Evolution of South American spiny rats (Rodentia, Echimyidae): the star-phylogeny hypothesis revisited

MOLECULAR PHYLOGENETICS AND EVOLUTION Molecular Phylogenetics and Evolution 25 (2002) 455–464 www.academicpress.com

Evolution of South American spiny rats (Rodentia, Echimyidae): the star-phylogeny hypothesis revisited Yuri L.R. Leite and James L. Patton* Museum of Vertebrate Zoology, 3101 Valley Life Science Building, University of California, Berkeley, CA 94720-3160, USA Received 18 October 2001; received in revised form 3 June 2002

Abstract We analyzed the phylogenetic relationships of echimyid genera based on sequences of the cytochrome b, 12S, and 16S mitochondrial genes. Our results corroborate the monophyly of Octodontoidea and the rapid diversification of echimyid rodents as previously proposed. The analyses indicate that the family Echimyidae, including Myocastor to the exclusion of Capromys, is paraphyletic, since Capromys and Myocastor are well-supported sister-taxa. We therefore suggest the inclusion of both Capromys and Myocastor in the family Echimyidae. Five other suprageneric clades are well supported: Dactylomys + Kannabateomys, Euryzygomatomys + Clyomys, Proechimys + Hoplomys, Mesomys + Lonchothrix, and Makalata + (Echimys + Phyllomys). Trinomys and Thrichomys have no clear close relatives, and Isothrix emerged as sister to Mesomys + Lonchothrix, but with no support. We suggest that most of the cladogenesis leading to the extant echimyid genera probably occurred during the Late Miocene, about eight million years ago. Ó 2002 Elsevier Science (USA). All rights reserved.

1. Introduction The Neotropical spiny rats of the family Echimyidae are the most taxonomically, ecologically, and morphologically diverse group of all extant hystricognath rodents. They are small-bodied rats distributed today throughout the Neotropical region from Central America to Argentina. It is an old family, with members recognized from the Oligocene of Bolivia (Deseadan), about 25 million years ago (Patterson and Wood, 1982). Among the extant forms, there are about 18 genera and 80 species (Eisenberg and Redford, 1999; Emmons and Feer, 1997; McKenna and Bell, 1997; Woods, 1993), which can be generally diagnosed by having bristly or spiny hair more evident on the back, although several species have soft fur. Systematic studies of echimyids at all levels are still in their infancy, despite the ecological and evolutionary diversity within the family. Lara et al. (1996) published the first comprehensive analysis of evolutionary relationships among echimyids using the complete nucleotide sequence of the mitochondrial cytochrome b (cyt b) *

Corresponding author. Fax: +1-510-643-8238. E-mail address: [email protected] (J.L. Patton).

gene of 12 supraspecific taxa. The monophyly of the family was strongly supported, but the relationships among most supraspecific taxa within the family had very weak support. Lara et al. (1996) concluded that this pattern of divergence resulted from a nearly simultaneous diversification of Recent echimyids (Fig. 1). Their conclusion was supported by the similar levels of sequence divergence and the lack of resolution for relationships among genera, contrasted with well-supported nodes both above and below the basal polytomy of the family. Here we revisit the star-phylogeny hypothesis for echimyid diversification by adding more taxa and more characters to the matrix of Lara et al. (1996), and discuss the systematic implications of the results.

2. Echimyid classification Woods (1993) divided the recent echimyids into five subfamilies, one extinct (Heteropsomyinae, endemic to the West Indies), and four extant (Table 1). The other subfamilies include the Dactylomyinae, with three genera of bamboo rats (Dactylomys, Kannabateomys, and Olallamys); Echimyinae, with four genera of tree rats (Echimys including Phyllomys, Makalata, Diplomys, and

1055-7903/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved. PII: S 1 0 5 5 - 7 9 0 3 ( 0 2 ) 0 0 2 7 9 - 8

456

Y.L.R. Leite, J.L. Patton / Molecular Phylogenetics and Evolution 25 (2002) 455–464 Table 1 Classification of extant echimyid rodents and the placement of Capromys and Myocastor according to Woods (1993) and McKenna and Bell (1997)

Fig. 1. Single most parsimonious tree published by Lara et al. (1996), based on complete sequences of the cyt b. Percent bootstrap values are given above branches and Bremer support values are given below.

Isothrix); and Eumysopinae, the most diverse subfamily composed of eight genera, including the terrestrial spiny rats and allies (Proechimys, Hoplomys, Thrichomys, Euryzygomatomys, Carterodon, Clyomys, Mesomys, Lonchothrix). Woods (1993) also included the monotypic genus Chaetomys in the subfamily Chaetomyinae within echimyids (following Patterson and Wood, 1982), but enamel microstructure (Martin, 1994) indicates that it is a member of the family Erethizontidae. Since Woods (1982) classified the extinct West Indian spiny rats (Heteropsomyinae) in the family Capromyidae, Patton and Reig (1989) proposed the use of the name Eumysopinae for the echimyids with narrow-fold molars. Recently, Woods (1989, 1993) placed heteropsomyines within the Echimyidae, but only to represent West Indian spiny rats, differently from McKenna and Bell (1997), who place both West Indian and South American spiny rats in Heteropsomyinae, with Eumysopinae as a synonym. In their classification, McKenna and Bell (1997), excluded Chaetomys from echimyids, but included Myocastor (Table 1), traditionally placed in its own family Myocastoridae (e.g., Woods, 1993). Recently, Lara et al. (1996) elevated Trinomys, traditionally placed as a subgenus of Proechimys, to the generic level, and Emmons and Vucetich (1998) created a new genus for the painted tree rat, Callistomys pictus. Emmons et al. (submitted) and Leite (2001) classified the

Woods (1993)

McKenna and Bell (1997)

Family Echimyidae Subfamily Dactylomyinae Dactylomys Kannabateomys Olallamys Subfamily Echimyinae Diplomys Echimysa Isothrix Makalata Subfamily Eumysopinaeb Carterodon Clyomys Euryzygomatomys Hoplomys Lonchothrix Mesomys Proechimysd Thrichomys Subfamily Chaetomyinaee Chaetomys Family Myocastoridae Myocastor Family Capromyidae Subfamily Capromyinae Capromys Geopromys Mesocapromys Mysateles Subfamily Plagiodontinae Plagiodontia

Family Echimyidae Subfamily Dactylomyinae Dactylomys Kannabateomys Olallamys Subfamily Echimyinae Diplomys Echimysa Isothrix Makalata Subfamily Heteropsomyinaec Carterodon Clyomys Euryzygomatomys Hoplomys Lonchothrix Mesomys Proechimysd Thrichomys Subfamily Myocastorinae Myocastor Family Capromyidae Capromysf Geocapromys Plagiodontia

a

Includes Phyllomys as synonym. Woods (1993) restricts Heteropsomyinae to extinct West Indian spiny rats. c Includes Eumysopinae as synonym. d Includes Trinomys as synonym. e McKenna and Bell (1997) classify Chaetomys in the Family Erethizontidae. f Includes Mesocapromys and Mysateles as synonyms. b

Atlantic tree rats in their own genus Phyllomys, apart from the Amazonian Echimys. In addition, several new species of echimyids have been described in recent years (e.g., Patton et al., 2000; Silva, 1998; Vi
e et al., 1996).

3. Materials and methods 3.1. Specimens The starting point for the present report was the matrix of Lara et al. (1996). Taxa added to this dataset were the echimyids Kannabateomys amblyonyx, Clyomys laticeps, and Myocastor coypus (the latter classified as an echimyid by some authors, e.g., McKenna and Bell, 1997). In addition, a capromyid (Capromys pilorides) and an ocotodontid (Octodon degus) were included as

Table 2 Specimens used in the phylogenetic analyses of the cyt b, 12S, and 16S genes, corresponding GenBank Accession Numbers, and locality data Taxon

Specimen numbera

GenBank Accession Number cyt b

12S

16S

Carpomys pilorides Cavia porcellus Clyomys laticeps Ctenomys haigi Dactylomys boliviensis Dactylomys dactylinus Echimys chrysurus Euryzygomatomys spinosus Hoplomys gymnurus Isothrix bistriata Kannabateomys amblyonyx Kannabateomys amblyonyx Lonchothrix emiliae Makalata didelphoides Makalata macrura Mesomys hispidus Mesomys hispidus Mesomys occultus Mesomys occultus Myocastor coypus Myoprocta pratti Octodon degus Phyllomys blainvilii Proechimys amphichoricus Proechimys simonsi Thrichomys apereoides Thrichomys apereoides Trinomys dimidiatus Trinomys eliasi Trinomys iheringi Trinomys paratus Trinomys setosus denigratus Trinomys setosus elegans Trinomys setosus setosus Trinomys yonenagae

PM 99558 ( ¼ T-2120) – CIT 1235 MVZ 184878 ( ¼ JLP 16556) MVZ 194298 ( ¼ MNFS 988) INPA 2477 USNM 549594 ( ¼ LHE 555) SU73 MVZ 162309 MNFS 97 CTX 2942 YL 182 INPA 2472 LHE 600 MVZ 194324 ( ¼ JLP 15214) MVZ 194378 ( ¼ MNFS 436) MVZ 194391 ( ¼ MNFS 745) MVZ 194396 ( ¼ JUR 501) MNFS 201 NUTRIA 289 MVZ 190655 ( ¼ JLP 15972) BM 727 MNRJ 43810 ( ¼ LMP 27) ALG 14040 MVZ 166803 ( ¼ JLP 11051) BIO 872 XI 012i MAMb 10 ML 141 MVZ 193411 ( ¼ MAM 55) YL 34 MNRJ 31441 MNRJ 31448 AL 3072 PEU 880027

AF422915 AJ222767b AF422918 AF422920 L23339c L23335c L23341c U34858c AF422922 L23355c AF422917 AF422916 AF422921 L23363c L23356c L23385c L23395c L23388c U35415c AF422919 U34850c AF422914 U35412c U35413c U35414c U34854c U34855c U35169c U35166c U35171c U35165c AF422923 AF422924 U34856c U35172c

AF422848 L35585c AF422851 AF422853 AF422875 AF422874 AF422877 AF422854 AF422862 AF422873 AF422850 AF422849 AF422857 AF422878 AF422879 AF422860 AF422861 AF422858 AF422859 AF422852 AF422846 AF422847 AF422876 AF422863 AF422864 AF422856 AF422855 AF422867 AF422869 AF422868 AF422866 AF422870 AF422871 AF422872 AF422865

AF422882 L35585d AF422885 AF422887 AF422909 AF422908 AF422911 F422888 AF422896 AF422907 AF422884 AF422883 AF422891 AF422912 AF422913 AF422894 AF422895 AF422892 AF422893 AF422886 AF422880 AF422881 AF422910 AF422897 AF422898 AF422890 AF422889 AF422901 AF422903 AF422902 AF422900 AF422904 AF422905 AF422906 AF422899

Locality

Y.L.R. Leite, J.L. Patton / Molecular Phylogenetics and Evolution 25 (2002) 455–464

Captive animal from the Rotterdam Zoo, Netherlands – Parque Nacional das Emas, Goi
as, Brazil 13.5 km E Estaci
on Perito Moreno, Prov. Rio Negro, Argentina Fazenda Santa F
e ( ¼ Flora), left bank Rio Juru
a, Acre, Brazil Munic
ıpio Beruri, right bank Rio Purus, Amazonas, Brazil 52 km SSW Altamira, right bank Rio Xingu, Par
a Brazil Sumidouro, Rio de Janeiro, Brazil 6 km N Buenaventura, Valle, Colombia Upper Rio Urucu, Amazonas, Brazil Usina Hidrel
etrica Salto Caxias, Paran
a, Brazil Reserva Biol
ogica de Pocßo das Antas, Silva Jardim, Rio de Janeiro, Brazil Alter do Ch~ao, Par
a, Brazil 52 km SSW Altamira, right bank Rio Xingu, Par
a, Brazil Vicinity of Miranda, left bank Rio Juru
a, Amazonas, Brazil Penedo, right bank Rio Juru
a, Amazonas, Brazil Barro Vermelho, left bank Rio Juru
a, Amazonas, Brazil Colocacß~ao Vira-Volta, left bank Rio Juru
a on Igarap
e Arabidi, Amazonas, Brazil Upper Rio Urucu, Amazonas, Brazil Uruguay Altamira, right bank Rio Juru
a, Amazonas, Brazil Chile (maintained in captivity at Norhtern Illinois University, DeKalb, IL) Mocambinho, Ja
ıba, Minas Gerais, Brazil San Carlos de Rio Negro, ca. 4 km N Isla Sarama, Amazonas, Venezuela Aguas Calientes, 1 km below Shintuya, Depto. Madre de Dios, Peru Santo In
acio, Bahia, Brazil Xing
o, Delmiro Gouveia, Vale do Rio S~ao Francisco, Alagoas, Brazil Mambucaba, Angra dos Reis, Rio de Janeiro, Brazil Restinga de Maric
a, Aeronautic Trail, Rio de Janeiro, Brazil Fazenda da Toca, Ilha de S~ao Sebasti~ao, S~ao Paulo, Brazil Grota da Aracruz Florestal, Esp
ırito Santo, Brazil Mata da Pra
una, 5 km N Conceicß~ao do Mato Dentro, Minas Gerais, Brazil Fazenda Esmeralda, 30 km E, 4 km N Rio Casca, Minas Gerais, Brazil Fazenda Cruzeiro, 13 km SSE Cristin
apolis, Sergipe, Brazil Dunes of the S~ao Francisco river, Ibiraba, Bahia, Brazil

a

457

Voucher specimens are deposited in the collections of the Instituto Nacional de Pesquisas da Amaz^ onia, Manaus (INPA), Museu de Hist
oria Natural Cap~ao da Imbuia, Curitiba (MHNCI), Museu Nacional, Rio de Janeiro (MNRJ), and Museum of Vertebrate Zoology, University of California, Berkeley (MVZ). Other prefixes correspond to field catalog numbers of specimens collected by A. Langguth (AL), A.L. Gardner (ALG), Y. Yonenaga-Yassuda (initials BIO, CIT), J.L. Patton (JLP), J. Malcolm (JUR), L.H. Emmons (LHE), M.A. Mustrangi (MAM), R. Cerqueira (initials MAMb, SU, XI), M. Lara (ML), M.N.F. da Silva (MNFS); P. da Rocha (PEU), Y. Leite (YL). These will be deposited at INPA (JLP, MNFS), MNRJ (AL, PEU, ML), MVZ (JLP, MNFS, JUR), Museu Paraense Em
ılio Goeldi (JLP, MNFS, JUR), Museu de Zoologia, Universidade de S~ao Paulo (BIO, CIT, MAM), Departamento de Zoologia, Universidade Federal de Minas Gerais, Belo Horizonte (YL), or National Museum of Natural History, Washington (ALG, LHE). b From DÕErchia et al. (1996). c From Frye and Hedges (1995). d From Lara et al. (1996).

458

Y.L.R. Leite, J.L. Patton / Molecular Phylogenetics and Evolution 25 (2002) 455–464

additional outgroups. Specimens used in the present study and corresponding GenBank Accession Numbers are listed in Table 2. 3.2. DNA sequencing Two other genes were added to the cyt b dataset of Lara et al. (1996): the complete 851 bp sequence of the 12S ribosomal RNA (rRNA) and a partial sequence of 466 bp of the 16S rRNA mitochondrial genes. The data from the three genes were combined into a final matrix which had 2457 characters and 35 OTUs. We extracted DNA using the Dneasy extraction kit (Qiagen). Two fragments of the mitochondrial cyt b gene were amplified in 25 ll polymerase chain reactions (PCR) using the primer pairs MVZ 05–MVZ 16, and MVZ 127–MVZ 108 (Table 3) and the following temperature regime: initial denaturation 94 °C/5 min, then 39 cycles of 94 °C/30 s, 48 °C/30 s, 72 °C/ 45 s, and final extension at 72 °C/45 s. For the amplification of the 12S rRNA gene (851 bp), we used primers MVZ 59–MVZ 44 and MVZ 01–MVZ 02 or MVZ 01– MVZ 50 under the temperature regime: 37 cycles of 95 °C/ 45 s, 49 °C/45 s, 72 °C/60 s. For the 16S rRNA gene (466 bp) we used the pair MVZ 117–MVZ 98 under the regime: 36 cycles of 94 °C/30 s, 50 °C/45 s, 72 °C/45 s. After an agarose gel check, samples were cycle-sequenced using the ABI-Prism d-Rhodamine kit (Applied Biosystems) through 25 cycles of 95 °C/30 s, 50 °C/15 s, 60 °C/4 min using the same primers listed above. Sequences were obtained using an ABI Prism 377 automated sequencer, and were aligned by eye using the software Sequencher 3.0 (Gene Codes). Sequences of the 12S and 16S genes were aligned based on their secondary structure, following Springer and Douzery (1996), and Gutell et al. (1993), respectively. 3.3. Phylogenetic analyses Phylogenetic analyses were performed using the software PAUP*4.0 (Swofford, 2000), using maximum

parsimony and maximum likelihood as optimality criteria. The data were analyzed with all bases pooled regardless of gene following the total evidence approach. Treatments of the data by gene or gene type (the protein coding versus ribosomal genes) gave the same general results. Heuristic searches were conducted utilizing the tree-bisection-reconnection (TBR) algorithm, via random stepwise addition with 10 replicates (except for maximum likelihood), and collapsing zero length branches. For parsimony, character states were optimized using the accelerated transformation (ACCTRAN) option. Cyt b characters were weighted by ignoring first position cytosine–thymine (C–T) changes, as well as third position transitions were ignored. This is based on empirical evidence for saturation for third position transitions, and to accommodate for the high proportion of C–T changes at first positions that specify different codons of leucine–isoleucine (Lara et al., 1996). For maximum likelihood, we used the program Modeltest 3.0.4 (Posada and Crandall, 1998) to select the most appropriate model of molecular evolution through a nested likelihood ratio test. According to this test, the General Time Reversible model of substitution (Rodr
ıguez et al., 1990) taking into account the proportion of invariable sites and following a gamma distribution for variable sites (GTR + I + G), is the one which best fits the data. Maximum likelihood analyses were then performed in two steps. First, the most parsimonious tree was scored for maximum likelihood parameters, using the appropriate model. The resulting scores were: R-Matrix A–C ¼ 4.1, A–G ¼ 12.27, A– T ¼ 5.246, C–G ¼ 0.8689, C–T ¼ 51.28, G–T ¼ 1; proportion of invariable sites ¼ 0.448832; and value of gamma shape parameter ¼ 0.589593. These scores were then input in a heuristic search for the maximum likelihood tree using the GTR + G + I model using empirical nucleotide frequencies, and five rate categories at variable sites. Support for clades within trees was assessed using Bremer support, or decay, index (Bremer, 1988), calcu-

Table 3 List of primers used in the molecular analyses Gene

Primer name

Primer sequence

Strand

30 end

Cyt b

MVZ MVZ MVZ MVZ

05 16 127 108

CGAAGCTTGATATGAAAAACCATCGTTG AAATAGGAARTATCAYTCTGGTTTRAT TRYTACCATGAGGACAAATATC CCAATGTAATTTTTATAC

L H L H

14,115 14,940 14,554 15,292

12S

MVZ MVZ MVZ MVZ MVZ

59 44 01 02 50

ATAGCACTGAAAAYGCTDAGATG TTMYAGAACAGGCTCCTCTAG AAACTGGGATTAGATACCCCAC GAGGGTGACGGGCGGTGTG TYTCGGTGTAAGYGARAKGCTT

L H L H H

47 613 506 902 1045

16S

MVZ 117 MVZ 98

CGCCTGTTTATCAAAAACAT CCGGTCTGAACTCAGATCACGT

L H

1947 2510

The 30 -end refers to the position in Mus. L, light strand; H, heavy strand.

Y.L.R. Leite, J.L. Patton / Molecular Phylogenetics and Evolution 25 (2002) 455–464

lated using the program Autodecay 4.0 (Eriksson, 1998), and bootstrap analysis (Felsenstein, 1985). For parsimony, 100 bootstrap replicates were performed using full heuristic searches, each with 10 replicates and random addition sequence of taxa. For maximum likelihood, 100 bootstrap replicates were conducted via ‘‘fast’’ stepwise-addition.

459

based on Kimura 2-parameter distances as the input into the likelihood analysis likewise gave a different topology but did not differ significantly in log-likelihood score and confirmed the same internal clades. In all trees, the same pattern reported by Lara et al. (1996) of high support at the base and tips, and low support in the middle is observed. 4.2. Monophyly of Octodontoidea and Echimyidae

4. Results and discussion

The maximum parsimony analysis resulted in one shortest tree, 2564 steps long with little support for intergeneric relationships, most of them forming a ladderized sequence where each step is based on one substitution only (Fig. 2). The maximum likelihood tree generated using this model had a score of )Ln ¼ 22202.4, and a different topology from the parsimony tree, but presented the same well-supported internal clades (Fig. 3, see discussion below). An additional analysis (not shown) done using a neighbor-joining tree

The Octodontoidea clade is very well supported in both parsimony (bootstrap value ¼ 100%, Bremer support ¼ 37 steps, Fig. 2) and likelihood analyses (bootstrap value ¼ 99%, Fig. 3). The superfamily Octodontoidea was proposed by Simpson (1945) and strong support for it has been achieved by virtually every phylogenetic study so far, based on immunology (Sarich and Cronin, 1980), myology (Woods and Hermanson, 1985), lung morphology (Wallau et al., 2000), mitochondrial genes (Lara et al., 1996; Nedbal et al., 1994), and nuclear genes (Huchon and Douzery, 2001). A shortcoming of most studies addressing relationships within Octodontoidea has been taxon sampling, espe-

Fig. 2. Single most parsimonious tree (length ¼ 2564 steps) of echimyids based on the combined analysis of the cyt b, 12S, and 16S genes. Percent bootstrap values are given above branches and Bremer support values are given below. Arrow indicates the monophyly of Octodontoidea, and dots highlight branches with more than 50% bootstrap support.

Fig. 3. Highest likelihood tree ()Ln ¼ 22202.4) of echimyids based on the combined analysis of the cyt b, 12S, and 16S genes. Percent bootstrap values are given above branches. Arrow indicates the monophyly of Octodontoidea, stippled area shows the region of the tree with no resolution, and dots highlight branches with more than 50% bootstrap support.

4.1. Phylogenetic relationships

460

Y.L.R. Leite, J.L. Patton / Molecular Phylogenetics and Evolution 25 (2002) 455–464

cially of echimyids, the most diverse hystricognath family, which usually has been represented by only one or two species (e.g., Huchon and Douzery, 2001; Nedbal et al., 1994; Woods and Hermanson, 1985). The present report includes most of the extant echimyid genera, but capromyids are represented by only one taxon, Capromys pilorides. Considering the star shape of the echimyid molecular phylogeny presented here, with several long branches joining almost at a single point (Fig. 4), outgroup rooting is not a trivial matter since the root can be placed anywhere without changing the result significantly. To test the alternative topologies proposed by the studies mentioned above, we used the Shimodaira– Hasegawa test (Shimodaira and Hasegawa, 1999) as suggested by Goldman et al. (2000). Rooting the tree to break the monophyly of the clade Myocastor + Capromys gives significantly worse results either when Capromys ()Ln ¼ 22249.4, p ¼ 0.02) or Myocastor ()Ln ¼ 22245.3, p ¼ 0.04) is forced as the outgroup (I and II in Fig. 4), therefore supporting their sister-group relationship. The only alternative that would leave the three families (Echimyidae, Myocastoridae, and Capromyidae) monophyletic is if the clade Myocastor + Capromys is sister to the remaining echimyids (III in Fig. 4), which is not significantly worse than the highest-likelihood tree. It is not, however, significantly different from having any of the other eight well-supported clades of echimyids as a sister group to the remaining (see Fig. 4). The monophyly of the family Echimyidae as it is known today (including Myocastor, to the exclusion of Capromys, McKenna and Bell, 1997) is controversial and is not corroborated by the present study. Instead, a poorly resolved clade including Capromys, Myocastor, and the remaining echimyids was retrieved (Figs. 2 and 3).

Fig. 4. Unrooted phylogram of the highest likelihood tree showing only ingroup taxa. Well supported clades are depicted in bold lines. Rooting the tree at branches I or II, would break the monophyly of Capromys + Myocastor, giving a significantly worse result. Rooting at branch III would make the clade Capromys + Myocastor sister to all other echimyids. There is no statistical difference between rooting at branch III or any of the other branches represented by thin lines (see text for details).

This clade is moderately well supported in the parsimony analysis (74% bootstrap value, 8 steps of Bremer support), but not so in the maximum likelihood (bootstrap <50%). Capromys and Myocastor are actually well supported as sister taxa in both parsimony and likelihood analyses. The phylogenetic relationships between capromyids, Myocastor, and other echimyids have long been a matter of debate. Using electrophoretic data collected from blood proteins, Woods (1982) proposed the separation of Myocastor from capromyids elevating each to separate families and apart from Echimyidae. Woods and Hermanson (1985) summarized the data available at that time and proposed a phylogeny based on myological data where capromyids and echimyids formed a clade sister to Myocastor. Using the 12S gene, Nedbal et al. (1994) found capromyids to be sister to a clade formed by Myocastor and echimyids, but with virtually no support. Carvalho (1999) obtained ambiguous results regarding the position of Myocastor in relation to other echimyids using morphological characters and fossil taxa. He did not include Capromys in his dataset, but sampled extensively both extant and extinct echimyids, finding the placement of Myocastor to be unstable, depending on the combination of characters and taxa used (cranial and tooth characters, extant and extinct taxa). In his total evidence analysis, Myocastor falls within echimyids. Huchon and Douzery (2001) obtained the same result using a nuclear marker, exon 28 of the von Willebrand factor gene (vWF), with good support for Capromys as sister to a clade formed by Echimys, Proechimys, and Myocastor. It should be noted that Woods believes ‘‘capromyids are derived from heteropsomyine echimyids’’ (Woods (1989, p. 767)), but places Capromys and its relatives in their own family Capromyidae (Woods, 1993), therefore making his Echimyidae paraphyletic. Whether extant echimyids are monophyletic to the exclusion of Myocastor and Capromys is a different issue, and the mitochondrial data presented above do not answer this question since they form a basal polytomy. Given the uncertainties regarding the monophyly of echimyids when Myocastor and Capromys are excluded and since names should be given to well-supported clades, the results presented here corroborate the recognition of the clade Echimyidae including Myocastor and Capromys. This way, we suggest Echimyidae be defined as the crown group stemming from the most recent common ancestor of extant echimyid genera Myocastor, Capromys, Geocapromys, Mesocapromys, Plagiodontia, Myocastor, Mysateles, Echimys, Phyllomys, Makalata, Isothrix, Callistomys, Diplomys, Dactylomys, Kannabateomys, Olallamys, Euryzygomatomys, Clyomys, Carterodon, Proechimys, Hoplomys, Trinomys, Thrichomys, Mesomys, and Lonchothrix. This definition will probably exclude some of the Late Oligocene taxa (Deseadan, 29–24.5 million years ago, McKenna and

Y.L.R. Leite, J.L. Patton / Molecular Phylogenetics and Evolution 25 (2002) 455–464

Bell, 1997) referred to as echimyids (Patterson and Wood, 1982). In fact, Vucetich et al. (1999) pointed out that the relationships of the Late Oligocene to Middle Miocene Echimyidae with recent forms are difficult to establish. We believe future phylogenetic studies will find that some of these Oligocene forms do not stem from the crown group Echimyidae as defined above, and another name would have to be applied to this more inclusive clade (McKenna and Bell, 1997). 4.3. Relationships within Echimyidae The results presented here corroborate the hypothesis of a rapid diversification of extant echimyid rodents as proposed by Lara et al. (1996). There is support for very few groups among echimyid genera, while strong support is found both within genera and at levels above the family. Our addition of more characters and more taxa did not help to solve the basal polytomy of the Echimyidae. Thus, we endorse the star-phylogeny as a hard rather than soft polytomy. Below, we discuss the systematic implications of the results obtained with the addition of new taxa to the matrix of Lara et al. (1996), and compare these hypotheses with recent analyses based on morphological characters (Carvalho, 1999; Emmons, submitted). As shown above, the radiation of echimyid rodents includes a clade formed by Myocastor and Capromys, making the subfamily Myocastorinae as proposed by McKenna and Bell (1997, Table 1) paraphyletic. Five other suprageneric clades are well supported: Dactylomys + Kannabateomys, Euryzygomatomys + Clyomys, Proechimys + Hoplomys, Mesomys + Lonchothrix, and Makalata + (Echimys + Phyllomys). Isothrix emerged as sister to Mesomys + Lonchothrix in both parsimony and likelihood analyses, but with no support, and Trinomys and Thrichomys join the base of the tree, with no clear close relatives. The well-supported clade containing Dactylomys and Kannabateomys is in agreement with the recognition of the subfamily Dactylomyinae (Tate, 1935, that also includes Olallamys) and the morphological analyses of Carvalho (1999) and Emmons (submitted). Support for the monophyly of other two subfamilies, Echimyinae and Eumysopyinae (sensu Patton and Reig, 1989, see Table 1), is generally lacking based on the sequence data. Within the Echimyinae, Makalata, Echimys, and Phyllomys form a robust clade, but they are not joined by Isothrix, which came out as sister to Mesomys + Lonchothrix in both parsimony and likelihood trees, but with no support. Carvalho (1999) found the Echimyinae to be paraphyletic as most genera were more closely related to dactylomyines, while Emmons (submitted) found them to be monophyletic, but with low support. Patton and Reig (1989) found the phylo-

461

genetic position of Mesomys to be ambiguous in relation to echimyines and eumysopines using electromorphic characters. Lara et al. (1996) found Mesomys + Lonchothrix and Dactylomys nested within a clade containing the echimyines Isothrix, Makalata, Echimys, and Phyllomys, but the bootstrap support was low (Fig. 1). We found the same result in the maximum likelihood analysis presented here (Fig. 3). Interestingly, Mesomys and Lonchothrix are climbing rats as are all the echimyines and dactylomyines, but have cheekteeth with narrow folds which become isolated as enamel islands, similar to the terrestrial forms, and are therefore classified within the Eumysopinae (sensu Patton and Reig, 1989). If additional data corroborate the position of Mesomys and Lonchothrix as basal to echimyines and dactylomyines, as suggested by the molecular data, it would be most parsimonious to conclude that morphological adaptations for climbing evolved only once in the common ancestor of these arboreal taxa, while the narrow-fold cheekteeth pattern is a primitive character shared by Mesomys and Lonchothrix and the terrestrial forms. Among the Eumysopinae (sensu Patton and Reig, 1989), Clyomys and Euryzygomatomys form a very robust clade that is joined by Carterodon in morphological analyses (Carvalho, 1999; Emmons, submitted). In addition, the genus Trinomys was well supported as monophyletic in both likelihood and parsimony analyses, confirming the result obtained by Carvalho (1999) using morphological data. Lara et al. (1996; see also Lara and Patton, 2000) did not find support for the monophyly of Trinomys using the complete sequence of the cyt b, but they included the divergent T. albispinus in their analyses, which is absent from the present report. In agreement with Lara et al. (1996), we found no support for a sister relationship between Trinomys and Proechimys (even if Hoplomys is included), as has been assumed by previous taxonomy, therefore corroborating the generic status of Trinomys, the terrestrial spiny rats of coastal Brazil.

5. Timing of divergence and biogeography Using the topology of the maximum likelihood tree presented above (Fig. 3), we compared the likelihood ratio enforcing versus not enforcing the molecular clock. Clock-constrained trees were significantly worse when all three genes were combined or in any combination of two genes. This result reflects the different rates of evolution across the included taxa. Clock-constrained trees were also worse when individual genes, confirming heterogeneous rates within them, estimated branch lengths. When the three codon positions of the cyt b gene were analyzed separately, the clock was rejected for second position changes, but not for neither first nor

462

Y.L.R. Leite, J.L. Patton / Molecular Phylogenetics and Evolution 25 (2002) 455–464

third position substitutions. We used the third position since the number of substitutions is higher, increasing the likelihood of estimating short branch lengths. The likelihood model used corrects for the saturation observed in third position transitions (Lara et al., 1996). The choice of a calibration date is not trivial, since extant echimyids are typically known only since the Late Pleistocene. The oldest record for an extant genus is for Thrichomys from the Late Miocene–Late Pliocene, according to McKenna and Bell (1997). However, the assignment of this taxon to Thrichomys is doubtful (Reig, 1989), partly because the material is highly fragmentary (Verzi et al., 1995). On the other hand, Thrichomys is apparently closely related to Pampamys, and extinct genus from the Late Miocene (Verzi et al., 1995), and these two taxa seem to be related both to the extinct Theridomys (Late Miocene) and the extant Clyomys and Euryzygomatomys (Carvalho et al., 1995; Montalvo et al., 1996). Consequently the split between those lineages must have occurred before the Late Miocene (D.H. Verzi, personal communication). The clock was therefore calibrated using the minimum date (Huayquerian, 6.8–9 million years ago) for the origin of the branch leading to Thrichomys, set to the median (7.9 million years ago). We recognize the inadequacies of a single calibration point, and provide the following only as a ‘‘best-case’’ scenario, with the present data available. Fig. 5 presents a maximum likelihood tree with branch lengths optimized enforcing the molecular clock for third position changes in the cyt b. It should be noted that a large part of the cladogenesis of extant echimyids during the Late Miocene fits within the 2.2 MY window of the Huayquerian based on the clock calibration, but since the calibration was based on the fossil record, those should be regarded as minimum dates. Although younger, those dates are not in disagreement with analyses based on the fossil record that support a major hystricognath radiation at the Middle–Late Miocene boundary (Vucetich et al., 1999). According to these authors, climatic and tectonic events (especially the Quechua tecnosedimentary episode, see also Marshall and Sempere, 1993) caused austral environments to become more arid, promoting a renovation of the hystricognath faunas that reached their modern aspect (Vucetich et al., 1999). The dates reported here are in agreement with those estimated by Huchon and Douzery (2001), who dated the split between Capromys and Myocastor + Echimys between 7 and 10 million years ago. They also agree in placing the split between Ctenomys and echimyids in the Miocene (here approximately 10.8 million years ago) instead of the Oligocene. This supports our suggestion above that Late Oligocene taxa referred to as echimyids (e.g., Patterson and Wood, 1982) may not be part of the crown group Echimyidae, but rather actually be part of larger clade that includes octodontids as well. In CarvalhoÕs (1999) analyses in-

Fig. 5. Clock-constrained maximum likelihood tree of echimyid genera. Topology based on the combined analysis of the three mitochondrial genes, and branch lengths estimated using third position cyt b substitutions. Calibration set to the origin of the branch leading to Thichomys estimated to be of Huayquerian age (ca. 7:9  1:1 MYA, stippled area). Below is a graph showing sea level changes (after Haq et al., 1987) over the same temporal scale for comparison.

cluding several fossil forms, the crown group Echimyidae does not include Late Oligocene taxa, most of which join the tree at a basal polytomy along with some of the oldest Octodontidae known. Moojen (1948, p. 310) proposed a vicariant hypothesis for the divergence of the spiny rats Proechimys and Trinomys. According to him, the dry vegetation belt (the Cerrado and Caatinga of today) that he believed formed during the Pleistocene divided the range of what would have been a widespread common ancestor. However, the results of the clock-constrained tree indicate that Proechimys and Trinomys have a much older origin (at least 6.8–9 million years ago, and they are not even sister taxa). These results do show, however, concordance for the internal branching of two other pairs of Amazon and Atlantic Forest genera, the tree rats (Echimys and Phyllomys) and bamboo rats (Kannabateomys and Dactylomys), at about 3.5 million years ago (Fig. 5). If we compare this date with eustatic sea level curves through time (Haq et al., 1987), it corresponds with an abrupt drop of more than 100 m in sea level at 3.8 million years

Y.L.R. Leite, J.L. Patton / Molecular Phylogenetics and Evolution 25 (2002) 455–464

ago, which happened after a period when the highest sea levels since the Miocene were recorded. Considering that sea level drops since the Oligocene may be in large part due to the influence of glaciations (Haq et al., 1987), it is reasonable to correlate this drop with climatic change. In this case, warm conditions around 5 million years ago are hypothesized to have allowed the existence of a continuous lowland rainforest in South America (the ‘‘ancestor’’ of present-day Amazon and Atlantic rainforests) where the common ancestors of the tree rats and the bamboo rats lived. With the abrupt onset of cooler and perhaps drier climate at 3.8 million years ago, moist forests would have become restricted to the Atlantic coast and the Amazon basin, respectively. Since both tree rats and bamboo rats are arboreal animals typical of forested areas, they constitute the vicariant forms now restricted to eastern Brazil (Phyllomys and Kannabateomys) and the Amazon (Echimys and Dactylomys). Mori et al. (1981) and Vanzolini (1988) also hypothesized isolation between the Amazon and Atlantic rainforests since the Tertiary, based on levels of endemism and disjunct distributions of trees and lizards, respectively. Amorin and Pires (1996) proposed a much older separation, of Cretaceous age, but more recent connections must have occurred, to explain the disjunction of recent groups, including all mammals. Costa (2002) examined the phylogeography of seven marsupial and three sigmodontine rodent genera distributed across the Amazon and Atlantic rainforests. She found close connections between these two biomes, as revealed by area cladograms where the Amazon and Atlantic forest were not always reciprocally monophyletic. However, no concordant pattern of area relationship was found, suggesting that different processes and/or historic events during the Tertiary and Quaternary affected the diversification within each lineage (Costa, 2002).

Acknowledgments We thank the following researchers for kindly providing tissue samples: R. Cerqueira, L.H. Emmons, A.L. Gardner, L. Geise, E.D. Hingst, D. Huchon, A. Langguth, M. Lara, E. Lessa, J.R. Malcolm, M. Mensink, B. Milstead, M.A. Mustrangi, J. Pagnozzi, L.M. Pessoa, P. da Rocha, M.N.F. da Silva, and Y. Yonenaga-Yassuda. We thank B.D. Mishler, R. Byrne, and L.P. Costa for providing critical comments that improved the quality of the manuscript. M.F. Smith provided essential help in the laboratory, and several DNA samples used here were extracted by M
arcia Lara and M.N.F. da Silva. Financial support for field work was obtained from the National Geographic Society (NGS) and the Museum of Vertebrate Zoology. Grants from NGS and the National Science Foundation (to JLP) funded the Laboratory analyses. Leite had fellowship support from the

463

Conselho Nacional de Desenvolvimento Cientif
ıco e Tecnol
ogico (CNPq), Brazil.

References Amorin, D.S., Pires, M.R.S., 1996. Neotropical biogeography and a method for maximum biodiversity estimation. In: Bicudo, C.E.M., Menezes, N.A. (Eds.), Biodiversity in Brazil: A First Approach. CNPq, S~ao Paulo, pp. 183–219. Bremer, K., 1988. The limits of amino-acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42, 795–803. Carvalho, D.A.D., Oliveira Filho, A.T.D., Vilela, E.D.A., Gavilanes, M.L., 1995. Phytosociological structure of a riparian forest of the upper Rio Grande (Bom Sucesso, Minas Gerais, Brazil). Rev. Bras. Bot. 18, 39–49. ~ es filogen
eticas entre formas recentes e Carvalho, G.A.S., 1999. Relacßo f
osseis de Echimyidae (Rodentia: ystricognathi) e aspectos da evolucß~ao da morfologia dent
aria’’. Masters Thesis, Universidade Federal do Rio de Janeiro, Rio de Janeiro. Costa, L.P., 2002. The molecular phylogeographic bridge between the Amazon and the Atlantic Forest: a case study with small mammals. J Biogeography, in press. DÕErchia, A.M., Gissi, C., Pesole, G., Saccone, C., Arnason, U., 1996. The guinea-pig is not a rodent. Nature 381, 597–600. Eisenberg, J.F., Redford, K.H., 1999. Mammals of the Neotropics: the Central Neotropics. University of Chicago Press, Chicago, IL. Emmons, L.H., submitted. A revision of the genera of arboreal Echimyidae (Rodentia: Echimyidae, Echimyinae); with descriptions of two new genera. Am. Mus. Novit. Emmons, L.H., Feer, F., 1997. Neotropical Rainforest Mammals: A Field Guide, second ed. University of Chicago Press, Chicago, IL. Emmons, L.H., Leite, Y.L.R., Kock, D., submitted. A review of the named forms of Phyllomys (Rodentia, Echimyidae), with taxonomic notes. Am. Mus. Novit. Emmons, L.H., Vucetich, M.G., 1998. The identity of WingeÕs Lasiuromys villosus and the description of a new genus of echimyid rodent (Rodentia: Echimyidae). Am. Mus. Novit. 3223, 1–12. Eriksson, T., 1998. Autodecay. Version 4.0. Department of Botany, Stockholm University, Stockholm. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach utilizing the bootstrap. Evolution 39, 783–791. Frye, M.S., Hedges, S.B., 1995. Monophyly of the order Rodentia inferred from mitochondrial DNA sequences of the genes for 12S rRNA, 16S rRNA, and tRNA-valine. Mol. Biol. Evol. 12, 168–176. Goldman, N., Anderson, J.P., Rodrigo, A.G., 2000. Likelihood-based tests of topologies in phylogenetics. Syst. Biol. 49, 652–670. Gutell, R.R., Gray, M.W., Schnare, M.N., 1993. A compilation of large subunit (23S and 23S-like) ribosomal RNA structures. Nucleic Acid Res. 21, 3055–3074. Haq, B.U., Hardenbol, J., Vail, P.R., 1987. Chronology of fluctuating sea levels since the Triassic. Science 235, 1156–1167. Huchon, D., Douzery, E.J.P., 2001. From the Old World to the New World: a molecular chronicle of the phylogeny and biogeography of hystricognath rodents. Mol. Phylogenet. Evol. 20, 238–251. Lara, M.C., Patton, J.L., 2000. Evolutionary diversification of spiny rats (genus Trinomys, Rodentia: Echimyidae) in the Atlantic Forest of Brazil. Zool. J. Linn. Soc. 130, 661–686. Lara, M.C., Patton, J.L., Da Silva, M.N.F., 1996. The simultaneous diversification of South American echimyid rodents (Hystricognathi) based on complete cytochrome b sequences. Mol. Phylogenet. Evol. 5, 403–413. Leite, Y.L.R., 2001. Systematics of the Atlantic tree rats, genus Phyllomys (Rodentia, Echimyidae), and the evolution of echimyid rodents in South America. Ph.D. Dissertation, University of California, Berkeley.

464

Y.L.R. Leite, J.L. Patton / Molecular Phylogenetics and Evolution 25 (2002) 455–464

Marshall, L.G., Sempere, T., 1993. Evolution of the Neotropical Cenozoic land mammal fauna in its geochronologic, stratigraphic and tectonic context. In: Goldblatt, P. (Ed.), Biological Relationships Between Africa and South America. Yale University Press, New Haven, CT, pp. 329–392. Martin, T., 1994. On the systematic position of Chaetomys subspinosus (Rodentia: Caviomorpha) based on evidence from the incisor enamel microstructure. J. Mammal. Evol. 2, 117–131. McKenna, M.C., Bell, S.K., 1997. Classification of Mammals Above the Species Level. Columbia University Press, New York. Montalvo, C., Vucetich, M.G., Verzi, D.H., 1996. Presencia de Theridomysops parvulus (Rodentia, Echimyidae, Eumysopinae) en la Formaci
on Cerro Azul, Provincia de La Pampa. Ameghiniana 33, 467. Moojen, J., 1948. Speciation in the Brazilian spiny rats (genus Proechimys, family Echimyidae). Univ. Kans. Publ. Mus. Nat. Hist. 1, 303–401. Mori, S.A., Boom, B.M., Prance, G.T., 1981. Distribution patterns and conservation of eastern Brazilian coastal forest tree species. Brittonia 33, 233–245. Nedbal, M.A., Allard, M.W., Honeycutt, R.L., 1994. Molecular systematic of hystricognath rodents: evidence from the mitochondrial 12S rRNA gene. Mol. Phylogenet. Evol. 3, 206–220. Patterson, B., Wood, A.E., 1982. Rodents from the Deseadan Oligocene of Bolivia and the relationships of the Caviomorpha. Bull. Mus. Comp. Zool. 149, 371–543. Patton, J.L., Reig, O.A., 1989. Genetic differentiation among echimyid rodents, with emphasis on spiny rats, genus Proechimys. In: Redford, K.H., Eisenberg, J.F. (Eds.), Advances in Neotropical Mammalogy. Sandhill Crane Press, Inc., Gainesville, NC, pp. 75–96. Patton, J.L., Silva, M.N.F., Malcolm, J.R., 2000. Mammals of the Rio Juru
a and the evolutionary and ecological diversification of Amazonia. Bull. Am. Mus. Nat. Hist. 244, 1–306. Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14, 817–818. Reig, O.A., 1989. Karyotypic repatterning as one triggering factor in cases of explosive speciation. In: Fontdevila, A. (Ed.), Evolutionary Biology of Transient Unstable Populations. Springer, Berlin, pp. 246–289. Rodr
ıguez, F., Oliver, J.F., Mar
ın, A., Medina, J.R., 1990. The general stochastic model of nucleotide substitution. J. Theor. Biol. 142, 485–501. Sarich, V.M., Cronin, J.E., 1980. South American mammal molecular systematics evolutionary clocks/and continental drift. In: Ciochon, R.I., Chiarelli, A.B. (Eds.), Evolutionary Biology of the New World Monkeys and Continental Drift. Plenum Press, New York, pp. 399–421. Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of loglikelihoods with applications to phylogenetic inference. Mol. Biol. Evol. 16, 1114–1116.

Silva, M.N.F., 1998. Four new species of spiny rats of the genus Proechimys (Rodentia: Echimyidae) from the western Amazon of Brazil. Proc. Biol. Soc. Wash. 111, 436–471. Simpson, G.G., 1945. The principles of classification and a classification of mammals. Bull. Am. Mus. Nat. Hist. 85, 1–350. Springer, M.S., Douzery, E., 1996. Secondary structure and patterns of evolution among mammalian mitochondrial 12S rRNA molecules. J. Mol. Evol. 43, 357–373. Swofford, D.L., 2000. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland. Tate, G.H.H., 1935. The taxonomy of the genera of neotropical hystricoid rodents. Bull. Am. Mus. Nat. Hist. 68, 295–447. Vanzolini, P.E., 1988. Distributional patterns of South American lizards. In: Vanzolini, P.E., Heyer, W.R. (Eds.), Proceedings of a Workshop on Neotropical Distribution Patterns. Academia Brasileira de Ci^encias, Rio de Janeiro, pp. 317–342. Verzi, D.H., Vucetich, M.G., Montalvo, C.I., 1995. Un nuevo Eumysopinae (Rodentia, Echimyidae) del Mioceno Tardio de la Provincia de La Pampa y consideraciones sobre la historia de la subfamilia. Ameghiniana 32, 191–195. Vi
e, J.C., Volobouev, V., Patton, J.L., Granjon, L., 1996. A new species of Isothrix (Rodentia: Echimyidae) from French Guiana. Mammalia 60, 393–406. Vucetich, M.G., Verzi, D.H., Hartenberger, J.-L., 1999. Review and analysis of the radiation of the South American Hystricognathi (Mammalia, Rodentia). Comp. Rend. Acad. Sci. Ser. II A 329, 763–769. Wallau, B.R., Schmitz, A., Perry, S.F., 2000. Lung morphology in rodents (Mammalia, Rodentia) and its implications for systematics. J. Morphol. 246, 228–248. Woods, C.A., 1982. The history and classification of South American Hystricognath rodents: reflections on the far away and long ago. In: Mares, M.A., Genoways, H.H. (Eds.), Mammalian Biology in South America, vol.6, Special Publication Series: The Pymatuning Symposia in Ecology. University of Pittsburgh, Pittsburgh, pp. 377–392. Woods, C.A., 1989. The Biogeography of West Indian rodents. In: Woods, C.A. (Ed.), Biogeography of the West indies: Past, Present, and Future. Sandhill Crane Press, Inc., Gainesville, pp. 741–798. Woods, C.A., 1993. Suborder Hystricognathi. In: Wilson, D.E., Reeder, D.M. (Eds.), Mammal Species of the World: a Taxonomic and Geographic Reference. Smithsonian Institution Press, Washington, pp. 771–806. Woods, C.A., Hermanson, J.W., 1985. Myology of hystrichognath rodents: an analysis of form, function, and phylogeny. In: Lucket, W.P., Hartenberger, J.L. (Eds.), Evolutionary Relationships Among Rodents: A Multidisciplinary Analysis, NATO ASI Series. Series A: Life Sciences, vol. 92. Plenum Press, New York, pp. 515– 548.