Evolution and Systematics ofAnopheles:Insights from a Molecular Phylogeny of Australasian Mosquitoes

MOLECULAR PHYLOGENETICS AND EVOLUTION

Vol. 9, No. 2, April, pp. 262–275, 1998 ARTICLE NO. FY970457

Evolution and Systematics of Anopheles: Insights from a Molecular Phylogeny of Australasian Mosquitoes Desmond H. Foley, Joan H. Bryan, David Yeates,* and Allan Saul† Tropical Health Program ACITHN and Department of Entomology, University of Queensland, Brisbane, Queensland 4072, Australia, *Department of Entomology, University of Queensland, Brisbane, Queensland 4072, Australia; and †Tropical Health Program ACITHN, Queensland Institute of Medical Research, Brisbane, Queensland 4029 Australia Received April 1, 1997; revised July 18, 1997

Relationships among the genus Anopheles and its many sibling species-groups are obscure despite the importance of anophelines as the vectors of human malaria. For the first time, the interrelationships and the origin of Australasian members of the subgenus Cellia are investigated by a cladistic analysis of sequence variation within the mitochondrial cytochrome oxidase subunit II gene. Estimated divergence times between many Australasian and Oriental taxa predate the mid Miocene collision of Australasia and Southeast Asia. Phylogenetic analysis suggests that two-way exchanges with Oriental mosquitoes rather than only immigration may have been a characteristic of anopheline paleobiogeography in Australasia. The Australasian fauna is mostly included in a large clade. The medically important Punctulatus Group is monophyletic and appears derived from Oriental stock. Populations within this group from as far apart as Australia and Vanuatu were in contact in the recent past (i.e., 0.35–2.44 mya), supporting dispersal rather than vicariance explanations. Some support for the monophyly of the Myzomyia, Neomyzomyia, and Pyretophorus Series was found. However, the subgenera Anopheles and Cellia and the Neocellia Series are paraphyletic, but branch support at these taxonomic levels was poor. The COII gene shows promise for questions concerning alpha taxonomy but appears to be of limited use for resolving deeper relationships within the Anopheles. r 1998 Academic Press Key Words: phylogeny; systematics; taxonomy; Anopheles; Australia; New Guinea; southwest Pacific; biogeography; malaria; evolution; mitochondrial DNA; CO-II.

INTRODUCTION Despite anopheline mosquitoes being the vectors of human malaria, their origins and phylogenetic relationships remain obscure. The cosmopolitan genus Anopheles (Order Diptera, Family Culicidae) is one of three genera in the subfamily Anophelinae. The others are Bironella, endemic to the Australasian Region, and 1055-7903/98 $25.00 Copyright r 1998 by Academic Press All rights of reproduction in any form reserved.

Chagasia, endemic to southern and central America. The genus Anopheles, proposed by Meigen in 1818, has recently been reviewed (Harbach, 1994) and includes six subgenera, the largest, Anopheles, Cellia, and Nyssorhynchus, being further subdivided in descending order into informal sections, series, groups, subgroups, and complexes. Part of this classification is given in Table 1. This classification has not been tested using modern phylogenetic methods (Harbach, 1994), but instead, relies on intuitive taxonomic interpretations of a limited number of ‘‘overt’’ morphological similarities. Isomorphic species groups highlight the limitations of this approach. Over 90 of the 458 anopheline species reviewed by Harbach (1994) belong to complexes of sibling species. Phylogenetic reconstruction is a neglected area in mosquito vector systematics (Munstermann and Conn, 1997) and a cladistic treatment of the Anopheles may shed light on the origins, evolution, and classification of this important genus. Our interest is principally in anophelines of the Australasian Region, a part of the Australian zoogeographic region, which is separated from the Oriental Region by the Wallace Line (Fig. 1) (Lee and Woodhill, 1944). In particular, we are interested in sibling species of the Punctulatus Group (Neomyzomyia Series), which includes important vectors of malaria and bancroftian filariasis in the southwest Pacific (Lee et al., 1987). They are distributed from the Moluccas in the west through New Guinea and the Solomon Islands to Vanuatu in the east and as far south as northern Australia (Belkin, 1962). Allozyme studies (e.g., Foley et al., 1993, 1994, 1995) have extended the number of species recognized within this group from 5 to 10, not including An. clowi and An. rennellensis, which were unavailable. These 10 species are An. punctulatus, An. koliensis, An. sp. nr punctulatus, and 7 species within the Farauti Complex, which cannot be separated on adult morphology (Foley et al., 1993). Having elucidated so many species within the Punctulatus Group we became interested in its origins and relationship

262

263

PHYLOGENY OF AUSTRALASIAN ANOPHELINES

TABLE 1 Classification of the Genus Anopheles in Relation to Outgroups Used in This Study Category

Name

Family Genus Family Subfamily Genus

Drosophilidae Drosophilaa Culicidae Culicinaea Culexa Aedesa Anophelinaea

Subfamily Genus

Subgenus

Series

Bironellaa Anophelesa Anophelesa Nyssorhynchus Kerteszia Lophopodomyia Stethomyia Celliaa Cellia Series Paramyzomyia Series Myzomyia Seriesa Neocellia Seriesa Pyretophorus Seriesa Neomyzomyia Seriesa Punctulatus Groupa Annulipes Groupa Farauti Complexa

Morphological character

Node

Agreement with molecular

Overall adult shape and resting habit

1

Î

Overall adult shape and resting habit

1

Î

Shape of wing veins and hairs in the larva Shape of wing veins and hairs in the larva Gonocoxites of the male genitalia

2 2 3

X

Gonocoxites of the male genitalia

3

X

Cibarial teeth Cibarial teeth Cibarial teeth Cibarial teeth Number of wing spots Number of wing spots All-dark proboscis

5 6 4 7 8 8 9

Î Î

Î X

Î

X

Î Î

X

Note. The agreement between the phyogeny derived from molecular data and some morphological characters used to distinguish categories is given as well as the node of importance on the single most parsimonious tree from the successively weighted scheme (see Fig. 5 and Discussion). All subgenera are listed as well as all series within the subgenus Cellia. a Taxa investigated in this study.

with other anophelines in the Australasian and Oriental regions. Most members of the subgenus Cellia in Australasia belong to the Neomyzomyia Series and are endemic to this region (Lee and Woodhill, 1944). Exceptions are three Oriental species, An. karwari (Neocellia Series) and An. subpictus s.l. (Pyretophorus Series), which extend to New Guinea, and An. tessellatus (Neomyzomyia Series), which occurs eastward to the Moluccas (Lee et al., 1987). Australasian Anopheles are mainly distributed in the northern parts of the region, but some species are also present throughout continental Australia (Colless and McAlpine, 1970). Various scenarios for the origin and spread of the Australasian Culicidae have been proposed, usually with a west to east dispersal to explain decreasing faunal richness in this direction and morphological affinities with Oriental mosquitoes (e.g., Iyengar, 1960; Belkin, 1962; Steffan, 1966). Many Australasian anophelines near the Wallace Line are limited to land of Australasian origin despite the proximity of Indonesian islands, suggesting a long independent association of mosquitoes with Australasia (cf. Swellengrebel and Rodenwaldt, 1932, with Burret et al., 1991, and Mi-

chaux, 1991). Evidence from plate tectonics suggests the Australian plate collided with Southeast Asia about 15–5 mya (Veevers, 1991). This collision is important for explanations of northern biota intruding into Australasia but has lost appeal as a universal explanation for ‘‘northern’’ elements in the Australian fauna and flora (Truswell et al., 1987; Cranston and Naumann, 1991). The factors determining present day mosquito distribution are unclear but a consideration of phylogenetic relationships may provide an insight. We tested the monophyly of the Punctulatus Group to shed light on its evolution. Sequence variation of cytochrome oxidase subunits appear useful for withingenera phylogenetic comparisons (Simon et al., 1994). Therefore, we used mitochondrial DNA (mtDNA) sequences from the cytochrome oxidase subunit 2 (COII) gene in a phylogenetic reconstruction. We included published sequences and our data from Oriental species and most of the Australasian Cellia to determine whether Australasian fauna are derived or ancestral relative to taxa from other parts of the world. An origin for the Punctulatus Group and evidence concerning the monophyly of some higher informal taxonomic catego-

264

FOLEY ET AL.

FIG. 1. Geographical distribution of collection sites for this study in relation to Oriental and Australian zoogeographic regions.

ries were found but conclusions about deeper relationships were constrained by the choice of gene. MATERIALS AND METHODS Mosquito Collections and Identification Adult female Australasian anophelines were identified using the keys of Belkin (1962) and Lee et al. (1987) and Oriental mosquitoes using the keys of CagampangRamos and Darsie (1970). Species within the Punctulatus Group and the Annulipes Complex (i.e., An. annulipes sp. A, sp. B, sp. D (Green, 1972) and sp. G (Booth and Bryan, 1986) ) were identified by allozyme electrophoresis (e.g., Foley et al., 1993; Foley and Bryan, 1991; unpublished data). In addition, morphology and species distribution (Liehne, 1991) were used to identify tentatively An. annulipes sp. B and sp. D. Details of collection and identification of specimens used in this study are given in Fig. 1 and Table 2. An. subpictus s.l. is a complex of four chromosomally defined sibling species, only one of which (sp. B) has been found in salt water (Suguna et al., 1994). As the specimen in this study was collected from freshwater, it is probably not this spe-

cies. Anopheles nataliae, the third species of the Lungae Complex (i.e., An. lungae, An. solomonis, and An. nataliae) and the remaining six members of the Neomyzomyia Series recorded for Australasia (e.g., Lee et al., 1987) were not available for this study. DNA Extraction Mosquitoes were placed in 1.5-ml microcentrifuge tubes (Eppendorf, Hamburg, Germany) and triturated with 100 µl lysis buffer (0.2 M NaCl, 10 mM Tris–HCl, pH 8, 25 mM EDTA, 0.5% sodium dodecyl sulfate). DNA was then extracted by ethanol precipitation following a modification of the procedure of Bender et al., (1983). The pellet was dried and reconstituted in 20 µl TE buffer (10 mM Tris–HCl, 1 mM EDTA, pH 8.0). PCR and Sequencing The At-LEU (58-ATGGCAGATTAGTGCAATGG-38) and Bt-LYS (58-GTTTAAGAGACCAGTACTTG-38) primers (Liu and Beckenback, 1992), spanning positions 2967–2986 and 3753–3734, respectively, in the complete An. gambiae sequence (Beard et al., 1993), were initially used for both amplification and sequencing of

265

PHYLOGENY OF AUSTRALASIAN ANOPHELINES

TABLE 2 Species, Sample Size, and Collection Details for Mosquitoes According to Their Taxonomic Grouping (Genus, Subgenus, Series) Identification

No.

Collection details

Longitude/Latitute

Code

Bironella Bi. hollandi

1

Mamara (Sols.) [L]

159°538E 9°248S

1

Anopheles (Anopheles) Myzorhynchus Series An. bancroftii

1 1

Darwin (Aust.) [C] Goroka (PNG) [H]

An. filipinae

1 1 1 1 1 2

Anahao (Phil.) [L] Maracdoc (Phil.) [L] Anahao (Phil.) [L] Iratan (Phil.) [A] Wakas (Phil.) [L] Anahao (Phil.) [L]

1 1 1

Sucat (Phil.) [L] Cabayo (Phil.) [L] Luz Viminda (Phil.) [A]

130°508E 12°278S 145°208E 6°18S

2 3

120°178E 14°428N 120°218E 14°398N 120°178E 14°428N 118°418E 9°478N 121°408E 14°28N 120°178E 14°428N

4 5 6 7 8 9–10

121°08E 14°278N 120°238E 14°378N 118°398E 9°438N

11 12 13

120°238E 14°378N 145°458E 5°228S 120°178E 14°428N

14 15 16

152°58E 27°88S 147°108E 19°458S 132°168E 14°288S 146°08E 34°108S 133°568E 23°428S 133°568E 23°428S 146°08E 34°108S 118°418E 9°478N 152°98E 4°178S/145°458E 5°228S 130°468E 12°268S 167°68E 15°248S 132°318E 12°548S 145°208E 16°208S 159°548E 9°248S 160°508E 8°408S 130°508E 12°278S 130°58E 13°578S 145°458E 5°178S 145°408E 5°228S 145°208E 6°18S 145°528E 5°578S 159°538E 9°248S 142°138E 9°148S 136°478E 12°118S 118°418E 9°478N 145°448E 5°228S 145°458E 5°228S 145°448E 5°228S Unknown 130°408E 12°288S 145°128E 17°268S 145°458E 5°178S 145°528E 5°578S 160°508E 8°408S 136°538E 4°448S 145°488E 5°48S 136°538E 4°448S 136°538E 4°448S 159°528E 9°228S 160°88E 9°358S 121°98E 14°448N

17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36–37 38–40 41 42 43 44–46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61–62 63

Anopheles (Cellia) Myzomyia Series

An. flavirostris An. mangyanus

Anopheles (Cellia) Pyretophorus Series An. litoralis An. subpictus s.l.

Anopheles (Cellia) Neocellia Series An. annularis An. karwari

1 1 1

Cabayo (Phil.) Dogia (PNG) [H] Anahao (Phil.)[L] Anopheles (Cellia) Neomyzomyia Series

An. amictus An. annulipes sp A An. annulipes sp B An. annulipes sp D An. annulipes sp G An. balabacensis An. farauti s.s. An. farauti No.2

An. farauti No.3 An. farauti No.4 An. farauti No.5 An. farauti No.6 An. farauti No.7 An. hilli An. kochi An. koliensis An. longirostris An. lungae An. meraukensis An. novaguinensis An. punctulatus

An. sp nr punctulatus An. solomonis An. tessellatus

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 3 1 1 1 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1

Anduramba (Aust.) [C] Burdekin (Aust.) [C] Katherine (Aust.) [C] Griffith (Aust.) [C] Alice Springs (Aust.) [C] Alice Springs (Aust.) [C] Griffith (Aust.) [C] Iratan (Phil.) [A] Rabaul/Agan (PNG) (Colony) Cox Peninsula (Aust.) [C] Fanafo/Velieton (Van.) [H] Cooinda (Aust.)[C] Mossman (Aust.) Poha R. (Sols.) [L] Aikuku (Sols.) [L] Darwin (Aust.) [C] (Aust.) Hudini (PNG) [H] Gonoa (PNG) [H] Goroka (PNG) [H] Tari (PNG) [H] Mamara (Sols.) [L] Boigu Is (Aust.) [L] Nhulunbuy (Aust.) (Colony) Iratan (Phil.) [A] Maraga (PNG) [H] Dogia (PNG) [H] Maraga (PNG) [H] Marawa (Malaita) (Sols.) [L] Cox Peninsula (Aust.) [C] Irvinebank (Aust.) [L] Hudini (PNG) [H] Tari (PNG) [H] Anomasu (Sols.) [L] Newtown (IJ, Ind.) [H] Budip (PNG) [H] Iwaka R. (IJ, Ind.) [H] Newtown (IJ, Ind.) [H] Tassifarona (Sols.) [L] Gold Ridge (Sols.) [L] Lucutan (Phil.) [A]

Note. Specimens marked [L] were collected as larvae, those marked [H] were collected landing on humans, those marked [C] were collected by CO2-baited EVS traps, and those marked [A] were collected from animals. Aust., Australia; IJ, Ind., Irian Jaya, Indonesia; PNG, Papua New Guinea; Phil., Philippines; Sols., Solomon Islands; and Van., Vanuatu.

266

FOLEY ET AL.

the COII gene. Each 25-µl PCR reaction contained 12.5 mM HCl (pH 8.3), 62.5 mM KCl, 625 µM each dNTP, 1.5 units TAQ (Boehringer Mannheim), 3.75 mM MgCl2, 20 pM each primer, and approximately 150 ng DNA template. The PCR program involved 3 cycles at 94°C for 2 min, 37°C for 2 min, and 72°C for 1 min; 35 cycles at 94°C for 30 s, 50°C for 30 s, and 72°C for 1 min; and 72°C for 5 min. Aliquots of reaction mixture (4 µl) were analyzed in ethidium bromide-stained 1% agarose gel (Seakem) by electrophoresis at 100 V for 30 min in TAE buffer. The total remaining reaction product was run in a 3% (NuSieve) agarose gel and the bands were excised. DNA was purified from excised bands using the Bresa-clean Nucleic Acid Purification Kit (Bresatec). The purified product was rehydrated in 20 µl of TE prior to sequencing. Additional primers for the COII gene were also designed on the basis of sequences generated from a subset of taxa to allow for complete sequencing and for those taxa which were difficult to amplify. These were (58-38): AGAT(TA)TTATCTTTT(GA)TTAGAA (position 3006–3026), AAAATGGCAACATGAG (position 3029– 3044), and CA(TC)CAATGATA(TC)TGAAG (position 3335–3351) for the sense strand and TTGCTTTCAGTCATCTAATG (position 3736–3717) for the antisense strand. Gene sequences were obtained using the ABI Prism Dye Terminator FS Cycle Sequencing Ready Reaction Kit, ethanol precipitation protocol 1, and the ABI Prism 377 sequencer. Sequences were aligned using the Pileup program in the GCG software package (Deveraux et al., 1984). Amino acid sequences were translated using Drosophila mitochondrial code (DeBruijn, 1983). Phylogenetic Analysis of COII Sequences Phylogenetic analysis using maximum parsimony was performed using PAUP version 3.0 (Swofford, 1993) and most parsimonious trees were examined in MacClade version 3.0 (Maddison and Maddison, 1992). Outgroups were the published COII sequences of Drosophila yakuba (Clary and Wolstenholme, 1985, GenBank X03240), Ae. aegypti (Ho et al., 1995, GenBank L34412), and Culex quinquefasciatus (Ho et al., 1995, GenBank L34351) and sequences derived from Bironella hollandi. The COII sequences of An. quadrimaculatus sp. A (Mitchell et al., 1993, GenBank L04272) and An. gambiae (Beard et al., 1993, GenBank L20934) were included with the ingroup taxa. Most parsimonious trees were determined with the heuristic search option (100 random stepwise addition replicates) using the tree-bisection-reconnection branch swapping algorithm. Initially, unordered, equally weighted characters were analyzed. As weighting methods based on homoplasy are ‘‘most consistent with cladistic philosophy and practice’’ (Brower and DeSalle, 1994), weighting was performed by successive approximations character weighting (using the rescaled consis-

tency index of Farris (1989) ) in order to give more value to less homoplasious characters identified on the initial unweighted trees. Reweighting was performed to measure the robustness of trees and was iterated until weights did not change (Farris, 1989). Branch support was determined using Bremer support (Bremer, 1994) calculated with AutoDecay 3.0 (Eriksson and Wikstro¨m, 1996). Indices were rescaled according to the method of Bremer (1994) to allow comparison with equal weighted values. For estimates of divergence time involving only transversion distances, we used the Kimura two-parameter formula, which gives the same result as the modified form of the Jukes–Cantor formula used by Beckenback et al. (1993). Nucleotide compositions, numbers of Tv and Ti, proportion of nucleotide differences, and Ti/Tv were calculated by MEGA 1.02 (Kumar et al., 1993). Results Data Sixty-three specimens representing 33 taxa were sequenced, but only one representative of each taxon is shown to aid presentation. These sequences (GenBank U94283–U94315) are also available from the authors on request. The complete sequences contained 684 nucleotides, coding for 228 amino acids (Fig. 2), including ATG for initiation and excluding a T-tRNA for termination. The sequences had a high proportion (71.8–75.5% for the Neomyzomyia Series) of A 1 T. As in Drosophila (Beckenbach et al., 1993) and An. quadrimaculatus sp. A (Mitchell et al., 1993) this high AT ratio is particularly evident at third codon positions (i.e., G 1 C content was 36.5, 33.1, and 7.2% for codons 1, 2, and 3, respectively). Table 3 shows the variable sites classified by codon position and degeneracy level for the Anopheles (Cellia) to aid understanding of the number and nature of sequence characters available for phylogenetic analysis. One-third (n 5 228) of the 684 nucleotide sites analyzed differ, of which 197 are parsimony informative and approximately half include transversions. In the first codon position, 18 of the 40 sites which differ result in inferred amino acid replacements. Only 10 of the 228 second codon positions differ; 6 occur between positions 254 and 392. Of the 228 third codon positions 178 (78%) differ, of which 23 resulted in inferred amino acid replacements. Closely related mtDNA lineages had a Ti:Tv 5 13:1, which reduced to less than 1:1 for species pairs .5% sequence divergence, indicating rapid saturation for transition substitutions. A linear relationship was observed between sequence divergence and transversion differences (not shown). Beckenback et al. (1993) used a similar linear relationship to establish time scales for Drosophila evolution, which we also use for divergence times (Table 4). Brower’s (1994) 2.3%/my relationship between time and uncor-

PHYLOGENY OF AUSTRALASIAN ANOPHELINES

267

FIG. 2. Translated amino acid sequence from a 684-bp sequence of COII showing variable sites in selected samples from Anopheles taxa in relation to outgroups. Dots represent identical amino acids and ‘‘?’’ represents an undetermined amino acid. Collection details are shown in Table 2.

268

FOLEY ET AL.

TABLE 3 Number of COII Gene Bases Which Are Different Among Nucleotide Sites in Specimens of Anopheles (Cellia) Listed in Table 1 First codon Level of degeneracy Identical Transitions Transversions Both Total bases % bases differ/ codon position

Nondegenerate 181 11 5 2 199 7.9

Second codon Twofold 7 21 0 1 29 9.6

Nondegenerate 218 3 5 2 228 4.4

Third codon Twofold

Fourfold Total

46 76 11 12 145

4 3 22 54 83

43.4

34.6

456 114 43 71 684

s.s. and An. punctulatus each showed a maximum of 1.5% uncorrected sequence divergence and An. farauti No. 2, 1.9%. A maximum of two amino acid substitutions resulted from these intraspecific differences. Within the Punctulatus Group, the minimum uncorrected interspecific sequence divergences were lowest between An. farauti No. 2 and An. farauti No. 6 (0.58%) and between An. farauti s.s. and An. farauti No. 7 (1.61%). A maximum of 7.83% divergence was recorded between An. farauti sibling species. Phylogeny

33.3

Note. Degeneracy was determined according to translation from the An. farauti s.s. (25) sequence.

rected sequence divergence was also applied to divergences of less than 8% (Table 4). Estimates of divergence time range from 0.35 to 106.2 my. Intra- and Interspecific Variation Nineteen species were sequenced for more than one individual. Within the Punctulatus Group, An. farauti

Two most parsimonious trees were obtained for equally weighted data and a strict consensus is shown in Fig. 3. The subfamily Culicinae, the genus Anopheles, and the Punctulatus clade are well supported but many deeper relationships among the genus Anopheles are unresolved. The main differences between the two most parsimonious trees are (1) in the position of the An. longirostris–An. amictus clade, one tree has this clade displacing An. flavirostis in the Myzomyia Series, the other has it as a sister clade to the An. meraukensis– An. annulipes clade, which results in the Neomyzomyia Series being monophyletic; and (2) in the position of An. tessellatus, one tree has it as a sister to the An.

TABLE 4 Mean Mitochondrial COII Sequence Divergence and Estimated Divergence Times for Anopheles and Outgroup Taxa Selected from a Range of Geographical Areas and Degrees of Relationship Time (mya)c Taxa compared Intraspecific divergence Within An. punctulatus (n 5 10) Within An. farauti s.s. (n 5 3) Within An. farauti No.2 (n 5 6) Interspecific divergence An. farauti No.7 and An. farauti s.s. (n 5 3) An. farauti No.5 and An. farauti s.s. (n 5 6) An. farauti No.3 and An. farauti s.s. (n 5 6) An. punctulatus and An. farauti s.s. (n 5 15) An. annulipes sp.A and An. farauti s.s. (n 5 3) An. annulipes sp.A and An. tessellatus (n 5 1) An. tessellatus and An. farauti s.s. (n 5 3) Myzomyia Series and An. farauti s.s. (n 5 21) An. gambiae and An. farauti s.s. (n 5 3) An. quadrimaculatus sp. A and An. bancroftii (n 5 2) Annulipes Complex and An. punctulatus (n 5 20) Lungae Complex and An. farauti s.s. (n 5 12) Bi. hollandi and An. bancroftii (n 5 2) An. quadrimaculatus sp. A and An. kawari (n 5 1) Ae. aegypti and Cx. quinquefasciatus (n 5 1) Ae. aegypti and Bi. hollandi (n 5 1) D. yakuba and Ae./Cx. (n 5 2)

Percentage of sequencea divergence

Percentage of transversionb frequency

I

0.81 1.27 1.42

0.18 0.20 0.32

1.70 2.75 3.58 7.72 8.24 8.33 8.38 8.90 8.92 9.36 9.81 9.96 10.30 12.31 12.43 14.18 19.89

0.25 0.54 0.84 4.50 4.97 4.27 5.08 5.73 6.05 5.32 6.25 5.23 7.13 5.82 6.72 8.08 13.81

II

III

0.35 0.55 0.62

1.38 1.54 2.44

0.60 0.67 1.05

0.74 1.20 1.56 3.36 — — — — — — — — — — — — —

1.92 4.15 6.46 34.6 38.2 32.8 39.1 44.1 46.5 40.9 48.1 40.2 54.8 44.8 51.7 62.2 106.2

0.83 1.80 2.80 15.0 16.6 14.2 17.0 19.1 20.2 17.7 20.8 17.4 23.8 19.4 22.4 26.9 46.0

Note. n, Number of Pairwise Comparisons. Uncorrected. b Kimura two-parameter equivalent to the Jukes–Cantor formula modified according to Beckenbach et al. (1993). c Columns I, II, and III are based on estimated divergence times of 2.3% uncorrected sequence divergence/my (Brower, 1994) and 0.13 and 0.3% transversion divergence/my (Beckenbach et al., 1993), respectively. a

PHYLOGENY OF AUSTRALASIAN ANOPHELINES

269

FIG. 3. Strict consensus of two most parsimonious trees from the equally weighted analysis. Tree length 5 1155 steps, CI 5 0.359, HI 5 0.641, RI 5 0.465, RC 5 0.167, CI excluding uninformative characters 5 0.308, HI excluding uninformative characters 5 0.692. Numbers on branches are Bremer’s support indices. A, subgenus Anopheles; M, Myzomyia Series; NC, Neocellia Series; NM, Neomyzomyia Series; P, Pyretophorus Series.

novaguinesis–An. farauti No. 6 clade, the other has it with the other Oriental members of the Neomyzomyia Series, i.e., An. balabacensis and An. kochi. Successively weighting produced a single wellresolved tree which differed in certain aspects from both equally weighted trees. The Punctulatus Group and the Annulipes and Lungae Complexes are monophyletic, as are the Myzomyia and Pyretophorus Series. The Oriental members of the Neomyzomyia Series also form a separate clade. However, the subgenera Anopheles and Cellia and the Neomyzomyia and Neocellia Series are paraphyletic. DISCUSSION The evidence presented in this paper is in the form of phylogenetic hypotheses and estimation of separation time between taxa. The implications of this evidence

concern Anopheles taxonomy and our understanding of the evolutionary history of this genus, particularly in the Australasian Region. Character analysis for two character sets, taxonomic categories and geographic distribution, was performed (Fig. 5) in an effort to trace the historical sequence leading to present distribution patterns and informal taxonomic divisions within the Anopheles. The various character states for each trait was mapped on the most parsimonious tree from the successively weighted scheme (Fig. 4). Different character states were recognized for genus and series levels (states 1–9) and for extralimital and Australasian distributions (states 1 and 2). A formal treatment of morphological characters is beyond the scope of this paper but taxonomic implications arising from the phylogeny (Fig. 5) are considered in terms of the robustness of characters dictating this taxonomy (Table 1).

270

FOLEY ET AL.

FIG. 4. Single most parsimonious tree from the successively weighted scheme. Tree length 5 1158 steps, CI 5 0.358, HI 5 0.642, RI 5 0.453, RC 5 0.166, CI excluding uninformative characters 5 0.308, HI excluding uninformative characters 5 0.693. Numbers on branches are rescaled Bremer’s support indices for comparison with equal-weighted values. A, subgenus Anopheles; M, Myzomyia Series; NC, Neocellia Series; NM, Neomyzomyia Series; P, Pyretophorus Series.

Taxonomy Deeper relationships within the phylogeny agree with current classification (e.g., node 1, Fig. 5, Table 1). The subfamily Culicinae, represented by single specimens of Aedes and Culex, is well supported. In the successively weighted phylogeny the subfamily Anophelinae also has high branch support. There are many differences between these two subfamilies (Reid, 1968) including overall shape and resting habit. However, other schemes have been proposed; for example, Belkin (1962) divided the Culicinae into 10 parts of equal rank with the Anophelinae but this scheme is not supported here. Also, Besansky and Fahey (1997) only recovered the Culicinae as a monophyletic group after successively weighting white gene sequences with third codon positions weighted 0. However, these authors recovered an internally consistent Anophelinae clade regardless of the weighting scheme. Bironella and Anopheles (node 2) can be distin-

guished by the shape of wing veins and the presence or absence and position of hairs in the larvae (e.g., Reid, 1968). Bironella are morphologically less distinct from Anopheles than Chagasia and distinctive characters such as the shape of the fifth foretarsal segment and claw of the male does not hold for all species, i.e., members of the subgenus Neobironella (Reid, 1968). Despite these caveats, successively weighting resulted in strong branch support for the monophyly of the Bironella and Anopheles. Support for this arrangement was also observed by Besansky and Fahey (1997), who additionally used a member of another subgenus (Bironella) to the one we used (Brugella). Lower support for ingroups within the Anopheles compared to outgroups is expected as the number of ingroups is much higher. However, within the genus Anopheles deeper relationships generally have low branch support compared to terminal clades.

PHYLOGENY OF AUSTRALASIAN ANOPHELINES

271

FIG. 5. Character analysis for two character sets [i.e., taxonomic categories (left) and geographic distribution (right)]. Different character states were recognized for genus and series levels (states 1–9) and for principally extralimital and Australasian distributions (states 1 and 2). Character states were mapped on the most parsimonious tree from the successively weighted scheme (i.e., Fig. 4). A, B, and C indicate major species radiations (see Discussion). Nodes 1–9 are considered in relation to the robustness of characters dictating taxonomy (Table 1 and Discussion).

White (1977) speculated that ‘‘respect’’ for the subgeneric classification scheme devised for the Anopheles ‘‘has prevented any attempt to test or tamper with anopheline systematics by modern methods.’’ Harbach (1994) notes that subgenera within the Anopheles are based primarily on the number and the positions of setae on the gonocoxites of the male genitalia. The present study suggests that the subgenera Cellia and Anopheles (node 3) are paraphyletic due to the position of An. quadrimaculatus sp. A. Only by ad hoc weighting of codons, 4:10:1, and transversions 2:1 to transitions did subgenera become monophyletic (analysis not shown). Several pieces of evidence should be considered in discussion of Anopheles subgenera. First, New World and Old World anopheline fauna are very distinctive, so much so that Reid (1968) used location as the first character in his subgeneric key, e.g., Cellia is confined to the Old World and Nyssorhynchus, Kerteszia, Lophopodomyia, and Stethomyia are confined to the New World. The subgenus Anopheles is unique in that it occurs in both regions. Is this a reflection of an ancient

continuous distribution or does this subgenus comprise relatively unrelated groups? Looking more closely at the subgenus Anopheles, the Laticorn Section occurs in both the Old World and the New World and is considered more primitive than the New World Angusticorn Section, based on comparison with the genus Chagasia (Reid, 1968). For instance, An. bancroftii (Laticorn Section, Myzorhynchus Series) has a long stigmal filament in the spiracular apparatus of the larva which is similar to filaments in Chagasia. Certainly, in our phylogeny (node 3) An. bancroftii appears as a sister to the Cellia and is basal to An. quadrimaculatus sp. A (Angusticorn Section, Anopheles Series). It is interesting to note here that pupal trumpets in the Cellia are, like An. quadrimaculatus sp. A, of the angusticorn type (Reid, 1968). Second, Reid (1968) stated also that certain members of the same series as An. quadrimaculatus sp. A ‘‘show between them several features suggesting some affinity to subgenus Cellia.’’ Among these similarities were ‘‘two points of resemblance with the Neocellia series of Cellia’’ (Reid, 1968), i.e., the long simple pupal hair ‘‘I’’ on abdominal segments VI and

272

FOLEY ET AL.

VII and egg floats which meet the deck. The former character is also a feature of the Pyretophorus Series (Reid, 1968). A well-supported association of An. quadrimaculatus sp. A with members of the Neocellia and Pyretophorus Series was observed in both equally weighted and successively weighted trees. Thus, this study suggests that the present subgeneric classification of the Anopheles is not a natural grouping and casts doubt on the robustness of characters of the male genitalia used to distinguish subgenera. Harbach (1994) notes that the series within the subgenus Cellia are based primarily on the cibarial teeth and the current study suggests that this character has phylogenetic signal. The Pyretophorus Series is a strongly supported monophyletic clade (node 4) with An. gambiae basal, the Myzomyia Series is monophyletic in one of the equally weighted trees and the successively weighted tree (node 5) with An. flavirostris basal, members of the Neocellia Series are paraphyletic (node 6) but appear closely related, and the Neomyzomyia Series (node 7) is monophyletic only in one of the equally weighted trees. Within the Neomyzomyia Series, the Punctulatus Group and the Lungae and Annulipes Complexes appear monophyletic with good branch support, particularly in the successively weighted tree. The sister clade relationship between the Punctulatus Group and the Annulipes Complex accords with Belkin’s (1962) conclusion that these two taxa are closest based on morphology. However, the use of genetic rather than morphological characters to identify members of the Punctulatus Group (e.g., Foley et al., 1993) and the largely non-overlapping distribution of this group and the Annulipes Complex may overemphasize the robustness of characters such as number of wing spots (e.g., Lee et al., 1987), used in the separation of these taxa (node 8). An. meraukensis appears as a sister taxon to the Annulipes Complex; larvae of An. meraukensis closely resemble those of An. annulipes s.l. (Lee and Woodhill, 1944). The consistent basal position of An. meraukensis and An. annulipes sp. B, the only taxa within this clade with an all-dark proboscis, suggests that this character is ancestral within the Annulipes Complex. Anopheles hilli and An. amictus form a strongly supported clade; these species are morphologically similar and were once considered subspecies, for example, by Lee and Woodhill (1944). Belkin (1962) suggested that the Lungae Complex showed close affinities with An. longirostris and An. tessellatus based on the presence of entirely white halteres and scutal scales restricted largely to the anterior promontory. However, these species do not group together in the present reconstruction. An. farauti Nos. 2 and 6 form a well-supported clade as does An. farauti s.s. with An. farauti No. 7. The Farauti Complex is paraphyletic because of the position of An. farauti No. 4 (node 9). However, Foley et al. (1993) noted that An. farauti No. 4 was different from the

other members of the Farauti Complex in that it sometimes exhibits white proboscis scaling, a feature it shares with An. koliensis, An. sp. nr punctulatus, and An. punctulatus; the latter two species form a clade with An. farauti No. 4. Thus, all-dark proboscis coloration appears to have phylogenetic utility. Although sequence data were not obtained for An. clowi and An. rennellensis, we would expect them to be placed in the An. punctulatus clade, based on their taxonomic membership in the Punctulatus Group. Evolutionary history Within the Cellia the basal position of members of the Neomyzomyia Series in the successively weighted tree is in accordance with Mattingly (1969) who regarded the Neomyzomyia as the most primitive series based on comparative egg morphology. He suggested this series arose in Africa and spread eastward; no African members of the Neomyzomyia Series were available to test this scenario. Only three Oriental species of the Neomyzomyia Series were available for comparison in this study. The Australasian species An. longirostris, An. hilli, and An. amictus appear basal to all of these species in the successively weighted tree and one equally weighted tree. In the other equally weighted tree the Oriental species An. kochi and An. balabacensis form a sister clade to one containing the Australasian species and the Oriental An. tessellatus. Thus, it is possible that two-way exchanges rather than only immigration were a characteristic of anopheline paleobiogeography in Australasia. Based on current distribution, radiation ‘‘A’’ (Fig. 5) separates the Oriental and most of the Australasian members of the Neomyzomyia Series. The derived nature of many of the Australian and New Guinea taxa suggests an Oriental origin. Reports of An. karwari, An. subpictus s.l., and An. tessellatus in New Guinea are at odds with their phylogenetic position (Fig. 5) and have been explained as either recent introductions in the case of the first two species (Lee et al., 1987) or as misidentifications in the case of the last (Reid, 1968). Radiation ‘‘B’’ separates Solomon Island endemics (the Lungae Complex) from Australian and New Guinea species (excepting An. farauti No. 7, which appears to be of recent origin, see Table 4). This suggests that biotic connection throughout much of Melanesia was possible early in the history of the Australasian fauna. Finally, radiation ‘‘C’’ separates principally Australian from principally New Guinean taxa. Members of the Punctulatus Group which occur in Australia (i.e., An. farauti s.s., Nos. 2 and 3) appear to be more derived than New Guinea species, suggesting that this group arose in New Guinea. Some branches within the Punctulatus Group are only poorly supported, limiting conclusions regarding species origins. Hennig (1981) suggested that the superfamily Culicoidea may have been in existence during the Upper

PHYLOGENY OF AUSTRALASIAN ANOPHELINES

Triassic (215 mya). This estimate is much higher than 106.2–46.0 mya for the separation of D. yakuba and Aedes/Culex (Table 4). Fossil mosquitoes indicate that the family Culicidae was ‘‘well and truly evolved’’ by the Eocene (58–36 mya) (Colless, 1986). Most fossil mosquitoes date from the Oligocene (38–26 mya) (Lutz, 1985, in Service, 1993), by which time members of Aedes and Culex were recognizable. This estimate is within the range for the split between Aedes and Culex (51.7–22.4 mya) in Table 4. Although no fossil anophelines have yet been found, bionomics and morphology (Ross, 1951) and chromosome and DNA studies indicate that the Anophelinae are primitive within the Culicidae (Rao and Rai, 1987, 1990; unpublished data in Besansky et al., 1992; Ho et al., 1995; Besansky and Fahey, 1997). Thus, the molecular clocks used in this study could be underestimating divergence at the level of superfamilies but are within the range for genera. Simon et al. (1994) considered that the information content of COII becomes obscured only between generic and ordinal levels. Estimated dates for tectonic events can also be compared to divergence times. Many branches between Australasian and extralimital taxa fall within the period Australia was considered isolated, i.e., between ‘‘separation’’ from Gondwanaland (60–38 mya) to ‘‘collision’’ with Southeast Asia (15–5 mya) (Cranston and Naumann, 1991; Veevers, 1991). Two points should be considered here. First, knowledge of palaeogeography is imperfect; Sluys (1994) suggests that ‘‘biogeographic data and theories should not be made subservient to geological theories but that both biological and geological information . . .’’ should be used to explain geographic pattern. Second, our estimates based on Brower (1994) are consistently lower than those based on Beckenback et al. (1993). This discrepancy in dating methods is greatest near 8% sequence divergence, the upper limit for Brower’s (1994) method. Valid estimates from Brower’s method may be limited to much lower sequence divergences in the Culicidae (e.g., ,5%). If the 0.3%/my rate of Beckenbach et al. (1993) is more accurate, then many divergence times in Table 4 (even within the Punctulatus Group) would be around the time of first contact between Australasia and Southeast Asia. Groups with different distributions have similar divergence times (e.g., between the Punctulatus Group and Lungae and Annulipes Complexes), suggesting an ancient species radiation. Just what role the isolation and fragmentation of Australasia played in this radiation remains unknown. Other geological evidence which should be considered includes the possibility of ‘‘stepping stones of dry land’’ providing opportunities for faunal and floral dispersal between Southeast Asia and Australasia prior to their collision (e.g., Burret et al., 1991). Timing of a possible link between Australia and elements of the Outer Melanesian Arc (18–12 mya, Michaux (1989)) would accord with the estimated speciation of the

273

Lungae Complex, endemic to the Solomon Islands. Dates applied to intraspecific divergence indicates that gene flow occurred in the recent past (0.35–2.44 mya, see Table 4), even between populations of An. farauti s.s. as far apart as Australia and Vanuatu. This supports a dispersal rather than vicariance explanation for the distribution of this species. These estimates postdate the isolation of Fiji, which may explain the absence of An. farauti s.s. east of Vanuatu. Thus, a combination of vicariance and dispersal scenarios may be necessary to explain the distribution of Australasian anophelines. CONCLUSION A reliable phylogeny for the Anopheles may help in the fight to control malaria by elucidating descent relationships of genes for refractoriness, insecticide resistance, and genetically determined ecological and behavioral traits important to malaria transmission. However, Harbach (1994) notes that within the Anopheles ‘‘a fair degree of instability still exists in the present scheme of classification.’’According to Zavortink (1990) the taxonomy of the Culicidae is largely still at the alpha level: the discovery, characterization, and naming of species. Given the endemism of anopheline fauna and the tendency to classify anophelines on a regional basis, it is the relationship between geography and phylogeny which will be central to our understanding of both anopheline taxonomy and evolution. The availability of modern phylogenetic methods, molecular character sets, and knowledge of earth history not available to earlier mosquito workers offers the chance to test current taxonomy and to develop an historical narrative for the evolution of the Anopheles. This study suggests that the subgenera Cellia and Anopheles and the Neocellia Series may be paraphyletic, which would invalidate them as systematic categories. However, some support for the monophyly of the Neomyzomyia, Myzomyia, and Pyretophorus Series suggests that characteristics of the cibarial teeth used to define these categories have phylogenetic signal. The hypothetical nature of phylogenetic reconstruction cannot be overstated. Within the genus Anopheles deeper relationships generally have low support and are poorly resolved compared to terminal clades. Saturation of the COII sequence is most likely the reason and would be particularly problematic for the Neomyzomyia Series if this series is the most ancient of the Cellia. This limits the confidence that can be attached to conclusions at deeper levels but points to the utility of the COII gene for questions concerning alpha taxonomy. Future analyses would benefit from comparisons like ours, which span different geographic regions and test specific taxonomic and biogeographic hypotheses. The inclusion of additional taxa and a formal treatment of the morphological characters used to define categories

274

FOLEY ET AL.

would strengthen confidence in statements about taxonomy. New morphological characters are needed and Harbach (1994) gives examples of some anatomical structures that have been totally neglected in taxonomic research. Finally, selecting an appropriate gene for the questions being asked is crucial (Brower and DeSalle, 1994). The use of nuclear protein-coding genes such as the white gene (Besansky and Fahey, 1997) holds much promise for elucidating deeper relationships within the genus Anopheles. ACKNOWLEDGMENTS We thank the following people for help in obtaining insect material: R. Cooper, J. Hii, R. Paru, and H. Dagoro for PNG specimens; E. Torres, F. Salazar, and L. Bueno for Philippine specimens; R. Russell, P. Whelan, C. Lokkers, T. Burkot, J. Stott, and R. Cooper for Australian specimens; A. Arabola and S. Meek for Solomon Islands specimens; K. Maitland and T. Williams for Vanuatu specimens; and P. Ebsworth for Irian Jaya specimens. We thank R. Slade for introducing us to the Mega 1.02 program and for commenting on the draft. We also thank R. DeSalle and two anonymous reviewers for their comments.

REFERENCES Beard, C. B., Hamm, D. M., and Collins, F. H. (1993). The mitochondrial genome of the mosquito Anopheles gambiae: DNA sequence, genome organization, and comparisons with mitochondrial sequences of other insects. Insect Mol. Biol. 2: 103–124. Beckenbach, A. T., Wei, Y. W., and Liu, H. (1993). Relationships in the Drosophila obscura species group, inferred from mitochondrial cytochrome oxidase II sequences. Mol. Biol. Evol. 10: 619–634. Belkin, J. N. (1962). ‘‘The Mosquitoes of the South Pacific (Diptera, Culicidae),’’ Vols. I and II. Univ. of California Press, Berkeley and Los Angeles. Bender, W., Spierer, P., and Hogness, D. S. (1983). Chromosomal walking and jumping to isolate DNA from the Ace and rosy loci and the Bithorax complex in Drosophila melanogaster. J. Mol. Biol. 168: 17–33. Besansky, N. J., and Fahey, G. T. (1997). Utility of the white gene in estimating phylogenetic relationships among mosquitoes (Diptera: Culicidae). Mol. Biol. Evol. 14: 442–454. Besansky, N. J., Finnerty, V., and Collins, F. H. (1992). Molecular perspectives on the genetics of mosquitoes. Adv. Genet. 30: 123– 184. Booth, D. R., and Bryan, J. H. (1986). Cytogenetic and cross breeding evidence for additional cryptic species in the Anopheles annulipes Walker complex (Diptera: Culicidae). J. Aust. Entomol. Soc. 25: 315–325. Bremer, K. (1994). Branch support and tree stability. Cladistics 10: 295–304. Brower, A. V. Z. (1994). Rapid morphological radiation and convergence among races of the butterfly Heliconius erato inferred from patterns of mitochondrial DNA evolution. Proc. Natl. Acad. Sci. USA 91: 6491–6495. Brower, A. V. Z., and DeSalle, R. (1994). Practical and theoretical considerations for choice of a DNA sequence region in insect molecular systematics, with a short review of published studies using nuclear gene regions. Ann. Entomol. Soc. Am. 87: 702–716. Burrett, C., Duhig, N., Berry, R., and Varne, R. (1991). Asian and south-western Pacific continental terranes derived from Gondwana, and their biogeographic significance. Aust. Syst. Bot. 4: 13–24.

Cagampang-Ramos, A., and Darsie, R. F. Jr. (1970). ‘‘Illustrated Keys to the Anopheles Mosquitoes of the Philippine Islands,’’ Malaria Eradication Training Center, Technical Report 70-1, USAF Fifth Epidemiological Flight, PACAF, Manila. Clary, D. O., and Wolstenholme, D. R. (1985). The mitochondrial DNA molecule of Drosophila yakuba: Nucleotide sequence, gene organization and genetic code. J. Mol. Evol. 22: 252–271. Colless, D. H. (1986). The Australian Chaoboridae (Diptera). Aust. J. Zool. 124: 1–66. Colless, D. H., and McAlpine, D. K. (1970). Diptera (Flies). In ‘‘The Insects of Australia: A Textbook for Students and Research Workers,’’ 1st ed., pp. 656–740, Melbourne Univ. Press, Carlton. Cranston, P. S., and Naumann, I. D. (1991). Biogeography. In ‘‘The Insects of Australia: A Textbook for Students and Research Workers,’’ (I. D. Naumann et al., Eds.), 2nd ed, Vol. 1, pp. 180–197, Melbourne Univ. Press, Carlton. DeBruijn, M. H. L. (1983). Drosophila melanogaster mitochondrial DNA, a novel gene organization and genetic code. Nature 304: 234–241. Devereux, J., Haeberli, P., and Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12: 387–395. Eriksson, T., and Wikstro¨m, N. (1996). ‘‘AutoDecay,’’ version 3.0. Distributed by the authors (anonymous ftp from 128.97.40.127 in directory pub/autodecay), Stockholm University, Sweden. Farris, J. S. (1989). The retention index and the rescaled consistency index. Cladistics 5: 417–419. Foley, D. H., and Bryan, J. H. (1991). Anopheles annulipes Walker (Diptera: Culicidae) at Griffith, New South Wales. 1. Two sibling species in sympatry. J. Aust. Entomol. Soc. 30: 109–112. Foley, D. H., Cooper, R. D., and Bryan, J. H. (1995). A new species within the Anopheles punctulatus complex in Western Province, Papua New Guinea. J. Am. Mosq. Control Assoc. 11: 122–127. Foley, D. H., Meek, S. R., and Bryan, J. H. (1994). The Anopheles punctulatus group of mosquitoes in the Solomon Islands and Vanuatu surveyed by allozyme electrophoresis. Med. Vet. Entomol. 8: 340–350. Foley, D. H., Paru, R., Dagoro, H., and Bryan, J. (1993). Allozyme analysis reveals six species within the Anopheles punctulatus complex of mosquitoes in Papua New Guinea. Med. Vet. Entomol. 7: 37–48. Green, C. A. (1972). The Anopheles annulipes complex of species. Abstr. Int. Congr. Entomol. 14th, p. 286, Canberra. Harbach, R. E. (1994). Review of the internal classification of the genus Anopheles (Diptera: Culicidae): The foundation for comparative systematics and phylogenetic research. Bull. Entomol. Res. 84: 331–342. Hennig, W. (1981). ‘‘Insect Phylogeny’’ (A. C. Pont, Ed.), Wiley, Chichester. Ho, C-M., Liu, Y-M., Wei, Y-H., and Hu, S-T. (1995). Gene for cytochrome c oxidase subunit II in the mitochondrial DNA of Culex quinquefasciatus and Aedes aegypti (Diptera: Culicidae). J. Med. Entomol. 32: 174–180. Iyengar, M. O. T. (1960). A review of the mosquito fauna of the South Pacific (Diptera: Culicidae). Tech. Pap. S. Pac. Comm. 130: 1–102. Kumar, S., Tamura, K., and Nei, M. (1993). ‘‘MEGA: Molecular Evolutionary Genetics Analysis,’’ version 1.0, The Pennsylvania State Univ., University Park. Lee, D. J., and Woodhill, A. R. (1944). ‘‘The Anopheline Mosquitoes of the Australasian Region, Monograph No. 2,’’ Australasian Med. Pub., Sydney. Lee, D. J., Hicks, M. M., Griffiths, M., Debenham, M. L., Bryan, J. H., Russell, R. C., Geary, M., and Marks, E. N. (1987). ‘‘The Culicidae of the Australasian Region,’’ Vol. 5, Australian Govt. Pub. Service, Canberra.

PHYLOGENY OF AUSTRALASIAN ANOPHELINES Liehne, P. F. S. (1991). ‘‘An Atlas of the Mosquitoes of Western Australia,’’ Health Dept. of Western Australia, Perth. Liu, H., and Beckenbach, A. T. (1992). Evolution of the mitochondrial cytochrome oxidase II gene among 10 orders of insects. Mol. Phylogenet. Evol. 1: 41–52. Maddison, W. P., and Maddison, D. R. (1992). ‘‘MacClade: Analysis of Phylogeny and Character Evolution,’’ Version 3.0, Sinauer, Sunderland, MA. Mattingly, P. F. (1969). Mosquito eggs II. Mosq. Syst. 1: 41–50. Michaux, B. (1989). Generalized tracks and geology. Syst. Zool. 38: 390–398. Michaux, B. (1991). Distributional patterns and tectonic development in Indonesia: Wallace reinterpreted. Aust. Syst. Bot. 4: 25–36. Mitchell, S. E., Cockburn, A. F., and Seawright, J. A. (1993). The mitochondrial genome of Anopheles quadrimaculatus species A: Complete nucleotide sequence and gene organization. Genome 36: 1058–1073. Munstermann, L. E., and Conn, J. E. (1997). Systematics of mosquito disease vectors (Diptera, Culicidae): Impact of molecular biology and cladistic analysis. Annu. Rev. Entomol. 42: 351–369. Rao, P. N., and Rai, K. S. (1987). Comparative karyotypes and chromosomal evolution in some genera of nematocerous (Diptera: Nematocera) families. Ann. Entomol. Soc. Am. 80: 321–332. Rao, P. N., and Rai, K. S. (1990). Genome evolution in the mosquitoes and other closely related members of superfamily Culicoidea. Hereditas 113: 139–144. Reid, J. A. (1968). ‘‘Anopheline Mosquitoes of Malaya and Borneo,’’ Inst. for Med. Res. Malaysia, Kuala Lumpur. Ross, H. H. (1951). Conflict with Culex. Mosq. News 11: 128–132. Service, M. W. (1993). Mosquitoes (Culicidae). In ‘‘Medical Insects

275

and Arachnids’’ (R. P. Lane and R. W. Crosskey, Eds.), pp. 120–240, Chapman & Hall, London. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., and Flook, P. (1994). Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87: 651–701. Sluys, R. (1994). Explanations for biogeographic tracks across the Pacific ocean: A challenge for paleogeography and historical biogeography. Prog. Phys. Geogr. 18: 42–58. Steffan, W. A. (1966). A checklist and review of the mosquitoes of the Papuan subregion. J. Med. Entomol. 3: 179–237. Suguna, S. G., Rathinam, K. G., Rajavel, A. R., and Dhanda, V. (1994). Morphological and chromosomal descriptions of new species in the Anopheles subpictus complex. Med. Vet. Entomol. 8: 88–94. Swellengrebel, N. H., and Rodenwaldt, E. (1932). ‘‘Die Anophelen von Niederlandisch-Ostindien,’’ 3rd ed., Fischer, Jena. Swofford, D. L. (1993). ‘‘PAUP: Phylogenetic Analysis Using Parsimony, Version 3.0, A User’s Manual,’’ Illinois Natural History Survey, Champaign. Truswell, E. M., Kershaw, A. P., and Sluiter, I. R. (1987). The Australian–Southeast Asian connection: Evidence from the palaeobotanical record. In ‘‘Biogeographical Evolution of the Malay Archipelago’’ (T. C. Whitmore, Ed.), pp. 32–49. Clarendon, Oxford. Veevers, J. J. (1991). Phanerozoic Australia in the changing configuration of Proto-Pangea through Gondwanaland and Pangea to the present dispersed continents. Aust. Syst. Bot. 4: 1–11. White, G. B. (1977). The place of morphological studies in the investigation of Anopheles species complexes. Mosq. Syst. 9: 1–24. Zavortink, T. J. (1990). Classical taxonomy of mosquitoes—A memorial to John N. Belkin. J. Am. Mosq. Control Assoc. 6: 593–599.