Biosciences Inc., San Luis Obispo, CA, USA), as described previously. Real-time PCR quantitative mRNA or DNA analyses were performed in ABI Prism 7000 Sequence Detection System (Applied Biosystems, Warrington, UK) using the SybrGreen system (Applied Biosystems, Warrington, UK). SybrGreen PCR MasterMix (Applied Biosystems), 100 nM specific primers (designed with the software Primer Express 3.0 from Applied Biosystems, Foster City, CA, USA; and subsequently synthesized by Invitrogen) (Table 1) and 2.5 ng of cDNA (or 5 ng of DNA) were used in each reaction. The standard PCR conditions are were 95 °C (10 min), followed by 40 cycles of 94 °C (1 min), 56–65 °C (specific annealing temperatures to each target described in Table 1) (1 min) and 72 °C (2 min), and by the standard denaturation curve (depicted in the figures with the corresponding Real-time PCR target). For mRNA analysis, the relative level of gene expression was calculated in reference to beta-actin expression in the sample, using the cycle threshold (Ct) method. For DNA analysis, gene expression levels were determined using the Ct method and normalized by the tissue weight. Negative controls without cDNA or DNA and without reverse transcriptase were also performed. Protein extraction and ELISA Measurements of cytokines and chemokines in periodontal tissue were performed by ELISA; as previously described. For protein

1124

C.E. Repeke et al. / Bone 46 (2010) 1122–1130

Table 1 Primer sequences and reaction properties. Target

Sense and anti-sense sequences

At (°C)

Mt (°C)

bp

TNF-α

AAGCCTGTAGCCCATGTTGT CAGATAGATGGGCTCATACC AGATC TCCGAGATGC CTTCA CCGTGGAGCAGGTGAAGAAT ATGAAATATACAAGTTATATCATG TGTTTCGAGGTCGAAGAGCATCCC TTCTGCTGACAAGCTCACCCT ATGGCGCTGAGAAGACTTGGT CCCACTTCCTGCTGTTTCTCCGCG GAGGAGGCCTCTCCTGAAGT TTCCCTGTCATCGCTTGCTCT CGGATGGAGATGCCGATTTT CAGAAGATGGCACTCACTGCA CACCATCGCTTTCTCTGCTCT GGAACCCCAGAGCGAAATACA CCTGAAGAATGCCTCCTCACA TGGACCTGGAGGAAATCTTGC AGAGTCCAAGAGAATGGCCGA AGAGATGCGTGGAGAGTCGAA AAGGTTTGGAATCTGCCCAGG CTGATGGCACCCATTTACACCT GATCTGAGCGATGCCATCAAA ACTGCAGGATGGACTCTTGCA TTTCAGAGCCTTGGAGGAGCT TTCTCAGCGAGGATGGCACTT AAACACGGTTCAGGATGCTGG CGTCATTTCTGTCCGTCTCT TTGCTGGCTGATGGCTGGCG ATGCCAACTTGACGTTAAAT AAACCCATCTCTGAGTTCTTCTTC ATGTTTGAGACCTTCAACA CACGTCAGACTTCATGATGG

56

79

330

58

84

307

58

77

501

60

79

322

60

80

238

60

81

433

65

75

203

57

77

225

58

79

155

65

85

162

60

82

186

60

82

206

60

81

200

56

82

390

60

78

557

56

75

495

IL-10 IFN-γ CCL3 CCL4 CCL5 RANKL OPG MMP-1 MMP-13 MMP-2 TIMP-1 TIMP-3 iNOS A.a. β-actin

At: annealing temperature, Mt: melting temperature; bp: base pairs of amplicon size. TNF: tumour necrosis factor; IL: interleukin; IFN: interferon; RANKL: receptor activator of nuclear factor κB ligand; OPG: osteoprotegerin; MMP: metalloproteinase; TIMP: tissue inhibitor of metalloproteinase; iNOS: inducible nitric oxide synthase; TIMP: tissue inhibitor of metalloproteinase.

extraction, palatal periodontal tissue was homogenized in phosphate-buffered saline (PBS) pH 7.4, centrifuged at 100g at 4 °C, and the concentrations of cytokines/chemokines in periodontal extracts were determined by ELISA using commercially available kits (R&S Systems, Minneapolis, USA) according to the manufacturer's instructions. Quantification of myeloperoxydase activity Quantification of myeloperoxydase (MPO) activity in homogenized periodontal tissue was measured as by enzymatic reaction, measured through the absorbance at 450 nm, and presented as OD; as previously described [9]. Met-RANTES treatment The treatment with met-RANTES (Serono Pharmaceutical Institute of Research, Switzerland) was performed as previously described [18], consisting in an intraperitoneal injection of 0.5 μg/kg of met-RANTES diluted in PBS, on alternate days, simultaneously initiated with the induction of PD protocol until day 30 post-infection, when the samples were collected. The control groups consisted of non-infected mice, treated or not with met-RANTES and infected mice treated or not with vehicle (PBS).

unpaired t-test, both performed with GraphPad Prism 5.0 software (GraphPad Software Inc., San Diego, CA). Values of p b 0.05 were considered statistically significant. Results CCL3 expression correlates with CCR1+, CCR5+ and RANKL+ cell migration throughout experimental periodontitis In the view of the characteristics and function of CCL3 in inflammatory diseases, our first step was to characterize the kinetics of expression of CCL3 throughout experimental PD. CCL3 expression showed a significant increase in the first days post infection (p b 0.05 vs. 0 h) and an intense increase on days 7 (p b 0.05 vs. 0 h) and 15 (p b 0.05 vs. 0 h). However, a significant reduction on CCL3 expression was observed on days 30 (p b 0.05 vs. 7 days and 15 days) and 60 (p b 0.05 vs. 7 days and 15 days; Fig. 1a). Similar to CCL3 expression kinetics, an intense migration of CCR5+ cells in infected WT mice was evaluated, from the 7 days post infection period (p b 0.001 vs. 0 h) and remained significant in the remaining periods of 15 (p b 0.001 vs. 0 h), 30 (p b 0.05 vs. 0 h) and 60 (p b 0.05 vs. 0 h) days, only with the exception of the 45 (p N 0.05 vs. 0 h) days post infection period (Fig. 1b). Among CCR1+ cells, there was a significant increase from the 15 days post infection period (p b 0.001 vs. 0 h), remaining significant in the 30 (p b 0.001 vs. 0 h), 45 (p b 0.05 vs. 0 h) and 60 days (p b 0.01 vs. 0 h) post infection periods, not showing significance only in the first period analyzed, the 7 days post infection period (p N 0.05 vs. 0 h), despite the tendency to increase (Fig. 1c). In addition, we also observed a significant increase in RANKL+ cells presence in the periods of 7 (p b 0.05 vs. 0 h) and 15 (p b 0.001 vs. 0 h) days post bacterial infection in the WT-AA mice (Fig. 1d), resulting in a very similar kinetic between CCL3 expression, CCR5 +, CCR1+ and RANKL+ cells migration in this periodontal disease experimental model. Moreover, CCL3 expression is positively correlated with migration of CCR5+ (p = 0.011; r2 = 0.9128) and RANKL+ (p = 0.019; r2 = 0.8732) cells influx and a small trend of positively correlated with CCR1+ (p = 0.285; r2 = 0.3592) cells in periodontal tissue infected (data not shown). Determination of CCR1+ and CCR5+ cell phenotype Having noted the kinetics of CCR1+ and CCR5+ cells migration to the periodontal tissues of A. actinomycetemcomitans infected WT mice, the phenotype of these cells was then analyzed. Therefore, the animals submitted to the protocol of PD induction were sacrificed at 30 days post-infection and samples were collected from palatal periodontal tissue. These samples were submitted to enzymatic digestion and the phenotypes of CCR5+ (Fig. 1e) and CCR1+ cells (Fig. 1f) were analyzed. Among CCR5+ cells, an increased amount of chemokine receptor CXCR3+ cells was found, followed by CD3+ cells, which suggests a higher population of Th1 cells. A relatively high amount of F4/80 cells was also found, suggesting that a significant proportion of CCR5+ cells probably correspond to macrophages. Thus, among CCR1+ cells, the results showed a greater number of macrophages (F4/80+ cells), followed by CCR5+ and CCR2+ cells. Among the other markers analyzed, CD3+, GR1+, CXCR3+, CCR4+ and CCR8+ were poorly expressed in the subpopulation of CCR1+ cells. The role of CCL3 in the modulation of the inflammatory response and of alveolar bone loss in response to A. actinomycetemcomitans

Statistical analysis Data are presented as means ± SD, and the statistical significance between the infected and control groups of WT and KO strains was analyzed by ANOVA, followed by Bonferroni post test, or by the

In the view of the potential role of CCL3 in the development of inflammatory cell migration and bone resorption, we next investigated such parameters throughout experimental PD in CCL3KO (Fig. 2). Unexpectedly, no significant decrease (p N 0.05) in alveolar

C.E. Repeke et al. / Bone 46 (2010) 1122–1130

1125

Fig. 1. CCL3 expression kinetics correlates with CCR5+, CCR1+ and RANKL+ cell migration during the course of experimental periodontal disease. C57Bl/6 (WT) mice were infected orally with A. actinomycetemcomitans (AA) and non-infected controls (C) and evaluated for: (a) CCL3 mRNA expression by Real-TimePCR, using the SybrGreen System and the cycle threshold (Ct) method, the box depicts the RealTimePCR melting curve; (b) CCR5+, (c) CCR1+ and (d) RANKL+ cells migration analyzed by flow cytometry, as described in Materials and Methods; (e) CCR5+ and (f) CCR1+ cells phenotype analyzed by flow cytometry, as described in Materials and methods; Values (mean ± SD) obtained from five animals at each point, from one experiment representative of three; ⁎p b 0.05, one-way analysis of variance (ANOVA) with Bonferroni's post-test.

bone resorption was observed in CCL3KO mice, similarly the analysis of the inflammatory cells influx also showed no significant differences (p N 0.05) in leucocytes number when infected WT and CCL3KO strains were compared. Despite of a small trend towards a lower migration of CCR1+ and CCR5+ to periodontal tissues of CCL3KO mice, no significant differences (p N 0.05) were found between WT and CCL3KO strains in all the periods analyzed. Similar results were found regarding RANKL+ cell migration, since similar numbers (p N 0.05) of these cells were found in the periodontal tissues of WT and CCL3KO mice. Accordingly, similar levels or RANKL and OPG were found in periodontal tissues of WT and CCL3KO mice by ELISA analysis. Cytokines and MMPs/TIMPs expression in periodontal tissues of CCL3KO mice throughout experimental periodontitis Since cytokines and MMPs/TIMPs have been associated with PD pathogenesis, our next step was to characterize the expression pattern of these molecules during the course of experimental PD in CCL3KO mice. As a general pattern, no significant differences (p N 0.05) were found between CCL3KO and WT strains regarding the levels of inflammatory cytokines TNF-α (Fig. 3a) and IFN-γ (Fig. 3b) expression, except at day 7 post infection, were the levels of both cytokines were found to be decreased (p b 0.05) in CCL3KO (data not shown). Similarly, IL-10 expression was similar in CCL3KO and WT mice (p N 0.05), except at day 15 post-infection (p b 0.05, Fig. 3c) were high levels of IL-10 mRNA were found in periodontal tissues of CCL3KO mice. We also investigated whether the lack of CCL3 could interfere in the modulation of MMPs/TIMPs balance (Fig. 3), and our results revealed that MMP-1, MMP-13, and TIMP-1 mRNA expression in gingival tissues from infected CCL3KO mice showed no significant differences (p N 0.05) when compared to WT mice during the entire course of the disease. Similar results were observed for MMP-2 and TIMP-3 mRNA (data not shown).

The control of experimental A. actinomycetemcomitans infection in CCL3KO mice In the view of the established role of CCL3 as a chemoattractant of macrophages and Th1-type lymphocytes, we next investigate if the lack of CCL3 could interfere in the control bacterial control mechanisms and in the bacterial load of infected periodontal tissue (Fig. 4). However, our results demonstrated that CCL3KO infected mice presented similar levels of bacterial load in periodontal tissue, as well the lack of CCL3 not result in altered levels of the neutrophilic antimicrobial mediator myeloperoxidase (MPO) (Fig. 4a) nor in the inducible nitric oxide synthase (iNOS) expression (Fig. 4b) when compared to WT mice (p N 0.05). The kinetics of CCL4 and CCL5 expression/production in CCL3KO mice In the view of the absence of experimental periodontitis phenotypic changes in CCL3KO mice, we next investigated if CCL4 and CCL5, two chemokines that play similar roles than CCL3 as CCR1 and CCR5 ligands, could overcome the lack of CCL3 (Fig. 5). The results showed that the kinetics of CCL4 and CCL5 expression resemble that seem to CCL3, and that CCL3KO mice express similar levels of chemokines CCL4 (Fig. 5a) and CCL5 (Fig. 5b) (p N 0.05). These results were confirmed by ELISA, were similar levels of CCL4 and CCL5 were found in the periodontal tissues of CCL3KO and WT mice after 30 days of infection (p N 0.05; Figs. 5c and d). Differential modulation of inflammatory cell influx and alveolar bone resorption by the individual or simultaneous inhibition of CCR5 and CCR1 To verify the role of chemokines CCL3, CCL4 and CCL5 in experimental PD, a specific antagonist of CCR1 and CCR5 receptors (met-RANTES) was used aiming to ablate the action of the three

1126

C.E. Repeke et al. / Bone 46 (2010) 1122–1130

Fig. 2. CCL3KO mice develop a similar PD phenotype than WT mice after A. actinomycetemcomitans oral inoculation. C57Bl/6 (WT) and CCL3KO mice were infected orally with A. actinomycetemcomitans and evaluated for: (a) total leukocyte counts of the inflammatory infiltrate, performed in a Neubauer chamber; (b) alveolar bone loss quantification, performed through the measurements of cement-enamel junction-alveolar bone crest (CEJ-ABC) area in the palatal face of maxillary molars; and (c) CCR5+, (d) CCR1+ and (e) RANKL+ cell counts, analyzed by flow cytometry, as described in Materials and methods. The levels of RANKL (f) and OPG (g) protein in periodontal tissues were determined at day 30 post-infection by ELISA, as described in Materials and methods. The results are presented as pictograms of protein per milligram of tissue, mean ± SD, from duplicate measurements, one experiment representative of three. Values (mean ± s.d.) obtained from five animals at each point, from one experiment representative of three; ⁎p b 0.05: (a–e) one-way analysis of variance (ANOVA) with Bonferroni's post-test, (f–g) unpaired t-test.

chemokines simultaneously. The results showed that the treatment with met-RANTES significantly reduced (p b 0.05) the influx of inflammatory cells and in the alveolar bone resorption in infected WT mice when compared with untreated infected WT mice. Accordingly, the number of CCR1+ and CCR5+ cell in periodontal tissues were also significantly reduced (p b 0.05) by met-RANTES treatment. In this way, our next aim was analyze individually the individual effect of the chemokine receptors CCR5 and CCR1. Our results demonstrated that the CCR5KO and CCR1KO strains presented a similar and partial, but significant, reduction in the alveolar bone loss and the influx of inflammatory cells when compared with untreated infected WT mice (p b 0.05). However, the reduction in both leukocyte counts and bone loss presented by both KO strains was significantly lower than that verified in met-RANTES treated infected WT mice (p b 0.05). Therefore, our data demonstrate that the absence of CCR1 and CCR5 individually resulted in an intermediate phenotype between met-RANTES untreated and treated WT mice regarding alveolar bone loss and inflammatory cell migration (Fig. 6), and demonstrate a cooperative role for such chemokine receptors in the pathogenesis of experimental periodontitis.

Discussion The chronic inflammatory cell influx into periodontal tissues has been associated with the persistent release of inflammatory mediators that result in the periodontal tissue destruction [4]. Among inflammatory mediators, the chemokine CCL3 have been implicated in PD pathogenesis [5]. This chemokine chemoattracts CCR1 and CCR5 expressing leukocytes triggering bone resorption in experimental arthritis, pathology that share several characteristics such as the chronic nature of the inflammatory reaction associated with bone resorption activity with PD [19,20]. However, the role of CCL3 in the development of experimental PD remains unknown. In order to clarify the putative role of CCL3 in the immunopathogenesis of PD, we initially investigate its expression kinetics and the putative correlation with inflammatory cell influx into periodontal tissues. CCL3, whose expression present an initial peak until 15 days post infection followed by a significant decrease, was found to parallel the kinetics of CCR1+ and CCR5+ cells migration after periodontal infection. The phenotypic analysis demonstrated that most of CCR5+ cells co-express CD3 and CXCR3, suggesting a

C.E. Repeke et al. / Bone 46 (2010) 1122–1130

1127

Fig. 3. The role of CCL3 in the modulation of cytokines, matrix metalloproteinases (MMPs) and tissue inhibitor of metalloproteinases (TIMPs) expression during the course of experimental periodontal disease. Periodontal tissues of C57Bl/6 (WT) and CCL3KO mice, infected orally with A. actinomycetemcomitans, were harvested from day 0 (before infection) until 60 days post-infection. The levels of TNF-α, IFN-γ, IL-10, MMP-1, MMP-13 and TIMP-1 mRNA were quantified by Real-TimePCR, using the SybrGreen System and the cycle threshold (Ct) method. The results are presented as the expressions of the target mRNAs with normalization to β-actin, mean ± SD from duplicate measurements, one experiment representative of three; the boxes depict the respective RealTimePCR melting curve for the respective gene targets. ⁎p b 0.05 compared to wild-type, unpaired t-test.

population of T lymphocytes polarized into Th1 phenotype [21]. Interestingly, Th1-cells are thought to be the major source of RANKL in diseased periodontium [22,23], and accordingly, the kinetics of RANKL+ cell migration to periodontal tissues is also present a parallel kinetics with CCR5+ cell influx. A significant number of CCR5+ cells, as well the majority of CCR1+ cells, were positive for F4/80, a marker of monocytes/macrophages lineage, which classically includes osteoclast precursors [11,24]. Therefore, CCR1 and CCR5 can cooperatively mediate the migration of osteoclast precursors and also of cells that could support its differentiation and activation (i.e. RANKL+ cells), thus potentially triggering bone

resorption process. Furthermore, this potential destructive role of CCL3 is supported by the fact that macrophages and Th1 cells are characteristic sources of catabolic cytokines such as TNF-α and IFN-γ [10,25,26]. In accordance, the period of higher CCL3 expression throughout experimental PD parallel with the intense bone loss activity and the predominance of the Th1-type response characteristic of the initial phase of disease [17]. Therefore, we next employed a CCL3 genetically deficient mice strain in order to clarify the putative role of CCL3 in PD outcome. Surprisingly, when comparing A. actinomycetemcomitans-infected CCL3KO and WT strains, no significant differences were observed

Fig. 4. The role of CCL3 in the control of A. actinomycetemcomitans infection. C57Bl/6 (WT) and CCL3KO mice were infected orally with A. actinomycetemcomitans and evaluated for: (a) levels of myeloperoxidase (MPO) in periodontal tissues, (b) levels of inducible nitric oxide synthase (iNOS) expression and (c) A. actinomycetemcomitans load (AA DNA) in periodontal tissues, quantified by Real-TimePCR, using SybrGreen System and the cycle threshold (Ct) method; all performed as described in the Materials and methods; the box depict the respective RealTimePCR melting curve for the respective gene target. ⁎p b 0.05 versus wild-type, unpaired t-test.

1128

C.E. Repeke et al. / Bone 46 (2010) 1122–1130

Fig. 5. Kinetics of CCL4 and CCL5 expression/production in the presence/absence of CCL3. C57Bl/6 (WT) and CCL3KO mice were infected orally with A. actinomycetemcomitans and evaluated for: (a) CCL4 and (b) CCL5 mRNA expression were quantified by Real-Time polymerase chain reaction in periodontal tissue, using SybrGreen System and the cycle threshold (Ct) method. The levels of CCL4 (c) and CCL5 (d) protein in periodontal tissues were determined at day 30 post-infection by ELISA, as described in Materials and methods. The boxes depict the respective RealTimePCR melting curve; ⁎p b 0.05 versus wild-type, unpaired t-test.

regarding the alveolar bone resorption, as well regarding leukocyte migration (both absolute and CCR1+, CCR5+ and RANKL+ cells count) to periodontal tissue after infection. Conversely, previous studies have demonstrated that CCL3 can induce inflammatory cells migration in RA experimental model [27]. In addition, the lack of CCL3 does not result in a differential cytokine production within periodontal environment throughout disease development, nor interfere in the MMPs/TIMPs and RANKL/OPG balance. Similar to our findings, mice with blockage of CCR5 receptors presented no significant differences in the expression of cytokines, such as IFN-γ, TNF-α and IL-10 in response to Trypanosoma cruzi infection, although it has been reported that there is a trend to decrease in inflammatory cytokine production [28]. In addition, RA experimental model using CCL3KO mice showed a similar and robust serum TNF-α level when compared with WT mice [27]. Our data regarding cytokine levels obviously justify the similar the disease phenotype presented by CCL3KO and WT strains, since the balance between pro- and anti-inflammatory cytokines is thought to modulate PD severity through the regulation of RANKL/OPG and MMPs/TIMPs systems [9,10,29]. Furthermore, the control of periodontal infection, described to the dependent of proinflammatory and Th-1-type cytokines induction of both MPO and iNOS [9,10] was not altered in the absence of CCL3. Accordingly, similar levels of MPO and iNOS were found in the tissues of CCL3KO and WT strains. However, this apparent lack of function for CCL3 is unanticipated in the view of the potential association previously discussed, and therefore we next investigate the possible reason for this phenomenon. Besides CCL3, other CC chemokines can bind to the chemokine receptors CCR1 and CCR5 [30], and this shared binding could overcome the lack of CCL3. Therefore, in order to evaluate the possible redundant functions of CCR1- and CCR5-ligands, we verified that CCL4 (MIP-1β) and CCL5 (RANTES) are expressed in a kinetics similar to that seen to CCL3 after periodontal infection. Accordingly, a similar pattern of CCL3,

CCL4 and CCL5 co-expression is described in human periodontitis lesions [6]. In addition, our data demonstrate the kinetics and levels of CCL4 and CCL5 expression remained unaltered in CCL3KO strain, reinforcing the hypothesis that these homologous chemokines might play overlapping roles, and that CCL4 and CCL5 could overcome the CCL3 lack without apparent deficits. In this context, it is possible to hypothesize that the chronic and broad antigenic stimuli in PD result in an environment qualitatively and quantitatively rich in inflammatory signals, including several chemokines. Consequently, this chemokine diversity results in a higher probability of the occurrence of chemokines with overlapping spectrum of action within periodontal environment, which virtually could attenuate or overcome the absence of a single chemokine. Accordingly, the redundancy (more than one chemokine can ding the same receptor) and the promiscuity (one chemokine can bind to more than one receptor) are characteristics that confer a robustness to the chemokines/chemokine receptors system [30,31]. Indeed, the robustness is as a common feature of many cytokine and growth factor networks that assure their proper performance, since the outputs of these cytokine networks may be retained to a sufficient extent, even if genetic or epigenetic alterations affect qualitatively or quantitatively individual network components [30,31]. However, robustness, redundancy and promiscuity also difficult the study of individual factors roles within these systems [30,31]. It is important to consider that the similar kinetics and assumed overlapping role for CCL3, CCL4 and CCL5 does not rule out the possibility that CCL4 and/or CCL5 could play a major role than CCL3 in experimental PD outcome. Therefore, further studies using specific antagonists or knockout strains for each chemokine receptor are required to unravel the specific roles of individual chemokines. Indeed, only the data regarding the patterns of chemokine expression are not enough to support the hypothesis concerning the possible overlapping role of CCL3, CCL4 and CCL5 in experimental periodontitis. One alternative approach to obtain a deeper insight into

C.E. Repeke et al. / Bone 46 (2010) 1122–1130

1129

Fig. 6. Differential modulation in inflammatory cell migration and in alveolar bone loss by the individual or simultaneous inhibition of CCR5 and CCR1 in C57Bl/6 mice infected by A. actinomycetemcomitans. C57Bl/6 (WT), CCR5KO and CCR1KO mice submitted to the periodontal disease protocol of induction by the inoculation with A. actinomycetemcomitans (AA) and non-infected controls (C) groups were treated with met-RANTES (Met), with PBS vehicle (V) or kept untreated (−), and evaluated for: (a) increase in the CEJ-ABC area; (b) number of leukocytes extracted by enzymatic digestion of the periodontal tissue, stained with the tripam blue and counted in a Neubauer chamber; and also for (c) CCR5+ and (d) CCR1+ cell counts, analyzed by flow cytometry, as described in Materials and methods. One-way analysis of variance (ANOVA) with Bonferroni's post-test. # Represent absence of positive cells evaluated; Different letters represent statistically significant differences (p b 0.05) between groups.

the role of such chemokines is to interfere in its receptors, namely CCR1 and CCR5, aiming to ablate the action of the three chemokines simultaneously. Therefore, we next treated A. actinomycetemcomitansinfected WT mice with met-RANTES (N-terminal-methionylated RANTES) a specific antagonist of CCR1 and CCR5 [16,28,32,33]. Our results demonstrated that met-RANTES treatment is effective in the attenuation of alveolar bone loss and inflammatory reaction development in response to periodontal infection, being specifically associated with a reduced influx of CCR1+ and CCR5+ into periodontal tissues. Indeed, met-RANTES has shown to be effective as a CCR5 and CCR1 specific antagonist in experimental models of infectious and autoimmune diseases [13,28,34], and resulting in a significant decrease of experimental arthritis severity [16,35]. Interestingly, when CCR1 and CCR5 were individually disabled (using genetically deficient mice strains), an intermediate phenotype of disease development was observed. Indeed, CCR1KO and CCR5KO strains presented a lower leukocyte infiltration and alveolar bone loss than WT mice, but the attenuation of disease severity obtained with met-RANTES treatment was significantly more effective, suggesting a cooperative role for such chemokine receptors in the inflammatory bone resorption process. Accordingly, recent studies demonstrate that CCR1 and CCR5 contribute to osteolysis in multiple myeloma and to inflammatory cell migration in different models [36–39], which reinforce the potential cooperative role these receptors. Taken together, the results presented here point to an important role for the chemokine receptors CCR1 and CCR5, and consequently for its ligands, in the development of

experimental periodontitis. However, further studies are required to determine the exact role of CCR1 and CCR5 in inflammatory bone loss, and to clarify the phenotype of the cells chemoattracted by them. In summary, our results demonstrate that the absence of CCL3 does not affect the development of experimental periodontitis, possibly due to a redundant role of CCL4 and CCL5, chemokines that share the binding to CCR1 and CCR5 with CCL3. When this network is disabled through the treatment with met-RANTES (a CCR1 and CCR5 antagonist), a significant reduction of experimental periodontitis is verified. Interestingly, the effect of met-RANTES treatment overcome the effect of the individual absence of CCR1 and CCR5 regarding inflammatory cell migration and bone loss, suggesting a cooperative role for these chemokine receptors in inflammatory bone loss process. Independently of the individual role of chemokines and chemokine receptors investigated in this study, our results reinforce the concept of the complexity of the chemokine/chemokine receptor system, and suggest that when inhibiting any chemokine receptor, as a general rule the function of more than one of its ligands (chemokine) is consequently disabled. Therefore, chemokine receptors appear as potential therapeutic targets to limit the inflammatory and bone resorptive process characteristic of PD. Acknowledgments This work was supported by grants from Fundação de Amparo à Pesquisa do Estado de São Paulo—FAPESP (06/00534-1, 07/01705-7).

1130

C.E. Repeke et al. / Bone 46 (2010) 1122–1130

References [1] Tonetti MS, Claffey N. Advances in the progression of periodontitis and proposal of definitions of a periodontitis case and disease progression for use in risk factor research. Group C consensus report of the 5th European Workshop in Periodontology. J Clin Periodontol 2005;32(Suppl 6):210–3. [2] Albiger B, Dahlberg S, Henriques-Normark B, Normark S. Role of the innate immune system in host defence against bacterial infections: focus on the Toll-like receptors. J Intern Med 2007;261:511–28. [3] Ebersole JL, Taubman MA. The protective nature of host responses in periodontal diseases. Periodontol 2000 1994;5:112–41. [4] Gemmell E, Carter CL, Seymour GJ. Chemokines in human periodontal disease tissues. Clin Exp Immunol 2001;125:134–41. [5] Silva TA, Garlet GP, Fukada SY, Silva JS, Cunha FQ. Chemokines in oral inflammatory diseases: apical periodontitis and periodontal disease. J Dent Res 2007;86:306–19. [6] Kabashima H, Yoneda M, Nagata K, Hirofuji T, Maeda K. The presence of chemokine (MCP-1, MIP-1alpha, MIP-1beta, IP-10, RANTES)-positive cells and chemokine receptor (CCR5, CXCR3)-positive cells in inflamed human gingival tissues. Cytokine 2002;20:70–7. [7] Gale LM, McColl SR. Chemokines: extracellular messengers for all occasions? Bioessays 1999;21:17–28. [8] Assuma R, Oates T, Cochran D, Amar S, Graves DT. IL-1 and TNF antagonists inhibit the inflammatory response and bone loss in experimental periodontitis. J Immunol 1998;160:403–9. [9] Garlet GP, Cardoso CR, Campanelli AP, Ferreira BR, Avila-Campos MJ, Cunha FQ, et al. The dual role of p55 tumour necrosis factor-alpha receptor in Actinobacillus actinomycetemcomitans-induced experimental periodontitis: host protection and tissue destruction. Clin Exp Immunol 2007;147:128–38. [10] Garlet GP, Cardoso CR, Campanelli AP, Garlet TP, Avila-Campos MJ, Cunha FQ, et al. The essential role of IFN-gamma in the control of lethal Aggregatibacter actinomycetemcomitans infection in mice. Microbes Infect 2008;10:489–96. [11] Yu X, Huang Y, Collin-Osdoby P, Osdoby P. CCR1 chemokines promote the chemotactic recruitment, RANKL development, and motility of osteoclasts and are induced by inflammatory cytokines in osteoblasts. J Bone Miner Res 2004;19: 2065–77. [12] Garred P, Madsen HO, Petersen J, Marquart H, Hansen TM, Freiesleben Sorensen S, et al. CC chemokine receptor 5 polymorphism in rheumatoid arthritis. J Rheumatol 1998;25:1462–5. [13] Marino AP, da Silva A, dos Santos P, Pinto LM, Gazzinelli RT, Teixeira MM, et al. Regulated on activation, normal T cell expressed and secreted (RANTES) antagonist (Met-RANTES) controls the early phase of Trypanosoma cruzi-elicited myocarditis. Circulation 2004;110:1443–9. [14] Oba Y, Lee JW, Ehrlich LA, Chung HY, Jelinek DF, Callander NS, et al. MIP-1alpha utilizes both CCR1 and CCR5 to induce osteoclast formation and increase adhesion of myeloma cells to marrow stromal cells. Exp Hematol 2005;33:272–8. [15] Watanabe T, Kukita T, Kukita A, Wada N, Toh K, Nagata K, et al. Direct stimulation of osteoclastogenesis by MIP-1alpha: evidence obtained from studies using RAW264 cell clone highly responsive to RANKL. J Endocrinol 2004;180:193–201. [16] Plater-Zyberk C, Hoogewerf AJ, Proudfoot AE, Power CA, Wells TN. Effect of a CC chemokine receptor antagonist on collagen induced arthritis in DBA/1 mice. Immunol Lett 1997;57:117–20. [17] Garlet GP, Avila-Campos MJ, Milanezi CM, Ferreira BR, Silva JS. Actinobacillus actinomycetemcomitans-induced periodontal disease in mice: patterns of cytokine, chemokine, and chemokine receptor expression and leukocyte migration. Microbes Infect 2005;7:738–47. [18] Matsui M, Weaver J, Proudfoot AE, Wujek JR, Wei T, Richer E, et al. Treatment of experimental autoimmune encephalomyelitis with the chemokine receptor antagonist Met-RANTES. J Neuroimmunol 2002;128:16–22. [19] Mercado FB, Marshall RI, Bartold PM. Inter-relationships between rheumatoid arthritis and periodontal disease. A review. J Clin Periodontol 2003;30:761–72.

[20] Bartold PM, Marshall RI, Haynes DR. Periodontitis and rheumatoid arthritis: a review. J Periodontol 2005;76:2066–74. [21] Silva TA, Garlet GP, Lara VS, Martins Jr W, Silva JS, Cunha FQ. Differential expression of chemokines and chemokine receptors in inflammatory periapical diseases. Oral Microbiol Immunol 2005;20:310–6. [22] Kotake S, Nanke Y, Mogi M, Kawamoto M, Furuya T, Yago T, et al. IFN-gammaproducing human T cells directly induce osteoclastogenesis from human monocytes via the expression of RANKL. Eur J Immunol 2005;35:3353–63. [23] Fukada SY, Silva TA, Garlet GP, Rosa AL, da Silva JS, Cunha FQ. Factors involved in the T helper type 1 and type 2 cell commitment and osteoclast regulation in inflammatory apical diseases. Oral Microbiol Immunol 2009;24: 25–31. [24] Vallet S, Raje N, Ishitsuka K, Hideshima T, Podar K, Chhetri S, et al. MLN3897, a novel CCR1 inhibitor, impairs osteoclastogenesis and inhibits the interaction of multiple myeloma cells and osteoclasts. Blood 2007;110:3744–52. [25] Karpus WJ, Lukacs NW, Kennedy KJ, Smith WS, Hurst SD, Barrett TA. Differential CC chemokine-induced enhancement of T helper cell cytokine production. J Immunol 1997;158:4129–36. [26] Montecucco F, Steffens S, Burger F, Da Costa A, Bianchi G, Bertolotto M, et al. Tumor necrosis factor-alpha (TNF-alpha) induces integrin CD11b/CD18 (Mac-1) upregulation and migration to the CC chemokine CCL3 (MIP-1alpha) on human neutrophils through defined signalling pathways. Cell Signal 2008;20:557–68. [27] Chintalacharuvu SR, Wang JX, Giaconia JM, Venkataraman C. An essential role for CCL3 in the development of collagen antibody-induced arthritis. Immunol Lett 2005;100:202–4. [28] Medeiros GA, Silverio JC, Marino AP, Roffe E, Vieira V, Kroll-Palhares K, et al. Treatment of chronically Trypanosoma cruzi-infected mice with a CCR1/CCR5 antagonist (Met-RANTES) results in amelioration of cardiac tissue damage. Microbes Infect 2009;11:264–73. [29] Garlet GP, Cardoso CR, Silva TA, Ferreira BR, Avila-Campos MJ, Cunha FQ, et al. Cytokine pattern determines the progression of experimental periodontal disease induced by Actinobacillus actinomycetemcomitans through the modulation of MMPs, RANKL, and their physiological inhibitors. Oral Microbiol Immunol 2006; 21:12–20. [30] Mantovani A. The chemokine system: redundancy for robust outputs. Immunol Today 1999;20:254–7. [31] Haddad JJ. Cytokines and related receptor-mediated signaling pathways. Biochem Biophys Res Commun 2002;297:700–13. [32] Proudfoot AE, Power CA, Hoogewerf AJ, Montjovent MO, Borlat F, Offord RE, et al. Extension of recombinant human RANTES by the retention of the initiating methionine produces a potent antagonist. J Biol Chem 1996;271:2599–603. [33] Proudfoot AE, Power CA, Rommel C, Wells TN. Strategies for chemokine antagonists as therapeutics. Semin Immunol 2003;15:57–65. [34] Longden J, Cooke EL, Hill SJ. Effect of CCR5 receptor antagonists on endocytosis of the human CCR5 receptor in CHO-K1 cells. Br J Pharmacol 2008;153:1513–27. [35] Shahrara S, Proudfoot AE, Park CC, Volin MV, Haines GK, Woods JM, et al. Inhibition of monocyte chemoattractant protein-1 ameliorates rat adjuvantinduced arthritis. J Immunol 2008;180:3447–56. [36] Seki E, De Minicis S, Gwak GY, Kluwe J, Inokuchi S, Bursill CA, et al. CCR1 and CCR5 promote hepatic fibrosis in mice. J Clin Invest 2009;119:1858–70. [37] Menu E, De Leenheer E, De Raeve H, Coulton L, Imanishi T, Miyashita K, et al. Role of CCR1 and CCR5 in homing and growth of multiple myeloma and in the development of osteolytic lesions: a study in the 5TMM model. Clin Exp Metastasis 2006;23:291–300. [38] Reichel CA, Khandoga A, Anders HJ, Schlondorff D, Luckow B, Krombach F. Chemokine receptors Ccr1, Ccr2, and Ccr5 mediate neutrophil migration to postischemic tissue. J Leukoc Biol 2006;79:114–22. [39] Yanaba K, Mukaida N, Matsushima K, Murphy PM, Takehara K, Sato S. Role of C-C chemokine receptors 1 and 5 and CCL3/macrophage inflammatory protein1alpha in the cutaneous Arthus reaction: possible attenuation of their inhibitory effects by compensatory chemokine production. Eur J Immunol 2004;34: 3553–61.