Evolutionary origins and sequence of the Escherichia coli O4 O-antigen gene cluster

FEMS Microbiology Letters 244 (2005) 27–32 www.fems-microbiology.org

Evolutionary origins and sequence of the Escherichia coli O4 O-antigen gene cluster q Jocelyne M. DÕSouza, Gabrielle N. Samuel, Peter R. Reeves

*

School of Molecular and Microbial Biosciences, University of Sydney, NSW 2006, Australia Received 29 August 2004; received in revised form 22 December 2004; accepted 5 January 2005 First published online 18 January 2005 Edited by R.Y.C. Lo

Abstract Escherichia coli express many types of O antigen, present in the outer membrane of the Gram-negative bacterial cell wall. O-Antigen biosynthesis genes are clustered together and differences seen in O-antigen types are due to genetic variation within this gene cluster. Sequencing of the E. coli O4 O-antigen gene cluster revealed a similar gene order and high levels of similarity to that of E. coli O26; indicating a common ancestor. These lateral transfer events observed within O-antigen gene clusters may occur as part of the evolution of the pathogenic clones. Ó 2005 Published by Elsevier B.V. on behalf of the Federation of European Microbiological Societies. Keywords: Escherichia coli; O-Antigen; O4 gene cluster; Evolutionary origins

1. Introduction Escherichia coli is a clonal species with clones normally identified by their combination of O and H (and sometimes K) antigens. The O-antigen consists of a number of oligosaccharide units comprised of two to six sugar residues, and variation exists in the number, type and linkages between these sugars. Variation in O-antigen structures contributes to major antigenic variability on the cell surface, and on this basis, there are 186 different forms recognised in E. coli (including Shigella strains) [1]. The surface of the O antigen is subject to intense selection by the environment and the host immune system, and this selection is believed to be a major factor in the maintenance of different O-antigen forms within a species. q The GenBank Accession No. for the sequence reported in this paper is AY568960. * Corresponding author. Fax: + 61 2 9351 4571. E-mail address: [email protected] (P.R. Reeves).

Genes involved in O-antigen biosynthesis are usually clustered, and in E. coli, generally flanked by the housekeeping genes galF and gnd at the 5 0 and 3 0 ends, respectively. O-Antigen gene clusters have a low mol% G + C content of generally less than 40% (compared to 51% in typical genes of E. coli) indicative of recent lateral transfer of genes from other bacterial species. Extensive work into the genetic basis of O-antigen variation and the identification of O-antigen biosynthesis genes by sequence analyses has been undertaken, including in organisms that express similar O-antigen types, for example E. coli Sonnei and Plesiomonas shigelloides O17 [2] and Salmonella enterica O35 and E. coli O111 [3]. Escherichia coli strains expressing the O4 O antigen are implicated in extra intestinal infections in humans and animals, such as genitourinary tract infections manifested as cystitis, pyelonephritis and urosepsis. The loss of the O4 O antigen has been shown to cause a significant decrease in infection [4]. E. coli O4 strains have also been associated with enteric disease, especially

0378-1097/$22.00 Ó 2005 Published by Elsevier B.V. on behalf of the Federation of European Microbiological Societies. doi:10.1016/j.femsle.2005.01.012

28

J.M. DÕSouza et al. / FEMS Microbiology Letters 244 (2005) 27–32

(a)

(b)

3

α-L-Rha

1,4

α-L-FucNAc

1,3

ß-D-GlcNAc

α-D-Glc 1,3

α-L-Rha

1,6

α-D-Glc

1,3

α-L-FucNAc

1,3

ß-D-GlcNAc

1

Fig. 1. O-Antigen structures of E. coli O26 (a) [5] and E. coli O4 (b) [6]. The O26 structure is composed of three sugars L -rhamnose (L -Rha), Nacetyl-L -fucosamine (L -FucNAc) and N-acetyl-D -glucosamine (D -GlcNAc). The O4 structure has two additional D -glucose (D -Glc) sugars, one on the main branch and the other on the side branch. The linkage and sugar conformation (a or b) is also indicated.

All plasmids used in this study were maintained in E. coli K-12 strain JM109 (Promega). The E. coli O4 type strain 0544 (O4:H5:K3) was obtained from the Institute of Medical and Veterinary Science (IMVS), Adelaide, Australia.

PCR amplify the O4 O-antigen gene cluster by long range PCR as described previously [7]. To limit the effect of PCR errors, 10 individual PCR reactions were mixed, and used to make the DNA bank. Long-range PCR products were subjected to shearing using a GeneMachine Hydroshear according to manufacturerÕs instructions. Fragments generated were size-selected (between 1.5 and 4 kb), dA-tailed, cloned and sequenced as previously described [8]. Sequence data was assembled using the PHRAP/PHRED package from the University of Washington Genome Center, and the program CONSED [9]. The data was analysed by using the Australian National Genomic Information Service (ANGIS) and the BLAST database used to search for sequence matches. The quality of chromosomal DNA of each E. coli strain used for PCR screening was assessed by positive PCR amplification with primers based on the recA gene (primers #4790 and #4791) (Table 1). PCR screening using primers #3445 and #5253 (based on the O4 wbuB and wbuC region, respectively) were carried out on E. coli strains as previously described [7] and some PCR products were sequenced.

2.2. Construction of a clone bank for sequencing

2.3. Nucleotide sequence Accession Number

Chromosomal DNA was prepared and primers #1523 and #1524 (Table 1) based on sequences within the galF and gnd genes, respectively, were used to

The DNA sequence of the E. coli O4 O-antigen gene cluster has been deposited in GenBank (Accession No. AY568960).

shiga-toxin producing strains (STEC) responsible for hemorrhagic colitis and hemolytic uremic syndrome cases. The O-antigen structures of E. coli O26 [5] and O4 [6] are similar (Fig. 1) and previous PCR assays based on the sequence of the E. coli O26 O-antigen gene cluster indicated sequence similarity between the gene clusters [7]. In order to understand the genetics and evolutionary origins of the O4 and O26 O antigens of E. coli, the O4 gene cluster was sequenced and compared to the E. coli O26 gene cluster.

2. Methods 2.1. Bacterial strains and plasmids

Table 1 List of primer sequences used in this study

3. Results and discussion

Primer name

Sequence (5 0 –3 0 )

1523 1524 3445 4790a 4791a 5253

ATTGTGGCTGCAGGGATCAAAGAAATC TAGTCGCGCTGGGCCTGGATTAAGTTCGC CCATAGCACCACGAGTTGGG CGCATTCGCTTTACCCTGACC TCGTCGAAATCTACGGACCGGA CGGGATCCCACTATAACCACTTAGAAAAAGC

a These primers were designed www.web.mpiib-berlin.mpg.de/mlst.

by

the

Achtman

group

3.1. Sequence of the E. coli O4 O-antigen gene cluster Primers based on the galF and gnd genes were used to amplify the O4 O-antigen gene cluster by long-range PCR. A sequence of 14,531 bases was obtained from galF (positions 1–879) to gnd (positions 14,273–14,531) consisting of 13 open reading frames (orfs) (Fig. 2), all

J.M. DÕSouza et al. / FEMS Microbiology Letters 244 (2005) 27–32 47

43

DNA Identity %

94.7 86.2

Protein Identity%

97.9 94.9

GC%

44

38

31

86.8

74.8

19

96.5

71.2

35

31

32

39

38

41

29

40

42

E. coli O26

20

29

20

21.8

23

36

31

31

81.6

94.8

88.3

93.8

96.7

95.5

98.5

98.3

94.7

97.7

E. coli O4 GC%

43

46

43

32

38

39

41

39

42

Fig. 2. Comparison of the E. coli O26 and E. coli O4 O-antigen gene clusters. The DNA and protein identity between both gene clusters is given as a percentage. The mol% G + C content of all genes with the gene cluster is also indicated.

in the same transcriptional direction. The sequences were used to search databases for indication of possible function. The E. coli O4 O-antigen gene cluster has a low mol% G + C of 38%, indicative of transfer from another species. 3.2. O4 O antigen genes O-Antigen gene clusters generally contain three classes of genes: (i) those required for the synthesis of nucleotide sugar precursors, (ii) genes required for the transfer of nucleotide sugars to build the O unit, and (iii) genes for the processing steps in the conversion of the O unit to O antigen as part of the LPS [10]. Based on the E. coli O4 O antigen structure, we expect genes for the synthesis of the sugars dTDP-L -Rha and UDPL -FucNAc; genes for sugar transferases, and genes for the O-unit flippase (wzx) and polymerase (wzy). dTDP-L -Rha pathway genes: The four genes involved in the biosynthesis of dTDP-L -Rha are usually clustered together in the gene order rml BDAC at the 5 0 end of the gene clusters in E. coli [11]. The rmlB (dTDP-glucose 4,6-dehydratase), rmlD (dTDP-4-dehydrorhamnose reductase), rmlA (dTDP-glucose-1-phosphate thymidylyltransferase) and rmlC (dTDP-4-dehydrorhamnose 3,5-epimerase) genes of O4 share 94.7%, 86.2%, 86.8% and 74.8% identity to those of O26, respectively (Fig. 2). This relatively low level of identity seen in rmlC along with its low mol% G + C (being lower than the 5 0 end) is consistent with a study by Li and Reeves [11] on S. enterica in which the 3 0 end of the rml gene set is more varied and O-antigen specific, compared to the 5 0 end which is subspecies specific. UDP-L -FucNAc pathway genes: fnlA, fnlB and fnlC were at the 3 0 end of the gene cluster, and 81.6%, 94.8% and 96.7% identical, respectively, to those of E. coli O26. These fnl genes are present in five other reported gene clusters coding for UDP-L -FucNAc containing structures (see www.microbio.usyd.edu.au/ BPGD/default.htm for details). FnlA, FnlB and FnlC

have been shown to carry out a five step reaction cascade for the synthesis of UDP-L -FucNAc [12]. O-Antigen processing genes: Most E. coli O antigens are synthesised by the Wzx/Wzy-dependent system, whereby the O units are constructed on the inner face of the cytoplasmic membrane, and then transported across the membrane by a flippase (Wzx) before being polymerised by the Wzy polymerase [10]. These proteins are known to be hydrophobic and not conserved within species, hence transmembrane regions and conserved motifs within the proteins are used for identification. The wzy gene from an O4 uropathogenic strain (serotype O4:K6) was previously sequenced and insertional mutagenesis as well as structure analysis on this gene confirmed polymerase function [13]. orf7 is identical to this wzy gene. The remaining transmembrane protein, Orf5 was assigned as the putative flippase Wzx. Analysis of Orf5 using TMHMM [14] showed that this integral inner membrane protein contained nine transmembrane segments. Orf5 also shared homology to other putative flippase proteins, such 43% to the Wzx from Shigella flexneri. The protein identity between the Wzx proteins from E. coli O4 and O26 is very low, only 20%. The O4 and O26 structures both contain D -GlcNAc as their first sugar, and recently, it was shown that Wzx proteins from several different O-antigens appear to have specificity for the same first sugar attached to Und-PP, regardless of the remainder of the O-unit [15]. Putative glycosyltransferase genes: In E. coli strains where UDP-D -GlcNAc is usually the first sugar, UDPD -GlcNAc-P is added to the lipid carrier undecaprenol phosphate (UndP) by the initial transferase WecA. wecA resides outside the gene cluster [16], and is presumed to be the first transferase gene for the O4 O-antigen gene cluster. Orf12 shares 94.7% identity to WbuB from the E. coli O26 gene cluster, previously thought to be the L -FucNAc transferase responsible for L -FucNAc-a-(1,3)UDP-D -GlcNAc linkage; which is also present in O4.

30

J.M. DÕSouza et al. / FEMS Microbiology Letters 244 (2005) 27–32

Orf12 has been named WbuB, and is part of the GT4_b family of transferases (distantly related subfamily within the family GT4) of the Henrissat scheme [17]. UDPL -FucNAc has an a conformation, hence the sugar transfer would require the function of a retaining glycosyltransferase. GT4 transferases function via a retaining mechanism, and this is consistent with WbuB being responsible for the formation of the L -FucNAc-a-(1,3)UDP-D -GlcNAc linkage. Orf6 is in the GT2 family of transferases [17], and has been named WbuG. GT2 transferases function via an inversion mechanism. A dTDP-nucleotide-sugar transferred to the O unit via an a linkage involves an inversion of sugar conformation, thus implicating WbuG in the formation of the linkage, as this is the only linkage requiring inversion. Furthermore, WbuG also shares homology to other putative rhamnosyl transferases, such as 35% protein identity to WciJ from Streptococcus pneumoniae. There are two UDP-D -Glc residues in the O4 structure. The side branch UDP-D -Glc residue is linked via an a-(1,3) linkage to the dTDP-L -Rha, and the main chain UDP-D -Glc sugar is linked to the UDP-L -FucNAc also via an a-(1,3) linkage; both requiring the function of a retaining transferase. Orf8 is the only remaining putative glycosyltransferase to be assigned a linkage. It shares 42% identity to a putative glycosyltransferase WbwG, from Shigella boydii O13 [1] and 27% identity to the E. coli K-12 UDP-D -Glc transferase WbbK [18]. Orf8 has been named WbuH and belongs to the GT4 family of transferases, which are responsible for forming retaining linkages. We suggest that WbuH transfers the main chain glucose as there are several cases where the side branch glucose is added from Und-P-Glc after synthesis and translocation of the O unit [18]. The deduced amino acid sequence of the product of orf13 (13,754–14,161) shows 98.5% identity to E. coli O26 wbuC; and has been named wbuC. It has 407 bp and no known function. 3.3. Role of O4 and O16 genes in formation of a hybrid structure Our data adds further insight into the formation of a reported hybrid O-antigen structure. Kogan et al. [6] showed that E. coli K-12 strains carrying an incomplete O4 O-antigen gene cluster (clone pGH58) produced a modified O4 antigen, whereas those with the complete gene cluster produced the typical O4 antigen. When the E. coli K-12 O antigen sequence and structure were determined [18], it became evident that the modified structure was a hybrid between the O4 and K-12 structures, as it contains the D -Glc-a-(1,3)-L FucNAc-a-(1,3)-D -GlcNAc portion of O4, but the bD -Galf-(1,6)-a-D -Glc segment of K-12. Now that we

have a sequence for O4 we can see what genes were present in pGH58 since a detailed restriction map is available [19]. The restriction sites from positions 7444–13,137 of our sequence (containing wzy, wbuH, fnlABC, wbuB and wbuC) are almost identical to those of pGH58. This region at the 3 0 end of the O4 gene cluster includes the genes required for the synthesis of the D -Glc-a-(1,3)-L -FucNAc-a-(1,3)-D -GlcNAc component of the hybrid K-12/O4 structure. We can now see that pGH58 lacked the rhamnose transferase gene for transfer of L -Rha to D -Glc for completion of the main chain of an O4 O-unit. This also provides some evidence that the E. coli O4 WbuG is a rhamnosyl transferase and WbuH is a putative glucosyltransferase. It seems clear that in the absence of a rhamnose transferase, the K-12 WbbI adds Galf to give what appear to be normal amounts of O antigen. This verifies the earlier conclusions for synthesis of the hybrid structure [18] and gives compelling evidence that WbbI of K-12, which in K-12 transfers Galf to the D -Glc-a(1,3)-L -Rha-a-(1,3)-D -GlcNAc, can also add Galf to the D -Glc-a-(1,3)-L -FucNAc-a-(1,3)-D -GlcNAc O4 intermediate. The K-12 polymerase carries out polymerisation even though both wzy genes are present, as the linkage is the same as in K-12. Furthermore, the pGH58 clone was still able to react with O4 antisera [20], indicating that the genes present at the 3 0 end of the O4 O-antigen gene cluster are an important determinant of O4 immune specificity. 3.4. PCR screening of the E. coli O4 wbuB and wbuC region The high level of identity at the 3 0 ends of the E. coli O4 and O26 gene clusters which include the fnl genes, wbuB and wbuC, suggests a common origin for this group of genes. PCR screening using primers #3445 and #5253 (based on the wbuB and wbuC region) was carried out on E. coli strains. Positive PCR results were obtained only with O12, O25 and O172 strains, the same strains that showed the presence of wbuB in a previous study [7]. The PCR products were sequenced and the level of identity found to be extremely high – E. coli O12 (95.1%), O25 (96.7%), O172 (96.6%) [data not shown]. The O172 O-antigen structure contains the same L -FucNAc-a-(1,3)-D -GlcNAc linkage [21] found in O4 and O26; and the high level of identity indicates that O12 and O25 also have this linkage. The S. boydii O13 O-antigen structure contains the L -QuiNAc-a-(1,3)-D -GlcNAc linkage and the gene cluster was found to have a wbuC homolog adjacent to a putative L -QuiNAc transferase gene [1]. The level of identity between WbuC from O4 and Orf10 in S. boydii is 45%, which is lower than the level seen between O4 and O26. This suggests that wbuC is not only present in gene clusters with structures that

J.M. DÕSouza et al. / FEMS Microbiology Letters 244 (2005) 27–32

31

Fig. 3. Schematic representation of the base pair sequence variation between the E. coli O26 and E. coli O4 O-antigen gene clusters. Each solid black bar represents a nucleotide change between both sequences. The genes present at the 5 0 ends (a) and the 3 0 ends (b) of both sequences are highly similar, compared to the variable central region.

contain L -FucNAc, but also L -QuiNAc and may be attributed to the fact that L -QuiNAc and L -FucNAc sugars have similar structures.

4. Escherichia coli O4 and O26 gene cluster, organization and evolutionary relationship Glycosyl transferases tend to be gene cluster specific due to the large variation in the linkage and types of sugar transferred. The putative rhamnosyl transferases WbuG and WbuA are very different as they catalyse different linkages in the E. coli O4 and O26 gene clusters, respectively. In contrast, the putative L -FucNAc transferase WbuB of E. coli O4 and O26 which catalyse the same L -FucNAc-a-(1,3)-D -GlcNAc linkages share a high level of identity. Escherichia coli O4 and O26 have related structures, and have in common the pathway genes, the transferase gene for the common L -FucNAc linkage to D -GlcNAc and also wbuC. Fig. 3 illustrates the distribution of base pair variation between the O4 and O26 gene O-antigen gene clusters at the 5 0 (a) and 3 0 (b) ends, respectively. There are sharp boundaries in the level of divergence at both ends, presumably the sites of more recent recombination events. The pattern for the rml genes in O4 and O26 fits that found in S. enterica [11] with levels of similarity high at the 5 0 end of the rml gene set, compared to the 3 0 end (Fig. 3(a)). This may be due to recombination within the rml genes during lateral transfer of O-antigen gene clusters, with 3 0 end of the rml gene set transferred with the central region that determines O antigen specificity.

Interestingly, the same pattern seen with the rml gene set also occurs in the fnl gene set, with the level of similarity increasing towards the central region (in this case is 3 0 –5 0 ). Recombination is thought to have occurred within the fnlA gene due to a significant decrease in the level of sequence identity within this gene, accounting for the low levels of amino acid identity seen between O4 and O26 (81.6%). The fnlA genes are more divergent than the fnlB and fnlC genes (Fig. 3(b)). Putative UDP-L -FucNAc transferase genes are found to be located downstream and adjacent to fnl genes in other species, for example, in the Pseudomonas aeruginosa O11 gene cluster [22] and the Bacteroides fragilis CPS cluster [23]. This cassette-like region containing the fnl genes and putative UDP-L -FucNAc transferase may facilitate lateral gene transfer of the genes. Genes in the central region are more divergent with only 20% and 23% identity for Wzx and Wzy, respectively. An analysis of the junctions within this region in O4 shows that the nucleotide positions of wzx (4624–5880), wbuG (5877–6779) and wzy (6776–7963) overlap each other, suggesting that this region has been well-established in O4. However, in O26, the nucleotide position of wzx (4893–6155), wzy (6221–7243) and wbuA (7259–8053) do not overlap, suggesting that re-arrangements within this central region may have occurred during the evolution of the O26 gene cluster.

5. Conclusions The E. coli O4 gene cluster was sequenced and found to contain all genes necessary for biosynthesis of its O

32

J.M. DÕSouza et al. / FEMS Microbiology Letters 244 (2005) 27–32

antigen. There was substantial similarity to the O26 gene cluster at both 5 0 and 3 0 ends of the gene cluster, indicating that they are related and have a common origin. OAntigen gene clusters are known to be relatively mobile and it thought that these regions of high similarity may have facilitated recombination within O4 and O26. Knowledge of the O4 and O26 sequences will facilitate studies of this mobility and association with specific forms of pathogenicity. Acknowledgements We thank Bernard Henrissat for assistance with the assignment of GT family names for transferases. References [1] Feng, L., Senchenkova, S.N., Yang, J., Shashkov, A.S., Tao, J., Guo, H., Zhao, G., Knirel, Y.A., Reeves, P.R. and Wang, L. (2004) Structural and genetic characterization of the Shigella boydii type 13 O antigen. J. Bacteriol. 186, 383–392. [2] Shepherd, J.G., Wang, L. and Reeves, P.R. (2000) Comparison of O-antigen gene clusters of Escherichia coli (Shigella) Sonnei and Plesiomonas shigelloides O17: Sonnei gained its current plasmidborne O-antigen genes from P. shigelloides in a recent event. Infect. Immun. 68, 6056–6061. [3] Wang, L. and Reeves, P.R. (2000) The Escherichia coli O111 and Salmonella enterica O35 gene clusters: gene clusters encoding the same colitose-containing O antigen are highly conserved. J. Bacteriol. 182, 5256–5261. [4] Russo, T.A., Sharma, G., Brown, C. and Campagnari, A. (1995) Loss of the O4 antigen moiety from the lipopolysaccharide of an extraintestinal isolate of Escherichia coli has only minor effects on serum sensitivity and virulence in vivo. Infect. Immun. 63, 1263– 1269. [5] Manca, M.C., Weintraub, A. and Widmalm, G. (1996) Structural studies of the Escherichia coli O26 O-antigen polysaccharide. Carbohyd. Res. 281, 155–160. [6] Kogan, G., Haraguchi, G., Hull, S.I., Hull, R.A., Shashkov, A.S., Jann, B. and Jann, K. (1993) Structural analysis of O4-reactive polysaccharides from recombinant Escherichia coli: changes in the O-specific polysaccharide induced by cloning of the rfb genes. Eur. J. Biochem. 214, 259–265. [7] DÕSouza, J.M., Wang, L. and Reeves, P.R. (2002) Sequence of the Escherichia coli O26 antigen gene cluster and identification of O26 specific genes. Gene 297, 123–127. [8] Wang, L. and Reeves, P.R. (1998) Organization of Escherichia coli O157 O antigen gene cluster and identification of its specific genes. Infect. Immun. 66, 3545–3551. [9] Gordon, D., Abajian, C. and Green, P. (1998) CONSED – A graphical tool for sequence finishing. Genome Res. 8, 195–202.

[10] Reeves, P.R. (1994) Biosynthesis and assembly of lipopolysaccharide (Neuberger, A. and van Deenen, L.L.M., Eds.), Bacterial Cell Wall, vol. 27, pp. 281–314. Elsevier, Amsterdam. [11] Li, Q. and Reeves, P.R. (2000) Genetic variation of dTDP-L rhamnose pathway genes in Salmonella enterica. Microbiology 146, 2291–2307. [12] Kneidinger, B., OÕRiordan, K., Li, J., Brisson, J.-R., Lee, J. and Lam, J.S. (2003) Three highly conserved proteins catalyze the conversion of UDP-N-acetyl-D -glucosamine to precursors for the biosynthesis of O antigen in Pseudomonas aeruginosa O111 and capsule in Staphylococcus aureus type 5 – implications for the UDP-N-acetyl-L -fucosamine biosynthetic pathway. J. Biol. Chem. 278, 3615–3627. [13] Lukomski, S., Hull, R.A. and Hull, A.I. (1996) Identification of the O antigen polymerase (rfc) gene inEscherichia coli O4 by insertional mutagenesis using a nonpolar chloramphenicol resistance cassette. J. Bacteriol. 178, 240–247. [14] Krogh, A., Larsson, B., von Heijne, G. and Sonnhammer, E.L.L. (2001) Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 305, 567–580. [15] Marolda, C.L., Vicarioli, J. and Valvano, M.A. (2004) Wzx proteins involved in biosynthesis of O antigen function in association with the first sugar of the O-specific lipopolysaccharide subunit. Microbiology 150, 4095–4105. [16] Alexander, D.C. and Valvano, M.A. (1994) Role of the rfe gene in the biosynthesis of the Escherichia coli O7-specific lipopolysaccharide and other O-specific polysaccharides containing N-acetylglucosamine. J. Bacteriol. 176, 7079–7084. [17] Coutinho, P.M., Deleuiry, E., Davies, G.J. and Henrissat, B. (2003) An evolving hierarchical family classification for glycosyltransferases. J. Mol. Biol. 328, 307–317. [18] Stevenson, G., Neal, B., Liu, D., Hobbs, M., Packer, N.H., Batley, M., Redmond, J.W., Lindquist, L. and Reeves, P.R. (1994) Structure of the O-antigen of E. coli K-12 and the sequence of its rfb gene cluster. J. Bacteriol. 176, 4144–4156. [19] Haraguchi, G.E., Hull, R.A., Krallmann-Wenzel, U. and Hull, S.I. (1989) Molecular cloning and expression of the O4 polysaccharide gene cluster from Escherichia coli. Microb. Pathogen. 6, 123–132. [20] Haraguchi, G.E., Zahringer, U., Jann, B., Jann, K., Hull, R.A. and Hull, S.I. (1991) Genetic characterisation of the O4 polysaccharide gene cluster from Escherichia coli. Microb. Pathogen. 10, 351–361. [21] Landersjo, C., Weintraub, A. and Widmalm, G. (2001) Structural analysis of the O-antigen polysaccharide from the Shiga toxin producing Escherichia coli O172. Eur. J. Biochem. 268, 2239– 2245. [22] Dean, C.R., Franklund, C.V., Retief, J.D., Coyne Jr., M.J., Hatano, K., Evans, D.J., Pier, G.B. and Goldberg, J.B. (1999) Characterization of the serotype O11 O-antigen locus of Pseudomonas aeruginosa PA103. J. Bacteriol. 181, 4275–4284. [23] Comstock, L.E., Coyne, M.J., Tzianbos, A.O. and Kasper, D.L. (1999) Interstrain variation of the polysaccharide B biosynthesis locus of Bacteroides fragilis: charaterization of the region from strain 638R. J. Bacteriol. 181, 6192–6196.