Evidencing the role of lactose permease in IPTG uptake by Escherichia coli in fed-batch high cell density cultures

Journal of Biotechnology 157 (2012) 391–398

Contents lists available at SciVerse ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

Evidencing the role of lactose permease in IPTG uptake by Escherichia coli in fed-batch high cell density cultures Alfred Fernández-Castané a,∗ , Claire E. Vine b , Glòria Caminal a , Josep López-Santín a a b

Departament d’Enginyeria Química, Unitat de Biocatàlisi Aplicada Associada al IQAC (CSIC), Universitat Autònoma de Barcelona, Bellaterra, Spain School of Biosciences, University of Birmingham, Edgbaston B15 2TT, UK

a r t i c l e

i n f o

Article history: Received 19 September 2011 Received in revised form 10 November 2011 Accepted 6 December 2011 Available online 21 December 2011 Keywords: Lac-permease LacY gene Recombinant protein production Fed-batch fermentation IPTG uptake

a b s t r a c t The lac-operon and its components have been studied for decades and it is widely used as one of the common systems for recombinant protein production in Escherichia coli. However, the role of the lactose permease, encoded by the lacY gene, when using the gratuitous inducer IPTG for the overexpression of heterologous proteins, is still a matter of discussion. A lactose permease deficient strain was successfully constructed. Growing profiles and acetate production were compared with its parent strain at shake flask scale. Our results show that the lac-permease deficient strain grows slower than the parent in defined medium at shake flask scale, probably due to a downregulation of the phosphotransferase system (PTS). The distributions of IPTG in the medium and inside the cells, as well as recombinant protein production were measured by HPLC–MS and compared in substrate limiting fed-batch fermentations at different inducer concentrations. For the mutant strain, IPTG concentration in the medium depletes slower, reaching at the end of the culture higher concentration values compared with the parent strain. Final intracellular and medium concentrations of IPTG were similar for the mutant strain, while higher intracellular concentrations than in medium were found for the parent strain. Comparison of the distribution profiles of IPTG of both strains in fed-batch fermentations showed that lac-permease is crucially involved in IPTG uptake. In the absence of the transporter, apparently IPTG only diffuses, while in the presence of lac-permease, the inducer accumulates in the cytoplasm at higher rates emphasizing the significant contribution of the permease-mediated transport. © 2011 Elsevier B.V. All rights reserved.

1. Introduction Escherichia coli is one of the hosts most widely used for production of heterologous recombinant proteins, because of its well-known genetics, metabolome and proteome, as well as the availability of tools for genetic manipulation. Among the different expression systems employed in E. coli, those derived from the lac operon are one of the most frequently used. Isopropyl-␤d-1-thiolgalactopyranoside (IPTG) is a commonly used gratuitous inducer for protein expression, because it is a synthetic analogue of lactose. It binds the lac repressor and consequently releases the operator allowing DNA transcription (Donovan et al., 1996). Fed-batch cell growth and protein expression using IPTG inducible promoters is a common operational procedure in order to achieve high cell density cultures and improved protein yields. IPTG induction is usually added as a single pulse (Vidal et al., 2005;

∗ Corresponding author. Tel.: +34 93 581 26 95; fax: +34 93 581 20 13. E-mail addresses: [email protected] (A. Fernández-Castané), [email protected] (C.E. Vine), [email protected] (G. Caminal), [email protected] (J. López-Santín). 0168-1656/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2011.12.007

Sevastyanovich et al., 2009). In that case, for strong promoters, the bacterial specific growth rate is reduced after induction due to metabolic burden (Andersson et al., 1996; Glick, 1995; Bentley et al., 2009). Alternatively, continuous IPTG addition has been employed as a method to maintain sustained growth after induction (Pinsach et al., 2008a; Striedner et al., 2003). The study of the transport phenomena involved in IPTG uptake could be of great significance in order to understand the induction mechanisms and their relationship with protein expression. This knowledge would constitute an essential tool for further optimization to obtain maximum yields. Nevertheless, until now, there was a lack of analytical methods to directly quantify the inducer concentration in medium and inside the biomass, limiting accurate description of IPTG transport. It is a matter of discussion in some publications whether the probability for the inducer to bind the repressor depends on the inducer concentration inside the cell (Vilar José et al., 2003) or if there are “stochastic” events involved to explain why, at some points, just by chance, the cell becomes induced (Rao et al., 2002). On the other hand, it is a controversial issue whether the IPTG uptake into the host cell is mediated by lactose permease (lac-permease), passive diffusion or by other types of permeases. Although a crucial influence of the lactose transporter,

392

A. Fernández-Castané et al. / Journal of Biotechnology 157 (2012) 391–398

lac-permease, in IPTG transport is widely suggested (Hansen et al., 1997; Jensen et al., 1993), it has been also published that IPTG can diffuse across the cell membrane without the aid of the lactose transporter (Beckwith and Reznikoff, 1979). In addition, there are references mentioning that IPTG could also be transported into the cell by other permeases rather than by lac-permease. In the latter case, this compound could be less susceptible to inducer exclusion by glucose and sugars whose assimilation is mediated by the phosphotransferase system (PTS) (Donovan et al., 1996). In the case of lac-permease mediated transport, IPTG induces its own active transport. This automatically leads to saturation curves when enzyme concentration is plotted against inducer concentration. This phenomenon was shown in a pioneer work in the 1950s, by testing ␤-galactosidase activity (lacZ) at different IPTG concentration levels (Herzenberg, 1959). It is known that lacZ and lacY, are in the same open reading frame (ORF) and thus, ␤-galactosidase activity is proportional to lac-permease expression in wild type strains. Cryptic lacY mutants expressed less lacZ and there was a linear relationship between ␤-galactosidase activity and IPTG concentration. These results were in contrast with the parent strain behaviour where saturation curves were observed when plotting lacZ activity against inducer concentration. Similar results for a lacY strain were observed by Jensen and Hammer (1998). Recently, a mathematical model for inducer transport was reported, in which it is considered that lac-permease might participate in carrier influx but also in efflux of IPTG. The model states that diffusive influx must be taken into consideration (Noel et al., 2009). However, all the mathematical models developed, as well as experimental work completed to date in order to describe IPTG transport mechanisms and the role of lac-permease do not account for experimental data regarding direct quantification of IPTG. Besides, one has to take into account that there are many variables that may regulate the induction phenomenon and thus, the transport of inducer. One key variable is the concentration of lac repressor (encoded by lacI) in the cell (Lewis, 2005). The operator sites that interact with the repressor (Dunaway et al., 1980; O’Gorman et al., 1980) or the presence of DNA loops are also key variables (Oehler et al., 2006). With the aim to elucidate the relative influence of diffusional and active IPTG transport mechanisms, our research group has recently developed an HPLC–MS assay for the quantification of IPTG in E. coli fed-batch culture samples. For the first time, direct measures of inducer can be achieved in order to study the distribution profiles of IPTG in both medium and inside the biomass (Fernández et al., 2010). Production of the recombinant protein Rhamnulose-1-Paldolase (RhuA) by a glycine auxotrophic strain (M15glyA, harbouring a plasmid complementing the auxotrophy) was used as a case study, by preparing lacY mutants and comparing with the parent strain in terms of IPTG uptake behaviour and protein production. The glyA gene was mutated in a previous work (Vidal et al., 2008) using the ␭-red recombinase system as described by Datsenko and Wanner (2000). This method is commonly used to inactivate chromosomal genes in E. coli K-12 and derived strains through homologous recombination using linear PCR products (Baba et al., 2006; Serra-Moreno et al., 2006). However, even with this site-specific recombination system, at least one copy of the FRT (FLP recognition target) site remains in the chromosome after excision of the selective marker, which limits the repeated use of these linear products. Therefore, the efficiency in generating double mutants can be improved by modifications of the original methods (Yu et al., 2008; Lee et al., 2009). Aiming to study the role of the lactose transporter when using the gratuitous inducer IPTG, a derivative mutant was generated by disrupting the lacY gene in this work.

In summary, this study aims to provide experimental data regarding IPTG distribution profiles and production of RhuA in fedbatch fermentation samples. Another aim was to elucidate the role of lac-permease in IPTG transport, by comparing the parent strain E. coli M15glyA with a glyA lacY mutant. 2. Materials and methods 2.1. Strains, plasmids and bacteriophage used in this study E. coli M15glyA derived from K-12 (plasmid free) was used as the target host for site specific lacY deletion and RhuA production. Plasmids pQ␣␤rham and pREP4 were used for RhuA protein production. Construction of the vector pQE␣␤rham for the production of RhuA under the control of the strong promoter T5 is described elsewhere (Vidal et al., 2003). This expression system is based on glycine auxotrophy to ensure plasmid stability, in order to avoid antibiotic supplementation (Vidal et al., 2008). E. coli BW25113 (lacY::kan) obtained from the Keio Collection (Baba et al., 2006) was used as the lacY donor strain. P1 bacteriophage was used to transfer the mutation into the host strain. The helper plasmid, pCP20, encoding FLP recombinase and temperature sensitive replication (Doublet et al., 2008), was used to eliminate antibiotic resistance from the host genome. 2.2. Media, chemicals and other reagents LB (Lennox Broth) medium, with a composition of 10 g L−1 peptone, 5 g L−1 yeast extract and 10 g L−1 NaCl, was used for pre-cultures. LA (Lennox Agar) plates were prepared with LB supplemented with 1.25% microbial agar. Solutions were filter sterilized using a Millex® GS 0.22 ␮m filter from Millipore. A stock solution of kanamycin (Sigma, 100 mg mL−1 ) was prepared in milliQ water, filter sterilized and stored at 4 ◦ C. Stock solutions of ampicilin (Sigma, 100 mg mL−1 ) were prepared in 50% (v/v) ethanol, filter sterilized, and stored at −20 ◦ C. Stock solutions of chloramphenicol (Sigma, 30 mg mL−1 ) were prepared in milliQ water, filter sterilized, and stored at −20 ◦ C. IPTG (Isopropyl ␤-d-1-thiogalactoryranoside) was purchased from Sigma–Aldrich and the stock solution was prepared by dissolving 2.38 g into 100 mL milliQ water and filter-sterilized in order to obtain a stock solution of 100 mM and stored at −20 ◦ C. The defined medium (DM) for shake flask cultures was composed of (g L−1 ) 5 glucose, 11.9K2 HPO4 , 2.4KH2 PO4 , 1.8NaCl, 3(NH4 )2 SO4 , 0.11MgSO4 ·7H2 O, 0.01FeCl3 , 0.03 thiamine and 0.72 mL L−1 of trace elements solution. The batch phase for bioreactor cultivations was composed of (g L−1 ) 20 glucose, 11.9K2 HPO4 , 2.4KH2 PO4 , 1.8NaCl, 3(NH4 )2 SO4 , 0.45MgSO4 ·7H2 O, 0.02FeCl3 , 0.1 thiamine and 2.86 mL L−1 of trace elements solution. Feedstock medium for high-cell-density fed-batch fermentations consisted of (g L−1 ) 478 glucose, 9.7MgSO4 ·7H2 O, 0.5FeCl3 , 0.34 thiamine, 64 mL L−1 trace elements solution. Phosphates were not included in the feeding solution for fed-batch cultures in order to avoid co-precipitation with magnesium salts. Instead, a concentrated phosphate solution containing 500 g L−1 K2 HPO4 and 100 g L−1 KH2 PO4 was pulsed during the fed-batch phase to avoid their depletion when necessary (calculated yield YX/P = 18 g DCW g P−1 ) (Ruiz et al., 2011). Formic acid (98% purity) was supplied from Panreac, and milliQ water was employed for HPLC analysis. MS solution was prepared in distilled water with, 4.5 g L−1 KH2 PO4 , 10.5 g L−1 K2 HPO4 , 1 g L−1 (NH4 )2 SO4 , 0.5 g L−1 Na3 C3 H5 O(COO)3 , 0.05 g L−1 MgSO4 ·7H2 O, 1 mL L−1 (NH4 )2 MoO4 , 1 mL L−1 Na2 SeO4 and 1 mL L−1 E. coli sulphur free salts, sterilized by autoclaving 15 min 121 ◦ C.

A. Fernández-Castané et al. / Journal of Biotechnology 157 (2012) 391–398

2.3. Transduction procedure A lacY mutation derived from the Keio collection was transferred by bacteriophage P1-mediated transduction into E. coli strain M15glyA with selection for kanamycin resistant transductants. Antibiotic resistant donor strains were grown in LB supplemented with 2 mM CaCl2 (LB-Ca2+ ) until the optical density at 650 nm had reached 0.7–0.8. The stock of bacteriophage P1 was serially diluted in LB-Ca2+ to give a range from a 10−1 dilution to 10−6 . Lennox agar was supplemented with 0.2% glucose and 2 mM CaCl2 and 1 mL aliquots were transferred to 6 sterile test tubes containing 2 mL LB-Ca2+ at 45 ◦ C. Donor culture (0.1 mL) and a dilution of bacteriophage (0.1 mL) were added to each tube of soft agar and after mixing the whole contents of the tube were poured over a supplemented LA plate. The plates were incubated at 37 ◦ C overnight. LB-Ca2+ (2 mL) was added to plates with a ‘lacey’ pattern of plaque formation, where plaques were very close together, but did not show zones of confluent lysis. The soft agar was broken up with a dry glass spreader and homogenized with 1 mL chloroform. The mixture was centrifuged (8000 × g, 15 min), and the clear supernatant containing the phage was stored in 1 mL chloroform at 4 ◦ C. Recipient strains were grown in 20 mL LB-Ca2+ until the optical density at 650 nm had reached 0.7–0.8. The bacteria were collected in three separate aliquots by centrifugation (3600 × g, 3 min) and each cell pellet was resuspended in 0.5 mL LB-Ca2+ . The bacteriophage propagated on the donor bacterium was diluted 1:10 using LB-Ca2+ . Concentrated P1 (0.1 mL) was added to the first tube, diluted P1 (0.1 mL) was added to the second tube and the third tube was left as a no P1 control. All three tubes were incubated statically at 37 ◦ C for 18 min, just under the time for a single cycle of phage replication. MS (1 mL) was added to each tube then the bacteria were collected by centrifugation (3600 × g, 3 min). The supernatant was discarded, and the bacteria were resuspended in 4 mL MS. The bacteria were collected by centrifugation (3600 × g, 3 min) and washed three further times to remove excess P1. The final cell pellet was resuspended in 1 mL LB and aerated at 37 ◦ C for 2 h to allow the bacteria to recover, and antibiotic resistance proteins to be expressed. Bacteria (0.1 mL) were plated onto selective plates and incubated at 37 ◦ C overnight. 2.4. PCR verifications Three PCRs were used to show that mutants had the correct structure. A freshly isolated colony was resuspended in 50 ␮L sterile water with a plastic tip and subsequently incubated for 10 min at 95 ◦ C. 5 ␮L portions were used in separate PCR reactions. Common test primers included k1 and k2 that are described elsewhere (Datsenko and Wanner, 2000). Nearby locus-specific primers 5P (5 CAGGTAGCAGAGCGGGTAAA 3 ) and 3T (5 ACATGACTTCCGATCCAGAC 3 ) were designed with Vector NTI 4.0 software to verify simultaneous loss of the parental fragment and gain of the new mutant fragment, and also to verify the presence of the scar sequence after elimination of the resistance gene. Genomic DNA of the lacY strain was sequenced and afterwards compared to the expected scar and the E. coli k-12 sequence from the NCBI databank (GenBank ID: NC 000913.2). Control colonies that were known mutant or parental strains were always tested. PCR SuperMix Hi-Fi Kit (Invitrogen) and PCR GoTaq MasterMix (Promega) were used. Agarose gel (1%) electrophoresis was used and GeneRuler 1 kb DNA Ladder was used as a marker (Fermentas). 2.5. Preparation of electrocompetent cells and transformation Electrocompetent cells were prepared to transform pCP20 into E. coli M15glyA lacY::kan and to co-transform pQE␣␤rham and the low-copy number pREP4 plasmids into E. coli M15glyAlacY.

393

In both cases, 50 mL LB cultures at 37 ◦ C were grown to an OD600 nm ≈ 0.8 and then were made electrocompetent by concentrating 100-fold and washing 4 times with ice-cold 10% glycerol. A Gene Pulser® II electroporator from Bio-Rad was used according to the manufacturer’s recommended protocols. 50 ␮L competent cells were transformed with 5 ␮L plasmid and 1 mL SOC medium was immediately added, and incubated for 1 h at 37 ◦ C. Cells were plated onto LA to select for bacteria that were CmR + AmpR or AmpR + kanR for pCP20 and [pQE␣␤rham and pREP4] transformations, respectively. Correct co-transformation with pQE␣␤rham and pREP4 for RhuA production were re-verified isolating the plasmids using Miniprep Kit (Promega) according to manufacturer’s instructions and subsequent digestion with HindIII endonuclease for 1.5 h at 37 ◦ C. Agarose gel electrophoresis was used to verify the correct size of both plasmids. 2.6. Fermentation and growth conditions The lacY strain was grown in shake flasks (100 mL) in DM in order to assess possible differences between the mutant and parent strain in specific growth rate (), biomass/glucose yields (Yx/s ) and acetate production. Substrate limiting fed-batch cultivations were carried out using a Biostat® B bioreactor (Braun Biotech Int.) with a 2 L fermentation vessel equipped with pH, dissolved oxygen and temperatures probes (Mettler Toledo, Columbus, OH, USA). The digital control unit (DCU) controlled the pH, stirring, temperature and dissolved oxygen of bioreactor. A microburette (MB, Crison Instruments MICRO BU 2030) with a 2.5 mL syringe (Hamilton) was used for discrete feed addition (Ruiz et al., 2009). The specific growth rate () was kept constant by setting a predefined exponential feeding profile (Pinsach et al., 2008b). Three fed-batch fermentations were performed at constant  (0.22 h−1 ) under the same conditions, but with inducer concentrations that were 10, 20 and 200 ␮M for the both the lacY mutant and the parent strain. Protein production and IPTG distribution profiles in both the medium and inside the biomass were analysed. Induction of RhuA production was carried out at 20 g L−1 DCW (biomass dry cell weight) in all cases to obtain the final concentrations of IPTG inside the reactor as stated above. Volume of cells was calculated according to biomass concentration and assuming a volume of 0.0023 L g−1 DCW (Bennett et al., 2008) to enable IPTG concentration calculations inside the biomass. 2.7. Analytical methods Growth of E. coli was monitored by optical density measurements at a wavelength of 600 nm using a spectrophotometer (Uvicon 941 Plus, Kontrol). Samples were diluted with distilled water until the final OD600 nm value was within the range of 0.3–0.9. Biomass was expressed as dry cell weight (DCW), 1 OD600 nm is equivalent to 0.3 g L−1 DCW (Vidal et al., 2005). For determination of glucose and acetate concentration in the medium, 1 mL of culture was centrifuged. The supernatant was filtered (0.45 ␮m) and glucose was determined with the biochemical analyser YSI 2700 (Yellow Spring Systems) while acetate was assessed by HPLC. To achieve cell disruption, cells were adjusted to an OD600 nm of 4 with Tris–HCl 100 mM pH 7 buffer, placed in ice and sonicated with four 15 s pulses at 50 W with 2 min intervals in ice between each pulse using a Vibracell® model VC50 (Sonics & Materials). Cellular debris was removed by centrifugation and the clear supernatant was collected for product analysis (Vidal et al., 2008). Total protein content was determined by means of the Bradford method using a Coomassie® Protein Assay Reagent Kit (Thermo Scientific).

394

A. Fernández-Castané et al. / Journal of Biotechnology 157 (2012) 391–398

single quadrupole and using a LC-10AD Solvent delivery system (pump A and B). A Shimadzu FCV-20H2 valve unit was used in order to divert the flux. The injection was made with a Shimadzu SIL-10AD automatic injector and data analysis was processed with Lab Solutions 3.04 software. Samples were kept in the autoinjector at room temperature. Medium sample preparation was done by centrifuging the broth and latter filtration (0.45 ␮m) of the supernatant. Samples were diluted to reach a concentration within the calibration curve range. Chromatographic and mass spectrometer conditions are described elsewhere (Fernández et al., 2010).

3. Results 3.1. Construction of lac-permease deficient E. coli M15glyAlacY

Fig. 1. Comparative growing profiles and acetate production levels in shake flask cultures of the parent strain E. coli M15glyA [pREP4] pQ␣␤rham (parent) and the new lac-permease deficient strain E. coli M15glyAlacY [pREP4] pQ␣␤rham (lacY) in defined medium (DM).

To determine the percentage of RhuA among the rest of intracellular soluble proteins, NuPAGE® 12% Bis–Tris gels were used according to the manufacturer’s instructions (Invitrogen). Protein concentration was quantified using Kodak Digital Science® 1D 3.0.2 densitometry software. Determination of acetate concentration in the culture medium was performed on a HPLC Series 1050 supplied by Hewlett Packard and equipped with a HP 1047A IR detector operating at a wavelength of 210 nm. Compounds were separated on a 300 mm × 7.8 mm Aminex HPX-87H column purchased from BioRad® . The mobile phase was prepared with sulphuric acid (0.005 M) in Milli-Q water. 30 min of equilibration are required before the injection. The flow rate was 0.6 mL min−1 and the analysis was performed at room temperature. 20 ␮L of standard/sample were directly injected into the column. IPTG analysis was performed on a Shimadzu Prominence liquid chromatograph with an UV/Vis detector operating at a wavelength of 210 nm, coupled to a mass spectrometer Shimadzu 2010A equipped with an ESI (electro spray ionization) interface and a

In order to construct the E. coli strain M15glyAlacY, a two step strategy was implemented as described in Section 2. Both the gene disruption and genetic marker removal steps were verified by PCR. Cells were co-transformed with pQE␣␤rham and pREP4 plasmids. Correct plasmid sequences were verified by purification and latter digestion with HindIII endonuclease, relative to a parental strain. Agarose gel electrophoresis was used to verify the size of the digestion products. The strain was stored at −80 ◦ C in cryo-vials. 3.2. Preliminary experiments with E. coli M15glyAlacY pQ˛ˇrham [pREP4] Preliminary shake flasks of both the parent strain and M15glyAlacY, transformed with pREP4 and pQE␣␤rham were carried out in triplicate in a defined medium (DM) with 5 g L−1 glucose as initial sole carbon source. As shown in Fig. 1, specific growth rate of the new construct was significantly lower ( 0.26 h−1 ) than the parent strain ( 0.54 h−1 ). Lower acetate accumulation was observed in the lacY strain. The calculated apparent biomass to substrate yield during exponential growth (Y(x/s) ) g DCW g−1 glucose was 0.43 for both strains while apparent acetate to biomass yields were 0.55 and 0.44 g acetate g−1 DCW for lacY and parent strain, respectively.

Fig. 2. Biomass, substrate, acetate and specific RhuA content profiles relative to time in a substrate-limited fed-batch culture. E. coli M15glyAlacY cultures transformed with [pREP4] and pQE␣␤rham were induced with a single pulse of 200 ␮M IPTG. The vertical solid line indicates the moment at which the feeding started (t = 14.30 h) while the vertical dashed line indicates the time when the pulse of IPTG was added into the culture in order to induce the overexpression of RhuA (tind = 18.79 h).

A. Fernández-Castané et al. / Journal of Biotechnology 157 (2012) 391–398

395

Table 1 Comparison of the percentage of inducer remaining in medium when RhuA production was maximum from the parent and lacY mutant strain at different IPTG levels. Inducer (␮M)

I/X0 (␮mol IPTG g−1 DCW)

␮mol added

10 20 200

0.5 1 10

8.7–7.9a 18–17.6a 178

a

Fig. 3. Comparison of specific RhuA production (mg RhuA g−1 DCW) between the parent and lacY mutant strain induced with 0.5, 1 and 10 ␮mol IPTG g−1 DCW, being 10, 20 and 200 ␮M, respectively.

3.3. Fed-batch substrate limiting fermentations Six fed-batch fermentations were performed using the predefined exponential feeding profile described in Section 2, three for each counterpart strains. Pulse induction was performed when 20 g DCW L−1 (66 OD600 nm ) were achieved, at IPTG concentrations of 10, 20 and 200 ␮M at induction time. Fig. 2 shows, as an example, the time profiles of glucoselimited fed-batch fermentation for RhuA production performed with the lacY strain. By monitoring the pO2 decreasing profile, it was observed that the lag phase at the beginning of the batch culture was significantly longer (2.5 h) than for the parent strain. In this example (Fig. 2), the specific growth rate () during the fedbatch phase was 0.20 h−1 , very close to the set point (0.22 h−1 ). Inducer was added by a single pulse of IPTG to reach 200 ␮M, being the ratio inducer/biomass (I/X0 ) = 10 ␮mol IPTG g−1 DCW. The duration of the induction period depends upon the initial inducer concentration, being 2.5 h in this case. The higher the concentration of IPTG, the sooner the metabolic burden occurs and growth rate decreases due to redirection of nutrients. The mean specific growth rate () during the induction period was 0.08 h−1 . Glucose concentration in the medium was maintained to values close to zero along the whole induction period by off-line measuring of glucose concentration and stopping the feed supply manually in order to avoid glucose accumulation that may lead to RhuA proteolysis, as reported in the literature (Ruiz et al., 2011). Acetate concentration was close to zero during the entire fermentation. Fig. 2 also shows the time evolution of the biomass concentration and specific RhuA amount (mg of recombinant protein per gram DCW), reaching 75 mg RhuA g−1 DCW. Comparison of RhuA production in fed-batch fermentations between both strains is shown in Fig. 3. As can be seen, significantly lower aldolase levels are obtained for the lacY strain in all cases. The production of RhuA in terms of mg g−1 DCW for the parent strain has been described to be dependent on the I/X0 ratio and presenting a maximum at I/X0 = 1 as reported in Ruiz et al. (2011). This fact is not observed for the lacY strain, and an almost constant RhuA amount was reached at inducer concentration of 20 and 200 ␮M IPTG. In summary, RhuA production is significantly affected when lacY is disrupted. Different production profiles are observed relative to the parent strain. 3.4. IPTG distribution profiles in medium and biomass The obtained results for medium and intracellular IPTG concentration evolution with time after induction are presented in Fig. 4A–F, for the six fermentations assayed. As previously reported

IPTG remaining in medium % Parent

lacY

68.9 57.8 84.3

80.8 91.8 95.8

Parent and lacY strain, respectively.

(Fernández et al., 2010), intracellular IPTG concentration was calculated from the initial IPTG added into the fermentor (␮mol) minus the amount directly measured and the amount of inducer removed when sampling along the fermentation (mass balances). As can be observed in Fig. 4A, C and E; the higher the initial inducer concentration, the faster the depletion of IPTG from the medium (initial rates are presented later in Fig. 5). In all cases, for the lacY strain, the IPTG concentration change with time followed a nearly linear behaviour, which has been fitted to a straight line. For the parent strain, inducer depletion was faster. The intracellular IPTG concentration was higher than in the medium in all cases. This evidence indicates that lac-permease has a crucial role in IPTG transport into the cell. For the lacY strain profiles, the medium and intracellular concentrations are of the same order during the whole induction period. Calculated intracellular inducer concentration is never significantly higher than in the medium, taking into account that small deviations in medium concentration data lead to a high variation in the calculated intracellular value. In fact, a difference of ±0.5 ␮M in the medium gives an error of ±4 ␮M in the intracellular IPTG concentration. In summary, the results for the lacY strain are compatible with the assumption of diffusional transport alone. For the parent strain (Fig. 4B, D and F), calculated intracellular concentrations are significantly higher inside the biomass than in medium and this is likely due to the lac-permease role. In Table 1, the percentage of IPTG remaining in medium when the production of RhuA was found to be maximum is presented. It is worth stating that, in all cases, only a small fraction of the initial inducer amount enters the biomass. The remaining inducer concentration in the medium is considerably lower for the parent strain than for the lacY. 4. Discussion As indicated in Section 1, the repeated use of Datsenko and Wanner method is limited (Lee et al., 2009). The parent strain used in this study, E. coli M15glyA, was already knocked-out for the glyA gene in a previous work using this technique (Vidal et al., 2008). Several attempts to disrupt lacY using the Datsenko and Wanner (2000) procedure were attempted but no successful mutants were obtained (results not shown). Thus, P1-mediated transduction was chosen as an alternative to the ␭-Red system in order to disrupt lacY, since it is known that many bacterophages encode their own homologous recombination system (Smith, 1988). As a consequence, we could successfully generate a double knock-out, in order to study the role of lacY, the second structural gene of the lac operon that encodes the transmembrane protein transport related lac-permease (Kaback et al., 2001). After co-transformation and colony selection of antibiotic resistant transformants, the correct sequence and the existence of no structural rearrangements of the vectors were verified, since in previous experiments we found fusion of both plasmids, probably because of the existence of homologous regions that might spontaneously recombine. Another reason for this plasmid fusion could

396

A. Fernández-Castané et al. / Journal of Biotechnology 157 (2012) 391–398

Fig. 4. IPTG distribution profiles of the parent and lacY mutant strains. A, C and E show the IPTG concentration in medium while B, D, and F show the calculated intracellular concentration. Three levels of initial IPTG concentration were studied for both strains: 10 (A and B), 20 (C and D) and 200 (E and F) ␮M, being I/X0 0.5, 1 and 10 ␮mol IPTG g−1 DCW, respectively.

have been intermolecular transposition of regions between plasmids (Eichenbaum and Livneh, 1998; Shiga et al., 1999; Périchon et al., 2008). Preliminary shake flask experiments demonstrated that the specific growth rate of the mutant strain was lower than of the parent strain. It is well reported in the literature that in E. coli, the PTS is the main pathway for glucose uptake and regulates the uptake of various non-PTS sugars such as lactose. The phosphotransferase system inhibits non-PTS inducer uptake by PTS sugars (inducer exclusion), and also regulates the synthesis of cyclic AMP (catabolite repression) (Postman et al., 1993; Saier, 1989). It is

reported that expression of lactose permease (lacY) is allosterically regulated by the PTS employing a mechanism that involves the direct binding of the glucose-specific enzyme IIA (IIAGlc ) to the permease (Nelson et al., 1983; Hoischen et al., 1996). Our results show that the lac-permease deficient strain had not only a lower maximum specific growth rate than its parent strain, but also a significantly lower production of acetate. Since the enzyme IIAGlc is synthesized constitutively (Saier and Roseman, 1976) and lacpermease bound to dephosphorylated enzyme IIAGlc must be in equilibrium (Saier et al., 1983), it can be postulated that a higher proportion of IIAGlc remains phosphorylated due to the lack of lacY.

A. Fernández-Castané et al. / Journal of Biotechnology 157 (2012) 391–398

Fig. 5. Comparison of the estimated initial uptake rates for the parent strain and its lacY derived mutant at different IPTG levels.

This phosphorylation diminishes the activity of the PTS and consequently reduces the glucose overflow in Erlenmeyer cultures using DM medium with glucose as the sole carbon source. However, for substrate limiting fed-batch experiments, these differences were not observed since the growth rate was kept constant, being lower than max , by setting an exponential feeding profile. Recombinant protein levels in fed-batch cultures showed great differences when comparing the counterpart strains. As commented in Section 3, the production of RhuA depends on the initial (I/X0 ) ratio for the parent strain. This indirect proportionality to the initial IPTG concentration has been reported for experiments employing several number of IPTG concentrations in the set range (Ruiz et al., 2011). As shown in Fig. 3, RhuA concentration was significantly lower for lacY strain for all of the initial IPTG concentrations assayed, without a clear dependency on (I/X0 ). For both strains, the results show that higher calculated intracellular concentrations of inducer do not mean higher protein production levels directly. This explanation is in agreement with the results obtained regarding RhuA production for the parent strain, in which maximum protein yields are obtained at inducer/biomass ratio, (I/X0 ) = 1. As stated in Section 1, there are some publications related to the study of mechanisms of transport of IPTG across the cell membrane but yet, it is a controversial issue because there was not any method available for direct inducer quantification. Measured IPTG in the medium and calculated intracellular inducer concentrations in the parent strain showed different distribution profiles of IPTG along the induction period. For the parent strain, medium IPTG concentration decreased slowly for a low IPTG concentration, while a sudden decrease of IPTG concentration in the medium was observed at higher inducer concentrations. This indicated that initial uptake rates (qI0 , ␮M h−1 ) of IPTG from the medium depend upon the initial inducer concentration. qI0 values were estimated from fitted curves, and results are shown in Fig. 5. As can be seen for the lacY strain, qI0 has a linear relationship with the initial inducer concentration. This is additional evidence in favour of a diffusional mechanism. On the other hand, qI0 values are always higher for the parent compared with lacY strain at all inducer levels, showing a non-linear behaviour. Calculated intracellular concentrations were higher than in the medium in the parent strain showing that IPTG uptake may be mediated by active transport involving lactose permease. This result is in agreement with some authors reporting that lactose permease plays an important role in transporting IPTG (Hansen et al., 1997; Jensen and Hammer, 1998). However, other studies mention that the contribution of the lactose permease is not so significant in E. coli (Beckwith and Reznikoff, 1979; Beckwith, 1987). The latter studies employed indirect protein production data to support these hypotheses.

397

By studying IPTG distribution profiles in the lacY strain it was found that calculated intracellular concentrations were not significantly higher than the concentration in medium, indicating that IPTG transport may not be mediated by active transport and only diffusion across the membrane occurs. It is important to take into account that calculated intracellular concentrations were obtained from measured data in medium and by mass balances. As observed in Fig. 4, at some points during the experiment, higher intracellular concentrations were calculated, compared to those measured in medium. These differences were not significant since the relative standard deviation (RSD) of measured IPTG is <15% as reported in Fernández et al. (2010). Results showed in Table 1 demonstrate that even inducing the overexpression of recombinant proteins at low IPTG concentrations, an excess of inducer is employed since most of it remains in the medium. Furthermore, the fact that lac-permease catalyses IPTG active transport is also supported when comparing the % of inducer remaining in medium between the parent and lacY strains at each level of induction concentration. 5. Conclusions This work presents a contribution to the study of the transport mechanisms involved in IPTG uptake. It faces a controversial topic regarding the role of lactose permease in IPTG transport in high cell density cultures, employing a non-structured approach. A lacpermease deficient mutant has been successfully constructed and IPTG distribution profiles were compared between the lacY mutant and the parent strain. The observed differences can be attributed to the role of lac-permease that might transport IPTG actively across the cell membrane, while when lacking this transmembrane protein only diffusion of IPTG is supposed to take place. When using the same inducer concentration, RhuA levels were found to be lower when lacking the lac-permease indicating that there is a relationship between the intracellular inducer and the overexpression of the recombinant protein. It is expected that the obtained results will be of great value to elucidate mechanisms of transport and recombinant protein production. The work includes experimental quantification of inducer levels in medium and calculated inside the biomass by mass balances, being the latter which determines the overexpression of the product of interest. Author’s contributions AFC: All experiments and manuscript preparation. CV: Knockout experiments and manuscript revision. GC and JSL research design and manuscript preparation. All authors have read and approved the final manuscript. Acknowledgements This work has been supported by the Spanish MICINN, project CTQ 2008-00578, and by DURSI 2009SGR281 Generalitat de Catalunya. The Department of Chemical Engineering of Universitat Autònoma (UAB) de Barcelona constitutes the Biochemical Engineering Unit of the Reference Network in Biotechnology of the Generalitat de Catalunya (XRB). AFC acknowledges UAB for a predoctoral grant. Thanks are due to Pau Ferrer and Jeff Cole for their advice on molecular biology. References Andersson, L., Yang, S., Neubauer, P., Enfors, S.O., 1996. Impact of plasmid presence and induction on cellular responses in fed batch cultures of Escherichia coli. J. Biotechnol. 46, 255–263.

398

A. Fernández-Castané et al. / Journal of Biotechnology 157 (2012) 391–398

Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K.A., Tomita, M., Wanner, B.L., Mori, H., 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol., doi:10.1038/msb4100050. Beckwith, J.R., 1987. The lactose operon. In: Escherichia coli and Salmonella typhimurium, vol. 2. Cell Mol Biol American Society for Microbiology, Washington, DC, pp. 1444–1452. Beckwith, J.R, Reznikoff, W.S., 1979. Lac: The Genetic System. In the Operon. Cold Spring Laboratory Harbor, NY, pp. 11–30. Bennett, B.D., Yuan, J., Kimball, E.H., Rabinowitz, J.D., 2008. Absolute quantitation of intracellular metabolite concentrations by an isotope ratio-based approach. Nat. Protoc. 3 (8), 1299–1311. Bentley, W.E., Mirjalili, N., Andersen, D.C., Davis, R., Kompala, D.S., 2009. Plasmidencoded protein: the principal factor in the metabolic burden associated withrecombinant bacteria. Biotechnol. Bioeng. 102 (5), 1284–1297. Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Echerichia coli K-12 using PCR products. PNAS 97 (12), 6640–6645. Donovan, R.S., Robinson, C.W., Glick, B.R., 1996. Review: optimizing inducer and culture conditions for expression of foreign proteins under the control of the lac promoter. J. Ind. Microbiol. 16, 145–154. Doublet, B., Douard, G., Targant, H., Meunier, D., 2008. Antibiotic marker modifications of (Red and FLP helper plasmids, pKD46 and pCP20 for inactivation of chromosomal genes using PCR products in multidrug-resistant strains. J. Microbiol. Methods 75, 359–361. Dunaway, M., Olson, J.S., Rosenberg, J.M., Kallai, O.B., Dickerson, R.E., Matthews, K.S., 1980. Kinetic studies of inducer binding to lac repressor–operator complex. J. Biol. Chem. 21 (255), 10115–10119. Eichenbaum, Z., Livneh, Z., 1998. UV light induces IS10 transposition in Escherichia coli. Genetics 149 (3), 1173–1181. Fernández, A., Ruiz, J., Caminal, G., López-Santín, J., 2010. Development and validation of a liquid chromatography–mass spectrometry assay for the quantitation of IPTG in E. coli fed-batch cultures. Anal. Chem. 82, 5728–5734. Genetic sequence database at the National Center for Biotechnical Information (NCBI), 2011. GenBank ID: NC 000913.2 (accessed July 8th, 2011). Glick, B.R., 1995. Metabolic load and heterologous gene expression. Biotechnol. Adv. 13 (2), 247–261. Hansen, L.H., Knudse, S., Sorensen, S.J., 1997. The effect of the lacY gene on the induction of IPTG inducible promoters, studied in Escherichia coli and Pseudomonas fluorescens. Curr. Microbiol. 36, 341–347. Herzenberg, L.A., 1959. Studies on the induction of beta-galactosidase in a cryptic strain of Escheriachia coli. Biochim. Biophys. Acta 31 (2), 525–538. Hoischen, C., Levin, J., Pitaknarongphorn, S., Reizer, J., Saier Jr., M.H., 1996. Involvement of the central loop of the lactose permease of Escherichia coli in its allosteric regulation by the glucose-specific enzyme IIA of the phosphoenolpyruvatedependent phosphotransferase system. J. Bacteriol. 178 (20), 6082–6086. Jensen, P.R., Hammer, K., 1998. Artificial promoters for metabolic optimization. Biotechnol. Bioeng. 58, 191–195. Jensen, P.R., Westerhoff, H.V., Michelsen, O., 1993. The use of lac-type promoters in control analysis. Eur. J. Biochem. 211, 985–991. Kaback, H.R., Sahin-Tóth, M., Weinglass, A.B., 2001. The kamikaze approach to membrane transport. Nat. Rev. Mol. Cell Biol. 2, 610–620. Lee, D.J., Bingle, L.E.H., Heurlier, K., Pallen, M.J., Penn, C.W., Busby, S.J.W., Hobman, J.L., 2009. Gene doctoring: a method for recombineering in laboratory and pathogenic Escherichia coli strains. BMC Microbiol., doi:10.1186/1471-2180-9252. Lewis, M., 2005. The lac repressor. C. R. Biol. 328, 521–548. Nelson, S.O., Wright, J., Postma, P.W., 1983. The mechanism of inducer exclusion. Direct interaction between purified IIIglc of the phosphoenolpyruvate: sugar phosphotransferase system and the lactose carrier of Escherichia coli. EMBO J. 2, 715–720. Noel, J.T., Pilyugin, S.S., Narang, A., 2009. The diffusive and carrier efflux have a strong effect on the bistabillity of the lac operon in Escherichia coli. J. Theor. Biol. 256, 14–28.

Oehler, S., Alberti, S., Benno Müller-Hill, B., 2006. Induction of the lac promoter in the absence of DNA loops and the stoichiometry of induction. Nucleic Acids Res. 2 (34), 606–612. O’Gorman, R.B., Rosenberg, J.M., Kallai, O.B., Dickerson, R.E., Itakura, K., Riggs, A.D., Matthews, K.S., 1980. Equilibrium Binding of Inducer to lac repressor operator DNA complex. J. Biol. Chem. 21 (255), 10107–10114. Périchon, B., Bogaerts, P., Lambert, T., Frangeul, L., Courvalin, P., Galimand, M., 2008. Sequence of conjugative plasmid pIP1206 mediating resistance to aminoglycosides by 16S rRNA methylation and to hydrophilic fluoroquinolones by efflux. Antimicrob. Agents Chemother. 52 (7), 2581–2592. Pinsach, J., de Mas, C., López-Santín, J., Striedner, G., Bayer, K., 2008a. Influence of process temperature on recombinant enzyme activity in Escherichia coli fedbatch cultures. Enzyme Microb. Technol. 43, 507–512. Pinsach, J., de Mas, C., López-Santín, J., 2008b. Induction strategies in fedbatch cultures for recombinant protein production in Escherichia coli: application to rhamnulose 1-phosphate aldolase. Biochem. Eng., doi:10.1016/j.bej.2008.04.013. Postman, P.W., Lengeler, J.W., Jacobson, G.R., 1993. Phosphoenolpyruvate: carbohydrate phosphotransferase system of bacteria. Microbiol. Rev. 57, 911–922. Rao, C.V., Wolf, D.M., Arkin, A.P., 2002. Control, exploitation and tolerance of intracellular noise. Nature 420, 231–237. Ruiz, J., González, G., de Mas, C., López-Santín, J., 2011. A semiempirical model to control the production of a recombinant aldolase in high cell density cultures of Escherichia coli. Biochem. Eng. J. 55, 82–91. Ruiz, J., Pinsach, J., Álvaro, G., González, G., de Mas, C., Resina, D., 2009. Alternative production process strategies in E.coli improving protein quality and downstream yields. Process Biochem. 44, 1039–1045. Saier Jr., M.H., 1989. Protein phosphorilation and allosteric control of inducer exclusion and catabolite repression by the bacterial phosphoenolpyruvate: sugar phosphotransferase system. Microbiol. Rev. 53, 109–120. Saier Jr., M.H., Novotny, M.J., Comeau-Fuhrman, D., Osumi, T., Desai, J.D., 1983. Cooperative binding of the sugar substrate and allosteric regulatory protein (enzyme IIIGlc of the phosphotransferase system) to the lactose and melibiose permeases in Escherichia coli and Salmonella typhimurium. J. Bacteriol. 155 (3), 1351–1357. Saier Jr., M.H., Roseman, S., 1976. The crr mutation: its effect on repression of enzyme sysnthesis. J. Biol. Chem. 251, 6598–6605. Serra-Moreno, R., Acosta, S., Hernalsteens, J.P., Jofre, J., Muniesa, M., 2006. Use of the lambda Red recombinase system to produce recombinant prophages carrying antibiotic resistance genes. BMC Mol. Biol., doi:10.1186/1471-2199-7-31. Sevastyanovich, Y., Alfasi, S., Overton, T., Hall, R., Jones, J., Hewitt, C., Cole, J., 2009. Exploitation of GFP fusion proteins and stress avoidance as a generic strategy for the production of high-quality recombinant proteins. FEMS Microbiol. Lett. 299, 86–94. Shiga, Y., Sekine, Y., Ohtsubo, E., 1999. Transposition of IS1 circles. Genes Cells 4 (10), 551–561. Smith, G.R., 1988. Homologous recombination in procaryotes. Microbiol. Rev. 52, 1–28. Striedner, G., Cserjan-Puschmann, M., Pötschacher, F., Bayer, K., 2003. Tuning the transcription rate of recombinant protein in strong Escherichia coli expression systems through repressor titration. Biotechnol. Prog. 19 (5), 1427–1432. Vidal, L., Durany, O., Suau, T., Ferrer, P., Benaigues, M.D., Caminal, G., 2003. Highlevel production of recombinant His-tagged rhamnulose 1-phosphate aldolase in Escherichia coli. J. Chem. Technol. Biotechnol. 78, 1171–1179. Vidal, L., Ferrer, P., Álvaro, G., Benaiges, M.D., Caminal, G., 2005. Influence of induction and operation mode on recombinant rhamnulose 1-phosphate aldolase production by Escherichia coli using the T5 promoter. J. Biotechnol. 118, 75–87. Vidal, L., Pinsach, J., Streidner, G., Caminal, G., Ferrer, P., 2008. Development of an antibiotic-free plasmid selection system based on glycine auxotrophy for recombinant protein production in E.coli. J. Biotechnol. 134, 127–136. Vilar José, M.G., Guet, C.C., Leibler, S., 2003. Modeling network dynamics: the lac operon, a case study. J. Cell Biol. 3, 471–476. Yu, B.J., Kang, K.H., Lee, J.H., Sung, B.H., Kim, M.S., Kim, S.C., 2008. Rapid and efficient construction of markerless deletions in Escherichia coli genome. Nucleic Acids Res. 36 (14), 84.