Exchange of Regions between Bacterial Poly(A) Polymerase and the CCA-Adding Enzyme Generates Altered Specificities

Molecular Cell, Vol. 15, 389–398, August 13, 2004, Copyright 2004 by Cell Press

Exchange of Regions between Bacterial Poly(A) Polymerase and the CCA-Adding Enzyme Generates Altered Specificities Heike Betat,1,3 Christiane Rammelt,1,3 Georges Martin,2 and Mario Mo¨rl1,* 1 Max-Planck-Institute for Evolutionary Anthropology Deutscher Platz 6 D-04103 Leipzig Germany 2 Department of Cell Biology Biozentrum University of Basel Klingelbergstrasse 70 CH-4056 Basel Switzerland

Summary Bacterial poly(A) polymerases (PAP) and tRNA nucleotidyltransferases are highly similar in sequence but display different activities: whereas tRNA nucleotidyltransferase catalyzes the addition of CCA to 3ⴕ ends of tRNAs, PAP adds poly(A) tails to a variety of transcripts. Using domain substitution experiments, we show that these enzymes follow a modular concept: exchange of N- and C-terminal regions leads to chimeric enzymes with unexpected activities, indicating that tRNA nucleotidyltransferase carries an “anchor domain” in the C-terminal section that restricts polymerization to three nucleotides. A 27 amino acid region was identified that determines whether poly(A) or CCA is synthesized by the enzyme chimeras. Sequence alignments suggest that the catalytic cores of both enzymes carry identical components involved in nucleotide recognition and incorporation. This seems to be the prerequisite for the observed reprogramming of the catalytic center of PAP to incorporate a sequence of defined length and composition instead of long stretches of A residues. Introduction The striking sequence similarity between bacterial poly(A) polymerases (PAP) and tRNA nucleotidyltransferases (CCA-adding enzymes) is a biological mystery. Based on a conserved 25 kDa N-terminal catalytic domain, both proteins are members of the class II polymerase ␤ superfamily of nucleotidyltransferases (Martin and Keller, 1996; Yue et al., 1996). At present, it is not possible to distinguish between the two proteins based on their primary structure; instead, their identity can only be determined by their type of activity, which differs substantially (Raynal et al., 1998; Sohlberg et al., 2003). Poly(A) polymerases add stretches of A residues to almost every RNA without length restriction, and the CCAadding enzymes incorporate a single CCA triplet to the 3⬘ end of tRNA precursors (Wahle, 1995; Sarkar, 1997; Schu¨rer et al., 2001). *Correspondence: [email protected] 3 These authors contributed equally to this work.

Besides the active site signature located in the N-terminal parts of both proteins (Martin and Keller, 1996; Yue et al., 1996), a region in the C terminus of the poly(A) polymerase was shown to be responsible for RNA binding (Raynal and Carpousis, 1999). Because of the modular organization and the high sequence similarity, it has been speculated that PAP and the CCA-adding enzyme not only have a common ancestor, but may even have interconverted during evolution (Yue et al., 1996). Therefore, it is conceivable that these proteins are composed of individual modules that function in both CCA-adding enzyme as well as PAP contexts and define their characteristic enzymatic features. Such functional modules can be identified by exchanging defined regions of the proteins of interest and by studying the properties of the resulting chimeras. Due to the similar sequence composition of the CCAadding enzyme and PAP, these new proteins are likely to fold up properly and, as a consequence, retain properties of the enzymatic superfamily as it was shown for other types of enzymes (Hopfner et al., 1998). Here, reciprocal recombination of regions of the CCA-adding enzyme and poly(A) polymerase from E. coli was used to generate new enzymes, which displayed mixed activities. Furthermore, the data presented support the hypothesis of interconversion of these enzymes during evolution and show that, depending on a short internal region, the N-terminal active site and nucleotide binding pocket of PAP can be reprogrammed to catalyze CCA addition instead of the synthesis of poly(A). Results Replacement of the C Terminus of the CCA-Adding Enzyme by the Corresponding Part of Poly(A) Polymerase Generates a Poly(CCA) Polymerase The catalytic domains, including the nucleotide binding site of CCA-adding enzymes and poly(A) polymerases, are located in the N-terminal region of these enzymes and contain the highly conserved active site signature of this class of nucleotidyltransferases (Figure 1). However, it is not known which parts of the proteins are responsible for individual features such as substrate specificity (tRNA or any RNA), nucleotide specificity (ATP/CTP or ATP), and the number of incorporated nucleotides (3 or more than 50 nucleotides). We therefore attempted to identify protein sequences that determine the specificity of these enzymes by domain shuffling. The C-terminal region of the E. coli CCA-adding enzyme (amino acids 219–412) was replaced by the corresponding region of the E. coli PAP (residues 295–472, Figure 2A). The chimeric DNA sequence was constructed by overlapping PCR and combining DNA fragments encoding the N- and C-terminal parts of both enzymes. The resulting PCR product was expressed as a chimeric protein, CCA/PAP 1, (consisting of amino acids 1–218 of the CCA-adding enzyme and amino acids 295–472 of PAP) and was tested for activity with radioactively labeled substrates for CCA-adding enzymes (tRNA with-

Molecular Cell 390

Figure 1. Schematic Representation of the Parental Enzymes E. coli poly(A) Polymerase and CCA-Adding Enzyme Poly(A) polymerase is shown in blue, and the CCA-adding enzyme is shown in green. Swap positions for chimeras CCA/PAP 1 and PAP/ CCA 1 are indicated. The displayed N-terminal regions (residues 1–294 and 1–218, respectively) carry the active site signature of nucleotidyltransferases (presented in red boxes).

out CCA terminus) and PAP (oligo(A)12) in the presence of all four nucleotides (Figure 2B). The reaction products were separated on a denaturing 10% polyacrylamide gel and were visualized by autoradiography. After isolation, 3⬘ ends of the products were ligated to an RNA/ DNA oligonucleotide, amplified by RT/PCR, and cloned, and 34 individual clones were sequenced. Parental enzymes were used as positive controls, and a recombinantly expressed ␤-galactosidase served as negative control. Whereas both the CCA-adding enzyme and PAP showed the expected activities and comparable amounts of the negative control did not lead to nucleotide incorporation, the chimeric CCA/PAP 1 protein displayed new and surprising features: like the CCA-adding enzyme, it was specific for tRNA as substrate, but did not accept the PAP substrate oligo(A)12. However, in contrast to the parental CCA-adding enzyme, the chimera added multiple nucleotide triplets (Figure 2B; left panel; products 1, 2, and 3). Sequencing revealed that C and A residues were incorporated in the correct sequential order in these products: 13 of 13 clones of product 1 showed that either CCA or CCCA was added to the 3⬘ end of the tRNA (Figure 2B; CCA*). The appearance of the CCCA reaction product is in accordance with in vitro activity of the parental CCA-adding enzyme of E. coli that has been observed earlier (Hou, 2000): depending on the RNA substrate, the enzyme can incorporate three instead of two C residues at the 3⬘ terminus. This is most likely a result of the nucleotide concentrations in the assays and may not occur in the cell with a higher ATP than CTP concentration. For product 2, 13 individual clones were analyzed. Ten carried a second CCA terminus, and two parts of it (C–), while one showed misincorporation of CCC. Similarly, product 3 showed the addition of a third CCA triplet in seven of eight clones (one showed a misincorporation of CATT). Therefore, the chimeric enzyme is not restricted to the incorporation of a single CCA terminus, but it shows multiple rounds of CCA addition, comparable to multiple additions of A residues by PAP. In a second chimera (Figure 2A), the swap position was shifted toward the N terminus, resulting in a CCA/PAP 2 enzyme with a shorter N-terminal part of the CCA-adding enzyme (positions 1–198) and a larger proportion of the PAP C terminus (positions 275–472). This chimera carried the complete RNA binding domain (position 275–331) of E. coli PAP (Raynal and Carpousis, 1999). CCA/PAP 2 had the same enzymatic properties as the CCA/PAP 1 chimera and catalyzed multiple rounds of CCA addition exclusively to tRNA 3⬘ ends and did not display any poly(A) polymerase activity (results not shown).

The Reciprocal Chimera PAP/CCA 1 Incorporates CCA Since results with the chimeras CCA/PAP 1 and CCA/ PAP 2 indicate a modular organization of these enzymes, this concept was further investigated by the construction of the reciprocal chimera PAP/CCA 1, comprising the N-terminal part of PAP (positions 1–294) and a C-terminal portion of the CCA-adding enzyme (positions 219–412; Figure 3A). The recombinant enzyme was tested for activity with the same substrates as the CCA/ PAP chimeras in the presence of all four nucleotides (tRNA without the CCA terminus and oligo(A)12). As shown in Figure 3A (lower panel), PAP/CCA 1 accepted exclusively the tRNA substrate and showed no activity on oligo(A)12. Furthermore, it catalyzed the incorporation of a limited number of nucleotides into tRNA, similar to the parental CCA-adding enzyme. Besides the side reaction product that was identified by sequencing and showing CCCA addition (already observed for the CCAadding enzyme), this chimera catalyzed a bona-fide CCA synthesis (reaction products are indicated as CCA* in Figure 3A): sequence analysis of 29 individual clones showed that PAP/CCA 1 synthesized complete (5 clones with CCA) or partial CCA ends (13 clones with CC–, 11 clones with C-). Thus, the enzyme did not incorporate three A residues (as one might expect from its N-terminal PAP-derived catalytic domain) and therefore did not display an activity complementary to the first chimeras, but it did have features of a true CCA-adding enzyme. A Region of 27 Amino Acids Determines the Catalytic Specificity Since the PAP/CCA 1 chimera showed CCA-adding activity, the C-terminal CCA half, and not the N-terminal catalytic region, of PAP must determine the catalytic properties of this chimeric enzyme. To identify segments in the C-terminal portion of PAP responsible for specificity, the fusion position between the PAP and CCA regions was shifted toward the C terminus. The resulting chimera, PAP/CCA 2, carried an extended PAP N terminus (positions 1–321) and a shortened CCA C terminus (positions 245–412). Therefore, the PAP region of PAP/ CCA 2 was 27 amino acids longer than that of PAP/CCA 1, and the CCA segment was reduced correspondingly (Figure 3B). The activity of the resulting protein was tested in the presence of either all four NTPs (Figure 3B) or CTP or ATP alone (not shown), and the reaction products were analyzed by sequencing. Interestingly, the addition of the 27 amino acid PAP region changed the activity of the chimera completely: instead of adding the CCA triplet to a tRNA substrate as with PAP/CCA 1, the PAP/CCA 2

Exchange of Regions in Nucleotidyltransferases 391

Figure 2. Enzyme Chimeras CCA/PAP 1 and CCA/PAP 2 (A) Proteins are represented as bars, with elements of the catalytic domain in red. The N-terminal part of the CCA-adding enzyme is indicated in green, and the C-terminal PAP region is indicated in blue. The putative RNA binding domain (RBD) of PAP is labeled in brown. While CCA/PAP 1 carries only parts of the RBD region, the complete domain is present in CCA/PAP 2. (B) Activity test of CCA/PAP 1 and parental enzymes with tRNA lacking a CCA terminus (left panel) and with oligo(A)12 (right panel). Analysis by polyacrylamide gel electrophoresis revealed that CCA/PAP 1 adds multiple rounds of CCA exclusively on the tRNA substrate (products 1, 2, and 3), while parental enzymes show typical activities (CCA*: band representing CCA addition and CCCA incorporation, which is a known in vitro side product of the E. coli CCA-adding enzyme). CCA/ PAP 2 showed identical activity (not shown).

chimera accepted ATP exclusively and incorporated long stretches of A residues into the tRNA as well as into the oligo(A)12 substrate like the parental poly(A) polymerase (Figure 3B; 17 of 18 sequenced clones showed exclusively A incorporations). Therefore, the additional 27 amino acids in the N-terminal region of the chimeric enzyme converted the CCA activity of PAP/CCA 1 into PAP activity. The C-Terminal Motifs Are Not Required for Polymerization Activity To test the importance of the C termini for the catalytic activities of the chimeric enzymes, truncated variants of the parental enzymes were analyzed (Figure 4). A truncated CCA-adding enzyme consisting of amino acids 1–264 showed full activity of CCA addition; however, a slightly shorter version (positions 1–218, representing the N-terminal part of the CCA-adding enzyme in the chimera CCA/PAP 1) was inactive under the stan-

dard incubation conditions and showed reduced binding of tRNA (Table 1). Accordingly, a faint reaction product was only observed at a more than 25 times higher concentration of tRNA primer. Comparable results were obtained in earlier reports for the E. coli poly(A) polymerase (Raynal and Carpousis, 1999): a C-terminally truncated form of the enzyme (PAP ⌬ 5, positions 1–274) showed no activity, while a slightly longer form (PAP ⌬ 3, positions 1–331) had full poly(A)-adding activity. Similarly, PAP ⌬ 5 showed no RNA binding, whereas PAP ⌬ 3 could bind to RNA (these two mutants are indicated by asterisks in Figure 4 (Raynal and Carpousis, 1999). We then investigated whether the observed loss of activity in the truncated variants of the CCA-adding enzyme represented the requirement of specific sequences in the C-terminal parts of the protein or whether any nonrelated protein sequence could rescue the activity. The C-terminal part of CCA/PAP 1 was replaced by thio-

Figure 3. Enzyme Chimeras PAP/CCA 1 and PAP/CCA 2 The color code in the upper panel is identical to that in Figure 2. In PAP/CCA 2, the fusion position is shifted toward the C terminus, thereby elongating the PAP region by 27 amino acids. The lower part shows gel electrophoresis of resulting reaction products. (A) PAP/CCA 1 catalyzes the addition of CCA to a tRNA substrate and therefore acts as a true CCA-adding enzyme. CCA*: mixture of CCA and CCCA addition (a side product also observed in the parental CCA-adding enzyme of E. coli). The nature of the incorporated bases was analyzed by sequencing. Right panel: while PAP is active on oligo(A)12, PAP/ CCA 1 does not accept this substrate. (B) In contrast to PAP/CCA 1, PAP/CCA 2 exclusively incorporates ATP (verified by sequencing of reaction products) and accepts tRNA as well as oligo(A)12 as substrates. Thus, it represents typical PAP activity.

Molecular Cell 392

Figure 4. Summary of All Constructs and Chimeric Enzymes The asterisks indicate the truncated PAP versions (amino acids 1–274 and 1–331) described by Raynal and Carpousis (Raynal and Carpousis, 1999). Enzymatic activity of individual enzyme versions is indicated on the right. The color code is the same as in Figure 2 (black representing the thioredoxin tag). While CCA N termini display exclusively CCA-adding activity, the activity of the corresponding part of PAP is context dependent and can be modified by the shift of the fusion position. Red dashed boxes indicate the 27 amino acid region that probably carries the anchor element in the CCA-adding enzyme and dictates the specificity of the catalytic core of poly(A) polymerase.

redoxin (Trx), a protein that confers folding stability and increased solubility to recombinant proteins (CCA/Trx, Figure 4; Terpe, 2003). However, this C-terminal replacement did not result in any enzymatic activity of the CCA/ thioredoxin chimera (results not shown). Taken together, these data indicate that only short segments of the C-terminal regions in the CCA-adding enzyme (amino acids 219–264) and PAP (amino acids 295–331) are dictating the substrate specificity of these enzymes. They also show that our results are not caused by an artificial activity based on the presence of an arbitrary peptide sequence at the C terminus of the chimera (Figure 4). Kinetic Properties of Chimeras For all active enzyme chimeras as well as the parental enzymes, KM values for ATP and CTP were determined with tRNA or oligo(A)15 as a substrate. Although these values can vary within a considerable range, depending on the enzyme source and the purification procedures (Yue et al., 1996), the observed KM values show that all enzymes have high affinities for ATP and/or CTP (Table 1). Taken together, all measured KM values of the chimeras are within the same range as those measured for other nucleotidyltransferases, whereas the apparent kcat

values show a moderate reduction of the catalytic rate to 10%–30% of that of the parental enzymes (Deutscher, 1982; Yue et al., 1996; Reichert et al., 2001). Similarly, RNA primer affinities of the chimeras are comparable to the affinities of the parental enzymes, as indicated by the corresponding KM values (Table 1): here, the KM values measured depended on the origin of the C terminus, with the C-terminal part of PAP having a higher affinity for RNA than the CCA-adding enzymes’ C terminus. In contrast, the enzyme deletion variant CCA ⌬ 2, which corresponds to the 218 amino acid CCA N terminus in the CCA/PAP 1 chimera, showed almost no activity. A reason for that is a reduced tRNA binding capacity of this protein (increased KM for tRNA) and a reduction in substrate turnover, since the apparent kcat value for CTP was two orders of magnitude lower (Table 1). Together with the findings of Raynal and Carpousis (1999), these results indicate that the C termini of both PAP and CCA enzyme are involved in the RNA primer interaction and can therefore affect catalysis when modified or removed. Our kinetic analysis demonstrates that the observed activities of the chimeras represent true nucleotidyltransferase reactions and not in vitro artifacts caused by misfolding of the fusion proteins.

Exchange of Regions in Nucleotidyltransferases 393

Table 1. Kinetic Analysis of Enzyme Chimeras Enzyme

Product

KM (ATP, mM)

Parental CCA Parental PAP CCA ⌬ 2 PAP ⌬ 3c PAP ⌬ 5c CCA/PAP PAP/CCA 1 PAP/CCA 2

CCA poly(A) (⫹)/⫺b poly(A)c ⫺c poly(CCA) CCA poly(A)

0.81 0.13 ND NDc ⫺c 0.04 0.79 0.33

⫾ 0.31 ⫾ 0.08

⫾ 0.03 ⫾ 0.66 ⫾ 0.06

KM (CTP, mM) 0.23 0.27 0.24 NDc ⫺c 0.11 0.13 0.36

⫾ 0.003 ⫾ 0.03 ⫾ 0.05

⫾ 0.02 ⫾ 0.02 ⫾ 0.19

kcat (CTP, s⫺1)

KM (primer, ␮M)

0.212 ⫾ 0.013 0.430 ⫾ 0.152 0.004 ⫾ 0.001 NDc ⫺c 0.063 ⫾ 0.043 0.023 ⫾ 0.003 0.027 ⫾ 0.009

28.65 ⫾ 1.64 (tRNA)a 0.39 ⫾ 0.10 (A15), 3.70 ⫾ 0.31 (tRNA)a 70.93 ⫾ 4.27 (tRNA)a ⫹c ⫺c 0.94 ⫾ 0.46 (tRNA)a 8.18 ⫾ 0.83 (tRNA)a 4.14 ⫾ 1.30 (A15)

Kinetic parameters were determined as indicated in the Experimental Procedures. Each measurement represents the result of at least three independent experiments. kcat values are apparent values because tRNA was not used at saturating amounts when NTPs were titrated. ⫹, binding to RNA was demonstrated; ⫺, inactive; ND, not determined. a Determined for CTP incorporation. b Minimal activity at more than 25-fold tRNA primer concentration (relative to tRNA concentration used in standard assays, see the Experimental Procedures). c Raynal and Carpousis, 1999.

Discussion The high similarity of the bacterial poly(A) polymerase and the CCA-adding enzyme is based on a highly conserved N-terminal region lacking specific sequence signatures that would differentiate between the two enzymes (Figure 1). However, motifs predicted to be PAP or CCA adding enzyme specific have recently been described (Martin and Keller, 2004). In fact, it has been speculated that both types of enzymes might have interconverted at least once during evolution (Yue et al., 1996). Such a scenario is further supported by a phylogenetic analysis that could not resolve the evolution of eubacterial PAP and CCA-adding enzymes from a single common ancestor (Arndt von Haeseler, personal communication). Obviously, these enzyme siblings evolved by the exchange of individual domains that function in the contexts of both PAP and CCA-adding enzymes. We therefore investigated whether such exchanges are still possible with contemporary enzymes and whether the isolated N-terminal region carrying the active site signature is sufficient for specific catalysis. To exclude artificial results due to inappropriate reaction conditions, all chimeric enzymes and deletions were tested under incubation conditions optimized for both parental enzymes (CCA buffer and PAP buffer), where they showed no aberration in reactions (PAP was much more active in PAP buffer and incorporated more than 100 A residues, while CCA enzyme showed a decrease in activity under these conditions; data not shown). Furthermore, identical activities of the enzyme were observed at very high RNA (10- to 40-fold) or enzyme concentrations (5- to 10-fold; data not shown). These findings indicate that the activities of the chimeric enzymes do not represent artifacts, but are genuine features of the proteins. Considerable parts of the C-terminal regions of both enzymes could be deleted without loss of activity (CCAadding enzyme: deletion of 148 amino acids; PAP: deletion of 141 amino acids [Raynal and Carpousis, 1999]), while truncations of an additional 45 or 57 amino acids, respectively, abolished the polymerization activity of both enzymes (Figure 4). This indicates that protein regions downstream of positions 218 (CCA- adding enzyme; this site corresponds to the swap position in CCA/ PAP 1) or 274 (PAP) are of vital importance for enzymatic activity. As a control, we tested the effect of replacing

the C terminus of the CCA-adding enzyme by thioredoxin (Trx), which, as a fusion protein, is used to keep recombinant proteins soluble (Terpe, 2003). This chimeric protein was inactive under all assay conditions, demonstrating that an unrelated protein cannot restore the function of the C terminus. We conclude that specific C-terminal sections are required to obtain a functional PAP or the CCA-adding enzyme. The catalytic domain in these two nucleotidyltransferases is located in the N-terminal region, and the C-terminal part is involved in RNA binding. Thus, although the N terminus of the CCA/ Trx chimera might be folded correctly, the protein can probably not bind to its substrate because of the lack of a functional RNA binding domain and is therefore inactive. A Poly(CCA) Polymerase Replacing the C-terminal part of the CCA-adding enzyme by the corresponding section of PAP restored the enzymatic activity in the chimera CCA/PAP 1. In the cartoon shown in Figure 5, the 3D structure of the CCAadding enzyme of B. stearothermophilus (Li et al., 2002) is used to illustrate the regions that were exchanged. Surprisingly, CCA/PAP 1 displays mixed activities of both parental enzymes: like a CCA-adding enzyme, it exclusively recognizes tRNA molecules and adds the triplet CCA to the 3⬘ end. However, it shows multiple rounds of CCA addition, comparable to multiple additions of A residues by PAP (Figure 5, left). The same is true for the second chimera, CCA/PAP 2, which carries the complete postulated RNA binding domain of PAP (Raynal and Carpousis, 1999). Interestingly, this RNA recognition site does not redirect the enzyme to use oligo(A)12 as substrate, but the chimera is still specific for tRNA binding. Therefore, although this binding site may mediate nonspecific affinity for RNA, it does not promote activity in the presence of oligo(A)12. In addition, the observed tRNA specificity of the CCA/PAP chimeras indicates that the N-terminal part of the CCA-adding enzyme still carries a tRNA-specific binding site. Although these results show that the C-terminal half of the CCA-adding enzyme can be replaced by the corresponding section in PAP to generate an active enzyme, the poly(CCA) activity of the chimeras indicates that the C-terminal regions of the parental enzymes have different functions. Obviously, the CCA/PAP chimeras

Molecular Cell 394

Figure 5. Cartoon to Illustrate the Concept of the Exchange of Modules between PAP and the CCA-Adding Enzyme, which Confers New Activities Replaced regions of the E. coli enzymes were superimposed on the crystal structure of the B. stearothermophilus CCA-adding enzyme (Li et al., 2002). Swap positions (CCA/PAP 1: CCA1–218/PAP295–472; CCA/PAP 2: CCA1–198/PAP275–472; PAP/CCA 1: PAP1–294/CCA219–412; PAP/CCA 2: PAP1–321/ CCA245–412) as well as deletion sites (CCA ⌬1: CCA1–264, active [⫹]; CCA ⌬2: CCA1–218, inactive [⫺]) are indicated. The C-terminal region of the CCAadding enzyme (green) carries an unidentified anchor domain that restricts polymerization to the incorporation of three nucleotides. Replacement of the C terminus, including the anchor region, by the corresponding PAP region (blue) removes this restrictive domain and leads to a poly(CCA) polymerase activity (left). In the reciprocal exchange experiment, the resulting activity depends on the position of the fusion site (right): if helix M and the surrounding loop structures (red) are derived from the CCA-adding enzyme, the chimera acts as a true CCA-adding enzyme. If the helix M region is derived from PAP, the chimera displays PAP activity. Upper panel: secondary structure prediction of the original 27 amino acid regions of E. coli PAP and the CCA-adding enzyme. Both sequences are likely to fold into a helical domain similar to the structure of the B. stearothermophilus enzyme.

have lost the ability to discriminate between a tRNA precursor that has no CCA end and a mature tRNA; thus, whenever the PAP C terminus encounters a tRNA, the N-terminal catalytic core of the CCA-adding enzyme incorporates CCA (Li et al., 2002). This is supported by experiments with mature tRNA carrying a CCA end, which is readily accepted as a substrate by the CCA/ PAP chimeras and extended by further rounds of CCA additions (not shown), suggesting that regions with a CCA-sensing function must be located in the C-terminal half of CCA-adding enzymes. Furthermore, it seems that the C-terminal substrate binding site of the parental CCA-adding enzyme prevents movement of the tRNA (or its 3⬘ end) relative to the enzyme, acting as an “anchor” on the substrate and thereby preventing the addition of multiple CCA triplets. This is in agreement with experiments on an archaeal CCA-adding enzyme, where polymerization without translocation has been demonstrated (Shi et al., 1998): the tRNA substrate stays in a fixed position on the enzyme until all three nucleotides are added.

Reprogramming of the Catalytic Core of Poly(A) Polymerase Further support for a modular organization of nucleotidyltransferases comes from the reciprocal chimeras consisting of the N terminus of PAP and the C terminus of the CCA-adding enzyme (Figure 5, right). Whereas the CCA/PAP chimeras show features of both PAP and the CCA-adding enzyme, the reciprocal chimeras PAP/ CCA 1 and PAP/CCA 2 act as true CCA-adding enzymes or poly(A) polymerases, depending on the position of the swap site. The fact that the PAP/CCA 1 chimera incorporates a limited number of nucleotides confirms an anchor function for the C terminus of the CCA-adding enzyme. In contrast, both the RNA primer and the nucleotide specificity of the PAP/CCA 1 chimera were rather unexpected: although it carries the catalytic site and the nucleotide binding pocket of poly(A) polymerase, this fusion enzyme adds a CCA triplet exclusively to tRNA 3⬘ ends in a high-fidelity mode (no misincorporations were observed: in the sequence analysis, all 29 clones showed a complete or partial addition of CCA) and there-

Exchange of Regions in Nucleotidyltransferases 395

Figure 6. Nucleotide Binding Regions of Poly(A) Polymerase, in E. coli, and the CCA-Adding Enzyme, in E. coli and B. stearothermophilus (A) Alignment of the active site and nucleotide binding region of investigated enzymes (EcoCCA and EcoPAP). As a reference, the sequence of the B. stearothermophilus CCA-adding enzyme (BstCCA) is shown. Gray boxes indicate conserved amino acids, and residues involved in nucleotide recognition are indicated in red. Poly(A) polymerase carries template amino acids identical to the CCA-adding enzymes. P: interaction with the triphosphate moiety, 2⬘OH: interaction with the 2⬘-hydroxyl group of the ribose; A, C: interaction with bases adenine and/or cytosine according to Li and coworkers (Li et al., 2002). (B) Possible hydrogen bonds between template amino acids and base moieties (after Cho et al., 2003). Both CCA-adding enzymes and the poly(A) polymerase can form the same hydrogen bonds with the incoming ATP and CTP. 4-NH2 of CTP and 6-NH2 of ATP function thereby as H-donors and interact with a conserved aspartic acid side chain of the enzymes (D212, D131, D154). 3-N of CTP and 1-N of ATP act as H-acceptors for an invariant arginine residue (R215, R134, R157). In addition, the arginine residue can form another H-bond with the 2-O group of the cytidine. These highly conserved amino acid residues might explain the observed promiscuity of the catalytic domain of the poly(A) polymerase.

fore represents a genuine CCA-adding enzyme. Obviously, an “effector” region in the C-terminal part of the CCA-adding enzyme is responsible for this activity and determines the primer and nucleotide specificity of the PAP/CCA 1 fusion protein. In this construct, the catalytic pocket of PAP accepts not only ATP, but also CTP and, most surprisingly, can synthesize the sequence CCA with high accuracy. A possible explanation for this comes from a sequence alignment of the conserved N-terminal regions of both parental enzymes and the CCA-adding enzyme of B. stearothermophilus (Figure 6A): all three nucleotidyltransferases carry an identical set of conserved amino acids in this region. Surprisingly, the amino acids recognizing ATP and CTP in the Bacillus CCA-adding enzyme are also conserved in the catalytic core of PAP. The analysis of co-crystals of the Bacillus enzyme with ATP or CTP revealed that some of these amino acids act as a protein-based template and form hydrogen bonds with the incoming bases (Li et al., 2002): an arginine residue at position 157 (R157) interacts with 1-N of ATP and is stabilized by an H-bond with glutamic acid 153 (E153). In addition, aspartic acid 154 (D154) forms a hydrogen bond with the 6-NH2 of the base. These residues are found not only in the E. coli CCA-adding enzyme (corresponding positions: R134, E130, and D131), but also in PAP (R215, E211, D212; see Figure

6B). The same amino acids are involved in the interaction with CTP: two hydrogen bonds form between 3-N and 2-O of the base and R157 of the enzyme, and one hydrogen bond forms between 4-NH2 and D154. The importance of aspartic acid 212 in PAP (which corresponds to D154 in the Bacillus CCA-adding enzyme) for nucleotide incorporation was demonstrated by Raynal and Carpousis, who found that changing this residue leads to a dramatic loss in enzyme activity (Raynal and Carpousis, 1999). Apparently, the catalytic core of PAP carries the same amino acid template that is present in the CCA-adding enzymes and that, due to an identical arrangement of H-donor and -acceptor groups in ATP and CTP, binds specifically to both nucleotides (Figure 6; Cho et al., 2003). Further support for a CTP binding region in PAP comes from the observation that the KM values for CTP are identical in both parental enzymes (Table 1). However, the incorporation efficiency for CTP was determined to be less than 5% compared to ATP, indicating that the enzyme can discriminate between CTP and ATP to a certain degree (Sippel, 1973; Cao and Sarkar, 1997; Yehudai-Resheff and Schuster, 2000). Furthermore, it is not yet understood how PAP discriminates in the bacterial cell between individual NTPs (Yehudai-Resheff and Schuster, 2000). A possible explanation might be that ATP is much more abundant than

Molecular Cell 396

the other three NTPs in the cell, leading to a higher availability as a substrate for PAP (ATP: 42.4%, CTP: 9%, GTP: 17.2%, UTP: 31.4%; Roland Wagner, personal communication). In addition, the higher ATP concentration in the cell is compensated for by the CCA enzyme by a higher KM for ATP than for CTP (Table 1) to give both ATP and CTP an about equal chance in catalysis, whereas PAP with a lower KM for ATP than for CTP preferentially binds ATP. Helix M Dictates Specificity While PAP/CCA 1 turned out to be a bona fide CCAadding enzyme, a second chimera, PAP/CCA 2, where the fusion position was shifted 27 amino acids toward the C terminus, displayed a dramatic change in activity: this fusion enzyme synthesized poly(A) tails on both tRNA and oligo(A)12. Evidently, the 27 amino acids from poly(A) polymerase are responsible for this shift in enzymatic activity. According to a BLAST search analysis, the respective 27-residue regions show very little homology between bacterial PAP or CCA-adding enzymes (not shown). In the structure of the B. stearothermophilus CCA-adding enzyme (Figure 5), this section consists of a loop region and an ␣-helical domain (helix M according to Li et al., 2002). By applying computer algorithms (PSIPRED, http://bioinf.cs.ucl.ac.uk/psipred/ [McGuffin et al., 2000]; 3D-pssm, http://www.sbg.bio.ic.ac.uk/ⵑ3dpssm/ [Kelley et al., 2000]), we could predict an ␣ helix and flanking loop regions for this section in PAP as well as in the CCA-adding enzyme of E. coli (Figure 5, upper right panel). Because we could demonstrate that the presence of this 27-residue region from the CCA-adding enzyme restricts the polymerization to three nucleotides, it is likely that the “anchor” domain is located in helix M and/or the surrounding loop structure. Alternatively, the exchange of the helix M region could trigger a conformational change of other enzyme parts that is important for polymerization and specificity, similar to the rearrangement of the amino acid template discussed for the NTP binding pocket of the B. stearothermophilus CCA-adding enzyme (Li et al., 2002). However, in the absence of structural data on E. coli PAP, it is presently impossible to explain the molecular mechanisms underlying this reprogramming. While we found that the N-terminal part of PAP can be reprogrammed by the C terminus of the CCA-adding enzyme, the CCA N terminus (in CCA/PAP 1 and CCA/ PAP 2) strictly maintains its ability to template for CCA, even if under the influence of a PAP C terminus that includes the helix M region. Obviously, the catalytic cores of both enzymes differ in their enzymatic capacities: whereas the CCA-adding enzyme cannot be reprogrammed to PAP activity, poly(A) polymerase is more flexible in its catalytic specificity. However, it is unclear why the parental PAP enzyme and the PAP/CCA 2 chimera are not able to synthesize CCA like PAP/CCA 1. Li et al. (2002) discuss a structural rearrangement in the catalytic center of the CCA-adding enzyme as a prerequisite for switching the nucleotide specificity between CTP and ATP (Li et al., 2002): a rotation of the side chains of R157 and E153 leads to a change in nucleotide binding. It is possible that such a conformational change in the protein template is induced by re-

gions in the C-terminal part of the CCA-adding enzyme: fusing this part to the N-terminal catalytic core of PAP might lead to the corresponding R157/E153 rearrangement that allows PAP/CCA 1 to recognize and incorporate not only ATP, but now also CTP. Accordingly, such a rearrangement probably does not occur in the parental PAP, whereas in the PAP/CCA 2 chimera, it seems that the reorganization of the catalytic core is impeded by the shifted fusion position between the N- and C-terminal halves. Evolutionary Considerations While the conserved amino acid template (Figure 6) might explain the promiscuity of the PAP core, it is surprising that the CCA-adding enzyme cannot be reprogrammed in a similar way. Apparently, additional unidentified elements in the catalytic site restrict the CCA-adding enzyme to the incorporation of the CCA sequence. A possible explanation for such a restriction is the fact that the error-free addition of the CCA triplet to a tRNA 3⬘ end is of vital importance, since misincorporations lead to a dramatic loss of function of the corresponding tRNA (Reuven and Deutscher, 1993). In contrast, E. coli PAP accepts other NTPs besides ATP as substrates for addition to RNA (Sippel, 1973; Yehudai-Resheff and Schuster, 2000). Obviously, this lower fidelity (compared to the CCA-adding enzyme) is tolerated by the cell, since some mRNAs contain up to 25% guanosines and other nucleotides in their poly(A) tails (Lisitsky et al., 1996). In the light of evolution, the promiscuous activity of PAP can be interpreted in two ways: a poly(A) polymerase-like activity might have been the ancestral state of these enzyme siblings, whereas the CCA-adding enzyme has lost its ability to synthesize poly(A) tails during evolution and gained specificity for CCA addition. On the other hand, we have evidence that an ancient CCAadding enzyme is the ancestor of class II poly(A) polymerases (Martin and Keller, 2004). Therefore, bacterial PAPs may still keep a hidden CCA-adding activity that can be artificially reactivated by domain swap experiments. The same reasoning may apply to the RNA substrate specificity of these enzymes: whereas the N-terminal part of the CCA-adding enzyme exclusively recognizes tRNA-like molecules independently of the nature of the C-terminal region, the PAP counterpart can act on any RNA and becomes specific for tRNAs, depending on the origin of the C-terminal part (in particular helix M and the adjacent loop structure). We conclude that the features of the catalytic N terminus are dominant over the C-terminal elements in the CCA-adding enzyme, whereas the catalytic core is more flexible in PAP and can be reprogrammed in its specificity, due to the presence of an amino acid template identical to that found in CCA-adding enzymes. Although the evolutionary origin of these enzymes is still unknown, our data indicate that both types of proteins are composed of individual modules that can be exchanged and that lead either to mixed activities or to a complete reprogramming of the catalytic center (Raynal and Carpousis, 1999). Further refined sequence exchanges in combination with biochemical analysis as well as additional structural information will shed more light on the fascinating mechanism of polymerization in both CCA-adding enzymes and poly(A) polymerases.

Exchange of Regions in Nucleotidyltransferases 397

Experimental Procedures Construction of Recombinant Clones The gene of the wild-type E. coli CCA-adding enzyme (E. coli Top10, Invitrogen) was amplified by standard PCR. The product was cloned into the pET30-EK/LIC vector according to the supplier (Novagen), resulting in a construct with additional N-terminal His-Tag and S-Tag. The gene for the E. coli PAP (kindly provided by N. Sarkar) was recloned into pET30-EK/LIC with the primers indicated below. Chimeras CCA/PAP 1 (1CCA218/295PAP472), CCA/PAP 2 (1CCA 198/275PAP472), PAP/CCA 1 (1PAP294/219CCA412), and PAP/CCA 2 (1PAP321/245CCA412) were constructed by overlap extension PCR (Horton et al., 1990). Representative for all constructs, the assembly of the CCA/PAP 1 DNA sequence is described: DNA fragments encoding the CCAadding enzyme part (corresponding to amino acids 1–218) and the poly(A) polymerase part (corresponding to amino acids 295–472) were amplified by PCR with primers CCApETLicsense and CCA/ PAP 1p1 or CCA/PAP 1p2 and PAPpETLicantisense, respectively (30 cycles: 1 min, 94⬚C; 1 min, 58⬚C; 5 min, 72⬚C). The resulting CCA fragment overlaps at the 3⬘ terminus for 20 nucleotides with the 5⬘ part of the PAP fragment. The final chimeric CCA/PAP product was generated in an overlap extension PCR reaction, where both fragments were incubated without the addition of primers (4 min, 94⬚C; 10 cycles: 1 min, 94⬚C; 2 min, 40⬚C; 5 min, 72⬚C). Subsequently, primers CCApETLicsense and PAPpETLicantisense were added, and a standard PCR reaction was performed to amplify the final construct (30 cycles: 1 min, 94⬚C; 2 min, 58⬚C; 5 min, 72⬚C). For construction of the other chimeric sequences, an identical strategy (with the appropriate primers) was applied. For construction of the CCA/Trx fusion protein (1CCA218/1Trx109), the sequence encoding the thioredoxin tag was amplified by using the pET32a-vector (nucleotides 366–692; Novagen), followed by overlap extension PCR with the primers indicated below. C-terminal truncation variants of the enzymes were constructed by introduction of a stop codon, TGA, with the QuickChange Sitedirected Mutagenesis Kit (Stratagene). For constructions, the following primers (5⬘-3⬘) were used: CCAp ETLicsense, GACGACGACAAGATCAAGATTTATCTGGTC; CCAp ETLicantisense, GAGGAGAAGCCCGGTTCATTCAGGCTTTGGGCA; PAPpETLicsense, GACGACGACAAGATCACACCGAGGTGTAC; PAP pETLicantisense, GAGGAGAAGCCCGGTTCATGCGGTACCCTCA CGA; CCA/PAP 1p1, ATCCGCTCCATCGGGCTGTCGGCCGGAACG CCAAACAGTG; CCA/PAP 1p2, GACAGCCCGATGGAGCGGAT; CCA/PAP 2p1, GGCTGGAACAGATGATATTCGCGCAGTACCTGGA AGAACA; CCA/PAP 2p2, GAATATCATCTGTTCCAGCCG; PAP/CCA 1p1, GGATGCCACTTGGCAGGGCCATTTTCCGTGAAGTAGC; PAP/ CCA 1p2, CCTGCCAAGTGGCATCCGGAA; PAP/CCA 2p1, GCGAAA CGGACATCGACCTGCGGGTTCACGCGCATATCG; PAP/CCA 2p2, CAGGTCGATGTCCGTT; CCA/Trxp1, CAGGTGAATAATTTTATCGC TCATGGCCGGAACGCCAAAC; CCA/Trxp2, ATGAGCGATAAAATTA TTC; CCA/Trxp3, GAGGAGAAGCCCGGTTCAGGCCAGGTTAGCGT CGAG. Correct assembly of all constructs was confirmed by sequence analysis on an ABI Prism 3700 automated sequencer (Amersham Biosciences).

Protein Expression and Purification The wild-type CCA-adding enzyme, poly(A) polymerase, as well as deletion variants were expressed in E. coli BL21(DE3) (Novagen). For chimeric proteins, expression was performed in E. coli BL21 (DE3) pLysS or Tuner (Novagen). Freshly transformed cells were grown at 28⬚C–37⬚C in 700 ml LB medium containing 30␮g/ml kanamycin and 33 ␮g/ml chloramphenicol. At mid-log phase (A600 ⫽ 0.6), expression was induced by the addition of IPTG to a final concentration of 200 ␮M (1 mM for the wild-type CCA-adding enzyme). After 3–5 hr of incubation at 28⬚–37⬚C, cells were harvested by centrifugation and lysed by lysozyme treatment and sonication in ice-cold buffer I (20 mM Tris/HCl [pH 7.6], 0.5 M NaCl, 5 mM imidazole and 0.75 mg/ml lysozyme). After centrifugation for 30 min at 25,000⫻g and 4⬚C, the proteins in the supernatant were purified by FPLC on a 5 ml HiTrap Chelating Sepharose column (Amersham Biosciences) and eluted with 500 mM imidazole. In the case of chimeric proteins,

the eluate was adjusted to 5 mM DTT in order to prevent aggregation. Fractions containing the enzymes as determined by SDS-PAGE were pooled, dialyzed against buffer II (20 mM Tris/HCl [pH 7.6], 0.5 M NaCl, 5 mM MgCl2 and 10% glycerol) in case of the wild-type CCA-adding enzyme or buffer III (buffer II with 5 mM DTT) in the case of chimeric proteins. All proteins were stored in the presence of 40% (v/v) glycerol at ⫺20⬚C. Preparation of RNA Substrates The tRNA substrate tRNATyr (without the CCA terminus) was prepared as previously described (Schu¨rer et al., 2002). Transcription was carried out with T7 RNA polymerase in the presence of ␣-33PUTP according to the supplier’s instructions (New England Biolabs). An oligonucleotide consisting of a stretch of 12 adenosine residues (oligo(A)12) was purchased from Purimex, and 5⬘-end-labeled with ␥-33P-ATP. Radioactively labeled RNA molecules were purified by denaturing PAA gel electrophoresis. Bands were cut out with a sterile blade, and the RNA was eluted by incubation in 500 mM ammonium acetate (pH 5.7) and 0.1 mM EDTA at 4⬚C overnight and subsequent ethanol precipitation in the presence of glycogen (Peattie, 1979). Enzyme Activity Assays Standard conditions: 4 pmol 5⬘-33P-labeled tRNA substrates or 10 pmol 5⬘-end-labeled (A)12 substrate was incubated with up to 50 ng recombinant enzymes in the presence of all four NTPs (1 mM each) in CCA buffer (30 mM HEPES/KOH [pH 7.6], 6 mM MgCl2, 30 mM KCl, 2 mM DTT) or PAP buffer (10 mM Tris/HCl [pH 7.6], 4 mM MgCl2, 100 mM NaCl, 0.2 mM DTT, 0.2 mM EDTA, 1% glycerol, 0.1% Triton X-100 [Raynal et al., 1996]) in a total volume of 20 ␮l for 30 min at 30⬚C. After ethanol precipitation, products were separated by electrophoresis on a 10% polyacrylamide gel containing 8 M urea and visualized by autoradiography. Kinetic Analysis of Enzyme Chimeras For steady-state kinetic assays, E. coli PAP and chimera PAP/CCA 2 were tested at 37⬚C in 10 ␮l reaction volumes with six data points in a buffer consisting of 20 mM HEPES/KOH (pH 7.9), 0.1 mg/ml BSA, 30 mM KCl, 4 mM MgCl2, and 1 mM DTT. A total of 0.25 ␮Ci ␣-33P-ATP or CTP (3000 Ci/mmol) per reaction was included as a label. ATP and CTP were titrated between 0.04 and 0.6 mM with 50 ␮M oligo(A)15 or 5 ␮M tRNA in the reaction; primer RNAs were titrated between 1 and 5 ␮M in the presence of 0.5 mM CTP or ATP. The reactions were terminated after 15 min by absorption to 2 cm2 DE81 filter papers, washed three times for 20 min in 0.3 M NH4-formate, 10 mM Na-pyrophosphate, and measured in a scintillation counter. Kinetic parameters of three independent experiments were calculated on a Lineweaver/Burk plot. Kinetic analysis of the E. coli CCA-adding enzyme, CCA/PAP 1, and PAP/CCA 1 was carried out at 30⬚C in 10 ␮l standard reaction buffer (30 mM HEPES/KOH [pH 7.6], 6 mM MgCl2, 30 mM KCl, and 2 mM DTT) with 6–10 data points in the presence of 40 ␮Ci ␣-32PCTP or ␣-32P-ATP and 50 pmol in vitro-transcribed tRNA with cold CTP or ATP between 0.001 mM and 1 mM. After an incubation time of 5 min, reactions were stopped by the addition of 5 ␮l gel loading buffer (containing 80% formamide) and separated on a denaturing 10% polyacrylamide gel. Densitometric analysis of reaction products was carried out by using a STORM 860 phosphorimager and ImageQuant software. KM values of 2–6 independent experiments were determined in a nonlinear regression fit by using GraphPad Prism. The obtained kcat values are apparent values because tRNA was not used at saturating amounts when NTPs were titrated. However, KM values are unaffected, since these nucleotidyltransferases display a random sequential mechanism (Williams and Schofield, 1977). Sequence Analysis of Reaction Products 3⬘ ends of RNA molecules were ligated to a DNA oligonucleotide (Purimex) carrying one single RNA nucleotide (UMP) at the phosphorylated 5⬘ end (5⬘-pU-ATACTCATGGTCATAGCTGTT-3⬘). Ligation was performed in the presence of 50 mM Tris/HCl (pH 8.0), 10 mM MgCl2, 1 mM hexamine cobalt chloride, 12.5% PEG 6000, 0.2

Molecular Cell 398

mg/ml BSA, and 10 U T4 RNA ligase (New England Biolabs) for 16 hr at 16⬚C. Reverse transcription was carried out by MMLV-Reverse Transcriptase (New England Biolabs) with a primer complementary to the ligated oligonucleotide (L123, 5⬘-AACAGCTATGACCATG-3⬘) according to the supplier’s protocol. Amplification of the cDNA was performed in a standard PCR assay by using L123 and a primer representing the 5⬘ part of tRNATyr (5⬘-GGTAAAATGGCTGAG-3⬘). The PCR products were cloned into the pCR威2.1-Topo威 vector according to the manufacturer’s instructions (Invitrogen) and sequenced. Phylogenetic Analysis The highly conserved 25 kDa amino acid regions of several eubacterial CCA-adding enzymes and poly(A) polymerases were aligned by Multalign (Corpet, 1988). Construction of a phylogenetic neighborjoining tree was based on a distance matrix with 10,000 bootstrap iterations (Saitou and Nei, 1987). Acknowledgments We would like to thank Amy Roeder, Kathrin Ko¨hler, Andrea Just, and Anett Beyermann for excellent technical assistance and Martin Augustin, Walter Keller, Andreas Mo¨glich, and Torsten Scho¨neberg for critical reading of the manuscript and many helpful discussions. Furthermore, we thank Arndt van Haeseler and Dorit Liebers-Helbig for support regarding the phylogenetic analysis and Nilima Sarkar for providing the plasmid pET28a/EcoliPAP. C.R. was supported by the Studienstiftung des deutschen Volkes. This work was funded by the Max-Planck-Society and the Deutsche Forschungsgemeinschaft (Mo634/2). Work at the Biozentrum was supported by the University of Basel and the Swiss National Science Fund. Received: March 19, 2004 Revised: May 21, 2004 Accepted: May 26, 2004 Published: August 12, 2004 References Cao, G.J., and Sarkar, N. (1997). Stationary phase-specific mRNAs in Escherichia coli are polyadenylated. Biochem. Biophys. Res. Commun. 239, 46–50. Cho, H.D., Oyelere, A.K., Strobel, S.A., and Weiner, A.M. (2003). Use of nucleotide analogs by class I and class II CCA-adding enzymes (tRNA nucleotidyltransferase): deciphering the basis for nucleotide selection. RNA 9, 970–981. Corpet, F. (1988). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 16, 10881–10890. Deutscher, M.P. (1982). tRNA nucleotidyltransferase. In The Enzymes, P.D. Boyer, ed. (New York: Academic Press), pp. 183–215. Hopfner, K.P., Kopetzki, E., Kresse, G.B., Bode, W., Huber, R., and Engh, R.A. (1998). New enzyme lineages by subdomain shuffling. Proc. Natl. Acad. Sci. USA 95, 9813–9818. Horton, R.M., Cai, Z.L., Ho, S.N., and Pease, L.R. (1990). Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques 8, 528–535. Hou, Y.M. (2000). Unusual synthesis by the Escherichia coli CCAadding enzyme. RNA 6, 1031–1043. Kelley, L.A., MacCallum, R.M., and Sternberg, M.J. (2000). Enhanced genome annotation using structural profiles in the program 3DPSSM. J. Mol. Biol. 299, 499–520. Li, F., Xiong, Y., Wang, J., Cho, H.D., Tomita, K., Weiner, A.M., and Steitz, T.A. (2002). Crystal structures of the Bacillus stearothermophilus CCA-adding enzyme and its complexes with ATP or CTP. Cell 111, 815–824. Lisitsky, I., Klaff, P., and Schuster, G. (1996). Addition of destabilizing poly (A)-rich sequences to endonuclease cleavage sites during the degradation of chloroplast mRNA. Proc. Natl. Acad. Sci. USA 93, 13398–13403. Martin, G., and Keller, W. (1996). Mutational analysis of mammalian poly(A) polymerase identifies a region for primer binding and cata-

lytic domain, homologous to the family X polymerases, and to other nucleotidyltransferases. EMBO J. 15, 2593–2603. Martin, G., and Keller, W. (2004). Sequence motifs that distinguish ATP(CTP):tRNA nucleotidyl transferases from eubacterial poly(A) polymerases. RNA 10, 899–906. McGuffin, L.J., Bryson, K., and Jones, D.T. (2000). The PSIPRED protein structure prediction server. Bioinformatics 16, 404–405. Peattie, D.A. (1979). Direct chemical method for sequencing RNA. Proc. Natl. Acad. Sci. USA 76, 1760–1764. Raynal, L.C., and Carpousis, A.J. (1999). Poly(A) polymerase I of Escherichia coli: characterization of the catalytic domain, an RNA binding site and regions for the interaction with proteins involved in mRNA degradation. Mol. Microbiol. 32, 765–775. Raynal, L.C., Krisch, H.M., and Carpousis, A.J. (1996). Bacterial poly(A) polymerase: an enzyme that modulates RNA stability. Biochimie 78, 390–398. Raynal, L.C., Krisch, H.M., and Carpousis, A.J. (1998). The Bacillus subtilis nucleotidyltransferase is a tRNA CCA-adding enzyme. J. Bacteriol. 180, 6276–6282. Reichert, A.S., Thurlow, D.L., and Mo¨rl, M. (2001). A eubacterial origin for the human tRNA nucleotidyltransferase? Biol. Chem. 382, 1431–1438. Reuven, N.B., and Deutscher, M.P. (1993). Substitution of the 3⬘ terminal adenosine residue of transfer RNA in vivo. Proc. Natl. Acad. Sci. USA 90, 4350–4353. Saitou, N., and Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Sarkar, N. (1997). Polyadenylation of mRNA in prokaryotes. Annu. Rev. Biochem. 66, 173–197. Schu¨rer, H., Schiffer, S., Marchfelder, A., and Mo¨rl, M. (2001). This is the end: processing, editing and repair at the tRNA 3⬘-terminus. Biol. Chem. 382, 1147–1156. Schu¨rer, H., Lang, K., Schuster, J., and Mo¨rl, M. (2002). A universal method to produce in vitro transcripts with homogeneous 3⬘ ends. Nucleic Acids Res. 30, e56. Shi, P.Y., Maizels, N., and Weiner, A.M. (1998). CCA addition by tRNA nucleotidyltransferase: polymerization without translocation? EMBO J. 17, 3197–3206. Sippel, A.E. (1973). Purification and characterization of adenosine triphosphate: ribonucleic acid adenyltransferase from Escherichia coli. Eur. J. Biochem. 37, 31–40. Sohlberg, B., Huang, J., and Cohen, S.N. (2003). The Streptomyces coelicolor polynucleotide phosphorylase homologue, and not the putative poly(A) polymerase, can polyadenylate RNA. J. Bacteriol. 185, 7273–7278. Terpe, K. (2003). Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems. Appl. Microbiol. Biotechnol. 60, 523–533. Wahle, E. (1995). 3⬘-end cleavage and polyadenylation of mRNA precursors. Biochim. Biophys. Acta 1261, 183–194. Williams, K.R., and Schofield, P. (1977). Kinetic mechanism of tRNA nucleotidyltransferase from Escherichia coli. J. Biol. Chem. 252, 5589–5597. Yehudai-Resheff, S., and Schuster, G. (2000). Characterization of the E. coli poly(A) polymerase: nucleotide specificity, RNA-binding affinities and RNA structure dependence. Nucleic Acids Res. 28, 1139–1144. Yue, D., Maizels, N., and Weiner, A.M. (1996). CCA-adding enzymes and poly(A) polymerases are all members of the same nucleotidyltransferase superfamily: characterization of the CCA-adding enzyme from the archaeal hyperthermophile Sulfolobus shibatae. RNA 2, 895–908.