- Email: [email protected]
Exercise training improves the antioxidant enzyme activity with no changes of telomere length
Available online at www.sciencedirect.com
Mechanisms of Ageing and Development 129 (2008) 254–260 www.elsevier.com/locate/mechagedev
Exercise training improves the antioxidant enzyme activity with no changes of telomere length Yun-A. Shin a,1, Jun-Hyoup Lee b, Wook Song a, Tae-Won Jun a,* a
Institute of Sports Science, Seoul National University, Sillim-dong, Kwanak-gu, Seoul 151-742, Republic of Korea b Research Institute of Sports Science, Sungkyunkwan University, Suwon, Republic of Korea Received 3 July 2007; received in revised form 24 November 2007; accepted 1 January 2008 Available online 17 January 2008
Abstract The purpose of this study was to determine the changes of both oxidant and antioxidant levels with exercise training in obese middle-aged women. The association between telomere length and oxidative stress with exercise was also examined. Sixteen obese middle-aged women participated in this study. The subjects were randomly divided into exercise group (EX) and control group (CON). EX performed aerobic exercise training for 6 months. DNA was extracted from leukocytes in peripheral blood and their telomere lengths were measured by real time PCR analysis. ˙ 2 max . Resting levels of erythrocyte glutathione peroxidase activity Long-term exercise training decreased body weight and BMI, and increased VO were higher in EX compared to CON. Superoxide dismutase (SOD) activities were higher after the acute exercise test at mid-intensity in postexercise training than in the pre-exercise training conditions. The telomere length did not change significantly after the acute exercise test in the pre-exercise training condition in spite of the increased level of malondialdehyde (MDA) as a marker of oxidative stress. In conclusion, antioxidant enzyme activities were increased following long-term exercise training; however, the lengths of telomere in leukocytes were not influenced by both mid-intensity and high intensity of exercise stress. # 2008 Elsevier Ireland Ltd. All rights reserved. Keywords: Telomere length; Oxidative stress; Antioxidant enzyme activity; Long-term exercise training; Acute exercise test
1. Introduction The elderly population is gradually increasing around the world. Although every human being ages, the aging process varies with respect to the manner and rate of the aging process (Harman, 2001). Many researchers have proposed several aging theories, genomics theories including the cellular senescence and cell death and free radical theories are considered the main theories among them. The aging process is exceedingly complex and multifarious factors affect aging (Knight, 2000). Scientists have been trying to explain the aging process at the cellular level. Cellular senescence is reported to be caused by telomere uncapping, DNA damaging, oxidative stress, activation of tumor genes, lack of growth hormone and nutrition among others (Ben-Porath and Weinberg, 2005).
* Corresponding author. Tel.: +82 2 880 7804; fax: +82 2 886 7804. E-mail address: [email protected] (T.-W. Jun). 1 Present address: Institute of Sports Science, Dankook University, Cheonan, Republic of Korea. 0047-6374/$ – see front matter # 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mad.2008.01.001
Among theses factors, telomeres consist of 5–15 kb repetitive hexanucleotide sequences (TTAGGG), located at the end of each chromosome (Blackburn, 1991). These stabilize the end of the chromosome; protecting them from recombination, fusion, and degradation, as well as preserving genetic information and controlling cellular reproductive ability (Hodes, 1999). Every time the cells go through division, they lose 30–200 DNA nucleotides and the telomeres become shorter (Harley et al., 1990; Counter et al., 1992). As a result, telomere length reflects the history of individual cell division, and telomere length in human cells, found in peripheral blood, has been reported to be a biomarker of cellular senescence (Cawthon et al., 2003). Recent research shows that cardiovascular disease and the accumulation of free radicals shorten telomeres through discontinuous duplication (Fitzpatrick et al., 2007; Kawanishi and Oikawa, 2004). Some causes of cardiovascular diseases are smoking, obesity, hypertension, hyperinsulinemia, psychological stress, and low estrogen levels; each of these factors is also known to increase oxidative stress and result in the reduction in telomere length (Epel et al., 2004; Jeanclos et al., 2000).
Y.-A. Shin et al. / Mechanisms of Ageing and Development 129 (2008) 254–260
Regular moderate exercise has been proposed due to the health benefits, including an increase of maximum oxygen consumption and decreased risk of obesity, cardiovascular disease and the metabolic syndrome (Fogelhoil et al., 2000; Sato et al., 2007). However, acute exercise increases oxidative stress because, during exercise, the increased strain of transporting oxygen to active muscles may damage cellular components. Especially, the oxidative stress by induced exercise in obese persons higher than non-obese persons following exercise (Saiki et al., 2001; Vincent et al., 2004). Numerous reports have documented increases in by-products of lipid peroxidation, especially malondialdehyde (MDA) following exercise (Alessio and Goldfarb, 1988; Jenkins, 1988; Metin et al., 2003). Saiki et al. (2001) reported that obese individuals have greater oxidative stress following acute treadmill exercise than non-obese counterparts. Santos-Silva et al. (2001) reported that resting MDA levels were higher in trained adolescent swimmers compared to the control group. However, not all studies have shown increases in MDA levels especially in response to exercise training. Niess et al. (1996) reported lower levels of plasma MDA in trained subjects than in controlled subjects after exhaustive treadmill exercise and Miyazaki et al. (2001) found the reduction of indices of oxidative stress following strenuous endurance training. These beneficial effects in response to exercise training imply a link between oxidative stress and increased antioxidant defense. Changes in antioxidant enzyme activity in erythrocytes correspond with enhanced protection from oxidative stress (Fielding and Meydani, 1997). Increased levels of blood antioxidant activity at rest were found in trained subjects. In addition, this antioxidant activity was further increased following exercise training (Urso and Clarkson, 2003). However, these conclusions still remain controversial. Tauler et al. (1999) reported no change in erythrocyte superoxide dismutase (SOD) activity in trained individuals following a moderate intensity duathlon. In addition, trained long distance skiers revealed a decrease in erythrocyte SOD activities in the blood following an acute bout of exercise (Hubner-Wozniak et al., 1994). On the basis of these considerations, more studies need to clarify the changes in antioxidant defense adaptation and oxidative stress both after single bouts of exercise and after aerobic exercise training. In addition, not many attempts have been made to establish the association between exercise and the telomere length. Therefore, the purpose of this study was to determine both oxidant and antioxidant enzyme activities in the blood before and after long-term aerobic training in obese middle-aged women. We also investigated the association between telomere length and oxidative stress with exercise.
255
women (Valdes et al., 2005). Furthermore, obese subjects had a greater risk of oxidative stress than non-obese subjects during an oxidative stimulus (Vincent et al., 2005). Therefore, we think telomere length in obese women is more sensitive to oxidative stress and can be changed with exercise training. Half of the subjects entered into a routine of regular exercise, while the control group, consisting of the other half of the subjects, did not participate in any form of regular exercise. None of the participants in this experiment had taken part in any regular aerobic exercise over the previous 6 months. Neither the exercise nor the control group was placed on any specific diet. All participants were not postmenopausal, did not suffer from metabolic disorders, did not smoke, were not taking anti-inflammatory drugs or steroids, and had not undergone surgery within the previous 3 months (We measured total cholesterol, HDL-C, triglyceride, fasting glucose, insulin, and estrogen levels [see Appendix Table 1].) Informed consent was obtained from all subjects prior to their participation in this study. The purpose of the first experiment was to determine whether 6 months of exercise training would encourage the adaptation of the defense system of antioxidants in obese middle-aged women. In the second experiment, we examined whether the length of telomeres was affected by the changes in the levels of oxidants and antioxidants after two different acute exercise tests at mid- and high intensities in pre- and post-exercise training (Fig. 1). These changes of oxidants and antioxidants after the acute exercise tests at moderate and high intensities were examined in pre- and post-exercise training.
2.2. Anthropometry measurements The subjects’ heights were measured on a portable stationmaster to an accuracy of 0.5 cm. Their weights were measured on an Inbody 3.0 (Biospace, Korea) to the nearest 0.1 kg.
2.3. Preliminary testing ˙ 2 max was measured in order to establish Prior to the trials, each subject’s VO their exercise training intensity. Subjects were familiarized with treadmill running and were informed of what was required of them with regards to the experiment. They then completed a graded treadmill exercise test to ˙ 2 max adhering to the Bruce Protocol (Bruce, 1972). determine each of their VO
2.4. Aerobic exercise training Aerobic training was supervised by an experienced physical education instructor and was performed 3 days a week for 6 months. Each session consisted of 10 min of warming up, 45 min of treadmill walking/running at ˙ 2 R (the difference between maximal VO ˙ 2 and resting VO ˙ 2 ), and 5 min 60% VO of cooling down. After 3 months of training, all subjects were examined and ˙ 2 max . their exercise intensity adjusted to their new measured VO
2.5. Acute exercise tests Only the exercise group took part in testing to compare ‘exercise intensity’ and they were asked to abstain from strenuous exercise, alcohol, and coffee for at least
2. Materials and methods 2.1. Subjects and experiment design Sixteen obese middle-aged women (age: 46.81 6.43 years, BMI: 28.55 2.80 kg/m2) participated in this study. Telomere length is differentially maintained at 30–50 years and an accelerated decrease thereafter (Brummendorf et al., 2003; Nawrot et al., 2004). However, telomere length has the association with obesity and obese women have 240 bp shorter telomere length than lean
Fig. 1. Experimental design of the present study. We examined whether the length of telomeres was affected by the changes of oxidant levels and antioxidants activities after two different acute exercise tests in pre-exercise training program. These tests were re-examined after 6 months aerobic exercise training. Acute exercise tests at two different intensities were performed at the level of 400 kcal.
256
Y.-A. Shin et al. / Mechanisms of Ageing and Development 129 (2008) 254–260
24 h beforehand. Tests were performed between 9 a.m. and 10:30 a.m. after an ˙ 2 max treadmill overnight fast. The participants performed 60% and 80% VO exercise, with a 1-week rest between in the two tests. These levels of exercise intensity were chosen as they follow the standards set by the ACSM (2006) in order to improve individual fitness. The energy expenditure in the acute exercise tests at both intensities was set at the level of 400 kcal for all subjects.
2.6. Analysis of oxidative stress and antioxidant enzyme activity For both experiments, serum aliquots were stored at 80 8C until assayed. A total of 10 ml of blood was obtained from the subjects before and after exercise testing after overnight fasting. A Diode Spectrophotometer (HP8452A, USA) was used to assess the MDA levels in the serum, according to the manufacturer’s instructions. In briefly, butylated hydroxyl toluene and chromogenic reagent were added to samples and warmed to 45 8C for 60 min. Absorbance values were followed spectrophotometrically at 586 nm. The MDA levels are reported as mmol serum. GPX activity was determined by colorimetric method. In brief, GPX catalyzes the oxidation of GSH (gluthathione) into GSSR (oxidized form of GSH) in the presence of cumene hydroxide. Then, GSSR can be converted to GSH in the presence of GR (gluthathione reductase) and NADPH. The decrease rate of NADPH to NADP+ in absorbance at 340 nm was then read with EIA reader (Molecular Device, USA). GPX activity is expressed as nmol/(min ml). Analysis of SOD was performed using the spectrophotometric method. Briefly, SOD plays a role in inhibiting the rate of nitro blue tetrazolium (NBT) reduction in the reaction with xanthine oxidase generating superoxide. The rate of reduction of NBT was read at 450 nm. One unit of SOD was defined as the enzyme activity required inhibiting the rate of NBT reduction by 50% in 1 min.
2.7. Analysis of the telomere length in WBC via real-time PCR Genomic DNAs were extracted from the peripheral blood by using Wizard Genomic DNA Purification Kit (Promega, Medison, USA) protocols. The relative ratio of telomere copy number to single gene copy number was measured by quantitative RCR as described by previously Cawthon (2002). Briefly the method is as follows: Eventually the contaminations is observed more sensitive to use by quantitative PCR, so diluted DNA in various concentrations (Applied Biosystem) was used for construction of standard curve and crossing point (Ct) (see Appendix Text; Fig. 1). Telomere primer sequences (50 ! 30 ) were tel 1, GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT; tel 2, TCCCGACTATC-CCTATCCCTATCCCTATCCCTATCCCTA. b-Globin primer sequences were 36B4u, CAG-CAAGTGGGAAGGTGTAATCC; 36B4d, CCCATTCTATCATCAACG-GGTACAA. The final telomere oligo-primer concentrations were tel1, 270 nM; tel 2, 900 nM. The final 36B4 (single copy gene) oligo-primer concentrations were 36B4u, 300 nM; 36B4d, 500 nM. In order to perform the polymerase chain reactions, we began by denaturizing at 94 8C for 3 min. This process was followed by 35 cycles of the following: 30 s of denaturizing at 94 8C, primer annealing at 56 8C for 25 s and, so that we could achieve extension, at 72 8C for 30 s. The end of the amplification cycles were set at 72 8C for 7 min. The formula 2DCt where DC t ¼ Cttelomere Ctb2-globin was used to calculating for telomere per single copy gene (T/S) values. In addition, relative T/S values were determined by sample T/S values compared with reference DNA T/S values. Southern blot analysis was also used primarily to compare the telomere length measured by quantitative PCR (see Appendix Fig. 2).
2.8. Statistical analyses Results were expressed as mean S.D. (standard deviation) using SPSS/PC statistic program (version 12.5 for windows; SPSS Inc., Chicago, IL, USA). Student’s t-test was used to determine the significance differences within group. Between-group comparisons were analyzed using independent t-test. For the changes of telomere length, MDA, SOD, and GPX levels after the acute exercise test in pre- and post-exercise training was assessed by three-way repeated ANOVA. The statistical factors analyzed were the acute exercise intensities, time, and long-term exercise training. Differences were considered statistically significant at p < 0.05.
3. Results 3.1. Physical characteristics of study subjects The changes in the physical characteristics of the subjects after long-term exercise training are shown in Table 1. Body weight ( p < 0.01) and BMI ( p < 0.01) ˙ 2 max (24.4%, p < 0.001) significantly decreased and VO significantly increased after 6-month exercise training. On the other hand, there were no significant changes in control group.
3.2. The resultant changes in oxidant, antioxidant enzymes, and telomere length at rest levels after long-term exercise training The changes in resting MDA levels and antioxidant enzymes activities of subjects in response to long-term exercise training are shown in Table 2. There were no significant changes in MDA levels and SOD activities at rest after aerobic exercise training. GPX activities increased significantly by 12%, for subjects at rest in the aerobic exercise group, after they had finished 6 months exercise training. On the other hand, MDA levels showed a tendency to increase after 6 months in control group ( p = 0.052). The changes in relative T/S values after 6 months were about 0.0003 0.0013 values in exercise group and 0.0144 0.1202 values in control group. In using Southern blot method, telomere length decreased about 16.25 23.26 bp in exercise group and 42.50 65.53 bp in control group. However, the change of telomere length after aerobic exercise training was not significantly different compared to before exercise training in both quantitative PCR and Southern blot method ( p > 0.05) (see Appendix Fig. 2).
Table 1 The changes in the physical characteristics of the subjects after long-term exercise training Variables
Weight (kg) BMI (kg/cm2) ˙ 2 max (ml/(kg min)) VO
Aerobic exercise (n = 8)
Control (n = 8)
Pre
Post
Pre
Post
70.24 8.36 28.34 2.64 25.24 0.94
67.78 8.21** 27.34 2.51** 31.41 1.71***
70.91 7.53 28.77 3.12 20.93 2.79
69.29 6.85 28.11 2.96 21.59 6.34
Values are expressed as mean S.D. BMI: body mass index. ** indicates significant difference compared to pre-exercise training ( p < 0.01). *** indicates significant difference compared to pre-exercise training ( p < 0.001).
Y.-A. Shin et al. / Mechanisms of Ageing and Development 129 (2008) 254–260
257
Table 2 The changes in resting MDA levels, antioxidant enzymes activities, and telomere length of subjects in response to long-term exercise training Aerobic exercise (n = 8)
MDA (mmol) SOD (U/ml) GPX (nmol/(min ml)) Telomere length (mean T/S ratio) Telomere length (kb)
Control (n = 8)
Pre
Post
Pre
Post
1.77 1.96 1.40 0.38 145.88 18.38 0.9962 0.0159 7.68 1.73
1.96 0.88 1.77 0.49 163.28 32.43* 0.9959 0.0146 7.67 1.74
1.09 0.42 1.40 0.47 147.68 17.31 1.0135 0.1277 8.03 2.62
1.94 0.84+ 1.58 0.58 152.21 34.97 0.9991 0.0075 7.99 2.60
Values are expressed as mean S.D. Telomere length means the ratio of the telomere length per standard gene. GPX: glutathione peroxidase; MDA: malondialdehyde; SOD: superoxide dismutase. * indicates significant difference compared to pre-exercise training ( p < 0.05). + shows increased tendency close to significant level in pre- and post-exercise training ( p = 0.052). Table 3 The changes in physical fitness after the acute exercise tests at different intensities in pre- and post-exercise training in exercise group Exercise intensity
˙ 2 max (ml/(kg min)) VO HR (beat/min) Velocity (km/h) Duration (min)+
˙ 2 60% VO
˙ 2 80% VO
max
max
Pre-training
Post-training
Pre-training
Post-training
16.54 0.56 126.07 8.30 4.42 0.43 65.88 9.02
20.25 1.03*** 129.62 6.08 5.24 0.42** 56.93 9.42
20.89 0.75 143.87 9.43 5.90 0.57 52.17 7.18
25.83 1.37*** 149.76 7.00 6.99 0.56** 44.63 7.43*
Values are expressed as mean S.D. * indicates significant difference compared to pre-exercise training ( p < 0.05). ** indicates significant difference compared to pre-exercise training ( p < 0.01). *** Indicates significant difference compared to pre-exercise training ( p < 0.001). + indicates duration for 400 kcal exercise test.
3.3. The changes in physical fitness after the acute exercise tests at different intensities in pre- and post-exercise training
changed after 6 months exercise training compared to preexercise training (Table 4).
The variations of the parameter of physical fitness related to acute exercise tests after long-term exercise training is shown in ˙ 2 (22.4%) and velocity (18.6%) significantly Table 3. VO increased once the level of exertion had risen above 60% ( p < 0.001, <0.01, respectively). At 80% exercise intensity, ˙ 2 (23.6%, p < 0.001) and velocity (18.4%, p < 0.001) VO markedly increased after 6 months exercise training. Compared to the results of pre-exercise training, overall physical fitness after 6-month exercise training showed improvement.
3.5. The changes in oxidative stress and antioxidant enzymes activities after the acute exercise test at two different intensities before and after exercise training
3.4. The changes in telomere length at two acute exercise intensities before and after long-term exercise training Immediately after the acute exercise tests with in both 60% ˙ 2 max , the telomere length was not significantly and 80% VO
MDA levels were considerably higher in the pre-exercise training condition immediately after the acute exercise test at ˙ 2 max (97.4%, p < 0.05) than before the test (Table 4). 80% VO MDA levels after the acute exercise test in post-exercise training condition were also significantly lower than pre˙ 2 max ( p < 0.05, exercise training at both 60% and 80% VO respectively). The change of MDA levels is shown in Fig. 2. However, immediately after the acute exercise tests at both 60% ˙ 2 max , MDA levels were not significantly increased and 80% VO in the post-exercise training condition and there were no ˙ 2 max . MDA levels, a differences between 60% and 80% VO
Table 4 The changes in antioxidant enzymes activities, MDA, and telomere length after the acute exercise tests at different intensities in pre- and post-exercise training ˙ 2 60% VO
Variables
˙ 2 80% VO
max
Before acute exercise
After acute exercise 0.77 0.37** 2.50 0.69**
max
Before acute exercise 1.65 0.53 1.12 0.98
After acute exercise
SOD (U/ml)
Pre-training Post-training
1.27 0.32 1.24 0.58
0.84 0.37** 1.42 0.93
GPx (nmol/(min ml))
Pre-training Post-training
144.29 20.47 169.11 36.23
143.83 21.19 176.41 31.97
144.35 19.76 188.11 26.66
MDA (mmol)
Pre-training Post-training
1.96 0.75 1.92 1.25
2.84 0.57 2.06 0.77
1.89 0.80 2.14 0.61
3.73 1.51* 2.27 0.85
Telomere length (T/S ratio)
Pre-training Post-training
1.00 0.02 1.00 0.01
0.99 0.04 1.00 0.00
1.00 0.01 1.00 0.01
0.98 0.01 1.00 0.01
146.08 17.53 195.74 32.68
Values are expressed as mean S.D. Telomere length means the ratio of the telomere length per standard gene. * indicates significant difference compared to before acute exercise tests ( p < 0.05). ** indicates significant difference compared to before acute exercise tests ( p < 0.01).
258
Y.-A. Shin et al. / Mechanisms of Ageing and Development 129 (2008) 254–260
Fig. 2. The changes in MDA levels, SOD, and GPX activities after the acute exercise tests at different intensities pre- and post-exercise training. Pre means before 6 months exercise training. Post means after 6 months exercise training. * indicates significant difference before and after acute exercise tests in the preand post-exercise training conditions ( p < 0.05). ** indicates significant difference before and after acute exercise tests in pre- and post-exercise training ( p < 0.01).
traditional marker of the oxidative stress in exercise, decreased significantly after 6 months exercise training. SOD activities were significantly reduced during in the preexercise training condition immediately after acute exercise ˙ 2 max tests at both 60% (39.4%, p < 0.01) and 80% VO (49.1%, p < 0.01) and there was no noteworthy alteration ˙ 2 max (Table 4). Also, SOD activities between 60% and 80% VO after the acute exercise test in post-exercise training were ˙ 2 max higher than the pre-exercise training condition at 60% VO ( p < 0.01). The change in SOD activities is shown in Fig. 2. In the post-exercise training condition, SOD activities were significantly increased immediately after the acute exercise test ˙ 2 max (101.6%, p < 0.01). Our results indicate that at 60% VO the antioxidant defense system increased after stimulation induced by long-term exercise training. Immediately after the acute exercise test at both 60% and ˙ 2 max , GPX activates remained unchanged in the pre80% VO exercise training condition and the difference between 60% and ˙ 2 max was negligible (Table 4). However, GPX 80% VO activates after the acute exercise test in the post-exercise training condition were higher than pre-exercise training ˙ 2 max condition at both 60% ( p < 0.05) and 80% VO ( p < 0.01). Also, GPX activates in the rest after the postexercise training condition were higher than the rest levels in the pre-exercise training condition ( p < 0.05). The change in GPX activates is shown in Fig. 2. 4. Discussion The present study shows that long-term aerobic exercise training increases antioxidant defense systems and reduces the up-regulation of oxidative stress in response to acute exercise at high and moderate intensities. Furthermore, these findings suggest that oxidative stress caused by the acute exercise with high intensity may not affect telomere proliferation irrespective of long-term exercise training. Changes in oxidative stress marker response to acute exercise with exercise training are
therefore not associated with concomitant alterations in telomere length. Several previous studies have reported that MDA levels in blood increase after single bouts of exercise. These results correlated with the increases in creatine kinase and lactic dehydrogenase in plasma, markers of muscle damage (Marzatico et al., 1997; Miyazaki et al., 2001). Toskulkao and Glinsukon (1996) reported that sedentary subjects had decreased SOD and GPX activities and had increased MDA levels in blood after 70% HRmax cycle ergometer exercise. Vincent et al. (2004) also reported that lipid hydroperoxide increased following acute aerobic treadmill exercise in obese women. Our finding is in accordance with previous studies which show that antioxidant activities decrease and MDA levels increase after the acute exercise test at high intensity before exercise training. In contrast to prior findings, strenuous endurance training was shown to reduce index of oxidative stress following high intensity exercise. Growing evidence demonstrated that regular exercise training improves antioxidant status (McArdle and Jackson, 2000) and enhances repair system to recover from oxidative damage (Rada´k et al., 2003; Sato et al., 2003). There was a smaller increase in MDA levels in response to the exercise bout after, compared to before, training (Miyazaki et al., 2001). Furthermore, Urso and Clarkson (2003) reported that trained individuals showed up-regulation of SOD and GPX activities in blood at rest, and SOD activity increased in response to an acute exercise test in trained subjects. Metin et al. (2003) suggested that the increase of antioxidant activities in young male football players was due to the elevation of oxidative stress caused by regular exercise. This study showed results similar to those previously described. The improvement in the physical fitness of subjects may be related to no change in MDA and a greater increase in SOD activities after the acute exercise testing in the postexercise training condition compared to the pre-exercise training condition (Yagi, 1987). Sen (1995) also reported that regular physical exercise improved the defense system by decreasing the post-exercise oxidative tress. Furthermore, the subjects in this study were obese women and Olusi (2002) reported that BMI correlates with the systemic oxidative stress. Following 6 months aerobic exercise training, GPX activity for the exercise group increased. In contrast to the exercise group, MDA levels in control group had a tendency to increase after 6 months. These findings are very interesting because high oxidative stress such as the acute exercise with high intensity may increase reactive oxygen species (ROS), especially in obesity with lipotoxic conditions (Kim et al., 2005). In spite of these conditions, regular exercise training had beneficial effects in terms of reducing oxidative stress in our present study. The association of oxidative stress and the telomere length has recently reported that oxidative stress accelerates the rate of telomere shortening in proportion to magnitude in vitro (von Zglinicki et al., 1995, 2000). On the other hand, the reduction of oxidative stress decreases the telomere-shortening rate and delays the replicative senescence (Sitte et al., 1998). The mechanism to explain oxidative stress-induced telomere
Y.-A. Shin et al. / Mechanisms of Ageing and Development 129 (2008) 254–260
shortening is as follows: telomeres have DNA regions (G-rich sequence) which are highly sensitive to oxidative damage. This in turn accelerates telomere shortening through DNA damage and prevents efficient repair (Lansdorp, 2005). Oxidative stress also affects telomere function in several ways, including the rapid and sustained decrease in telomere reverse transcriptase activity, an acceleration of telomere attrition (Blackburn, 2001) and replication errors (Goronzy et al., 2006). With regard to this telomere feature of oxidative response, it was shown that endurance athletes with exercise-associated chronic fatigue have abnormally shorter telomeres than control athletes (Collins et al., 2003). Moreover, the damage, caused by repeated training-induced muscle injury, has increased the proliferation of satellite cells (Collins et al., 2003). Bruunsgaard et al. (1999) reported that young and elderly groups showed significantly shorter telomere length after exhaustive exercise. Unlike previous studies, our results showed that, immediately after the acute exercise test in both 60% and 80% ˙ 2 max , the telomere length did not significantly change VO before and after 6-month exercise training. These results suggest that exercise itself could not be the critical factor in the shortening of the telomere length. Radak et al. (2001) also showed that telomerase activity in rat skeletal muscle was not significantly altered by mild and strenuous exercise training. Recent study has demonstrated that obese women have 240 bp shorter telomere length than lean women, which increase the white blood cell turnover and telomere attrition each cell replication, since obesity up-regulates the oxidative stress and inflammation (Valdes et al., 2005). Even though the results in this study did not reach a statistically significant level, the rate of telomere length shortening was faster in control group than in exercise group. Previous study reported that the decrease in relative T/S values per year was 0.0052 in middle-aged women (Nordfjall et al., 2005) and a loss of 31–63 bp per year in adulthood (Iwama et al., 1998). Our study showed similar telomere attrition rate for middle-aged women with previous studies, but the rate of telomere shortening in exercise group was less than previous studies (Iwama et al., 1998; Nordfjall et al., 2005). Therefore, the findings in this study are very interesting because this study was performed strictly in obese women, which could have more inflammatory response than lean subjects. Long-term exercise training down-regulated oxidative stress and improved the state of obesity in our obese subjects. Considering these results, we suggest that exercise may improved health in middle-aged women includes a decrease of weight and oxidative stress and this experiment has the possibility to reduce the concern that exercise may affect the shortening of telomere length, which is the marker of the aging process. However, our study has small numbers of subjects (n = 16) and much more subjects should be needed for the follow up study to examine the association of the telomere length and exercise benefit. In conclusion, there are increases in the activities of the antioxidant defense system following long-term exercise training and these indicate that exercise-induced variations
259
in antioxidant enzymes may be relevant in maintaining the length of telomeres. Also, oxidative stress caused by exercise would not affect the aging process as well as the telomere length shortening. Acknowledgments This work has been granted by the Korea Research Foundation (Program of Promotion of Predominance Research and Health Science, Project 2005, KRF-2005-041-G00154). The authors are grateful to NICEM research workers (SeungYoun Yi, Jong-Sung Lim, Yeoun-Hee Kim) and Professor Bob Hickner, Jun-Ho Lee & Kyoung-Young Lee for their technical assistance and editorial support. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.mad.2008.01.001. References ACSM, 2006. ACSM’s Guidelines for Exercise Testing and Prescription, 7th edition. American College of Sports Medicine Inc./Lippincott Williams & Wilkins. Alessio, H.M., Goldfarb, A.H., 1988. Lipid peroxidation and scavenger enzymes during exercise: adaptive response to training. J. Appl. Physiol. 64 (4), 1333–1336. Ben-Porath, I., Weinberg, R.A., 2005. The signals and pathways activating cellular senescence. Int. J. Biochem. Cell Biol. 37 (5), 961–976. Blackburn, E.H., 2001. Switching and signaling at the telomere. Cell 106 (6), 661–673. Blackburn, E.H., 1991. Structure and function of telomeres. Nature 350 (6319), 569–573. Brummendorf, T.H., Ersoz, I., Hartmann, U., Bartolovic, K., Balabanov, S., Wahl, A., Paschka, P., Kreil, S., Lahaye, T., Berger, U., Gschaidmeier, H., Bokemeyer, C., Hehlmann, R., Dietz, K., Lansdorp, P.M., Kanz, L., Hochhaus, A., 2003. Telomere length in peripheral blood granulocytes reflects response to treatment with imatinib in patients with chronic myeloid leukemia. Blood 101 (1), 375–376. Bruunsgaard, H., Jensen, M.S., Schjerling, P., Halkjear-Kristensen, J., Ogawa, K., Skinhoi, P., Pedersen, B.K., 1999. Exercise induces recruitment of lymphocytes with activated phenotype and short telomeres in young and elderly humans. Life Sci. 65 (24), 2623–2633. Bruce, R.A., 1972. Multistage treadmill test of submaximal and maximal exercise. In: American Heart Association, Exercise Testing and Training of Apparently Healthy Individuals; A Handbook for Physicians. American Heart Association, New York, pp. 32–34. Cawthon, R.M., Smith, K.R., O’Brien, E., Sivatchenko, A., Kerber, R.A., 2003. Association between telomere length in blood and mortality in people aged 60 years or older. Lancet 361 (9355), 393–395. Cawthon, R.M., 2002. Telomere measurement by quantitative PCR. Nucleic Acids Res. 30 (10), e47. Collins, M., Renault, V., Grobler, L.A., St Clair Gibson, A., Lambert, M.I., Wayne, Derman, E., Butler-Browne, G.S., Noakes, T.D., Mouly, V., 2003. Athletes with exercise-associated fatigue have abnormally short muscle DNA telomeres. Med. Sci. Sports Exerc. 35 (9), 1524–1528. Counter, C.M., Avilion, A.A., LeFeuvre, C.E., Stewart, N.G., Greider, C.W., Harley, C.B., Bacchetti, S., 1992. Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J. 11 (5), 1921–1929. Epel, E.S., Blackburn, E.H., Lin, J., Dhabhar, F.S., Adler, N.E., Morrow, J.D., Cawthon, R.M., 2004. Accelerated telomere shortening in response to life stress. Proc. Natl. Acad. Sci. U.S.A. 101 (49), 17312–17315.
260
Y.-A. Shin et al. / Mechanisms of Ageing and Development 129 (2008) 254–260
Fielding, R.A., Meydani, M., 1997. Exercise, free radical generation, and aging. Aging (Milano) 9 (1–2), 12–18. Fitzpatrick, A.L., Kronmal, R.A., Gardner, J.P., Psaty, B.M., Jenny, N.S., Tracy, R.P., Walston, J., Kimura, M., Abraham, A., 2007. Leukocyte telomere length and cardiovascular disease in the cardiovascular health study. Am. J. Epidemiol. 165 (1), 14–21. Fogelhoil, M., Kijala, U., Kaprio, J., Sarna, S., 2000. Predictors of weight change in middle-aged and old men. Obes. Res. 8, 267–273. Goronzy, J.J., Fujii, H., Weyand, C.M., 2006. Telomeres, immune aging and autoimmunity. Exp. Gerontol. 41 (3), 246–251. Harley, C.B., Futcher, A.B., Greider, C.W., 1990. Telomeres shorten during ageing of human fibroblasts. Nature 345 (6274), 458–460. Harman, D., 2001. Aging: overview. Ann. N.Y. Acad. Sci. 928, 1–21. Hodes, R.J., 1999. Telomere length, aging, and somatic cell turnover. J. Exp. Med. 190 (2), 153–156. Hubner-Wozniak, E., Panczenko-Kresowka, B., Lerczak, K., Psnik, J., 1994. Effects of graded treadmill exercise on the activity of blood antioxidant enzymes, lipid peroxides and nonenzymatic anti-oxidants in long-distance skiers. Biol. Sport 11 (4), 217–226. Iwama, H., Ohyashiki, K., Ohyashiki, J.H., Hayashi, S., Yahata, N., Ando, K., Toyama, K., Hoshika, A., Takasaki, M., Mori, M., Shay, J.W., 1998. Telomeric length and telomerase activity vary with age in peripheral blood cells obtained from normal individuals. Hum. Genet. 102 (4), 397– 402. Jeanclos, E., Schork, N.J., Kyvik, K.O., Kimura, M., Skurnick, J.H., Aviv, A., 2000. Telomere length inversely correlates with pulse pressure and is highly familial. Hypertension 36 (2), 195–200. Jenkins, R.R., 1988. Free radical chemistry. Relationship to exercise. Sports Med. 5 (3), 156–170. Kawanishi, S., Oikawa, S., 2004. Mechanism of telomere shortening by oxidative stress. Ann. N.Y. Acad. Sci. 1019, 278–284. Kim, S., Sohn, I., Lee, Y.S., Lee, Y.S., 2005. Hepatic gene expression profiles are altered by geistein supplementation in mice with diet-induced obesity. J. Nutr. 135 (1), 33–41. Knight, J.A., 2000. The biochemistry of aging. Adv. Clin. Chem. 35, 1–62 Review. Lansdorp, P.M., 2005. Major cutbacks at chromosome ends. Trends Biochem. Sci. 30, 388–395. McArdle, A., Jackson, M.J., 2000. Exercise, oxidative stress and ageing. J. Anat. 197 (Pt 4), 539–541. Marzatico, F., Pansarasa, O., Bertorelli, L., Somenzini, L., Della Valle, G., 1997. Blood free radical antioxidant enzymes and lipid peroxides following longdistance and lactacidemic performances in highly trained aerobic and sprint athletes. J. Sports Med. Phys. Fitness 37 (4), 235–239. Metin, G., Atukeren, P., Alturfan, A.A., Gulyasar, T., Kaya, M., Gumustas, M.K., 2003. Lipid peroxidation, erythrocyte superoxide-dismutase activity and trace metals in young male footballers. Yonsei Med. J. 44 (6), 979–986. Miyazaki, H., Oh-Ishi, S., Ookawara, T., Kizaki, T., Toshinai, K., Ha, S., Haga, S., Ji, L.L., Ohno, H., 2001. Strenuous endurance training in humans reduces oxidative stress following exhausting exercise. Eur. J. Appl. Physiol. 84 (1–2), 1–6. Nawrot, T.S., Staessen, J.A., Gardner, J.P., Aviv, A., 2004. Telomere length and possible link to X chromosome. Lancet 363 (9408), 507–510. Niess, A.M., Hartmann, A., Gru¨nert-Fuchs, M., Poch, B., Speit, G., 1996. DNA damage after exhaustive treadmill running in trained and untrained men. Int. J. Sports Med. 17 (6), 397–403.
Nordfjall, K., Larefalk, A., Lindgren, P., Holmberg, D., Roos, G., 2005. Telomere length and heredity: indications of paternal inheritance. Proc. Natl. Acad. Sci. U.S.A. 102 (45), 16374–16378. Olusi, S.O., 2002. Obesity is an independent risk facot for plasma lipid peroxidation and depletion of erythrocyte cytoprotective enzymes in humans. Int. J. Obes. Relat. Metab. Disord. 26, 1159–1164. Rada´k, Z., Apor, P., Pucsok, J., Berkes, I., Ogonovszky, H., Pavlik, G., Nakamoto, H., Goto, S., 2003. Marathon running alters the DNA base excision repair in human skeletal muscle. Life Sci. 72 (14), 1627–1633. Radak, Z., Taylor, A.W., Sasvari, M., Ohno, H., Horkay, B., Furesz, J., Gaal, D., Kanel, T., 2001. Telomerase activity is not altered by regular strenuous exercise in skeletal muscle or by sarcoma in liver of rats. Redox Rep. 6 (2), 99–103. Saiki, S., Sato, T., Kohzuki, M., Kamimoto, M., Yosida, T., 2001. Changes in serum hypoxanthine levels by exercise in obese subjects. Metabolism 50 (6), 627–630. Santos-Silva, A., Rebelo, M.I., Castro, E.M., Belo, L., Guerra, A., Rego, C., Quintanilha, A., 2001. Leukocyte activation, erythrocyte damage, lipid profile and oxidative stress imposed by high competition physical exercise in adolescents. Clin. Chim. Acta 306 (1–2), 119–126. Sato, Y., Nagasaki, M., Kubota, M., Uno, T., Nakai, N., 2007. Clinical aspects of physical exercise for diabetes/metabolic syndrome. Diabetes Res. Clin. Pract. 77 (1), S87–S91. Sato, Y., Nanri, H., Ohta, M., Kasai, H., Ikeda, M., 2003. Increases of human MTH1 and decreases of 8-hydroxyde-oxyguanosine in leukocyte DNA by acute and chronic exercise in healthy male subjects. Biochem. Biophys. Res. 305, 333–338. Sen, C.K., 1995. Oxidants and antioxidants in exercise. J. Appl. Physiol. 79, 675–686. Sitte, N., Saretzki, G., von Zglinicki, T., 1998. Accelerated telomere shortening in fibroblasts after extended periods of confluency. Free Radic. Biol. Med. 24 (6), 885–893. Tauler, P., Gimeno, I., Aguilo´, A., Guix, M.P., Pons, A., 1999. Regulation of erythrocyte antioxidant enzyme activities in athletes during competition and short-term recovery. Pflugers Arch. 438 (6), 782–787. Toskulkao, C., Glinsukon, T., 1996. Endurance exercise and muscle damage: relationship to lipid peroxidation and scavenging enzymes in short and long distance runners. Jpn. J. Phys. Fitness Sport Med. 45, 63–70. Urso, M.L., Clarkson, P.M., 2003. Oxidative stress, exercise, and antioxidant supplementation. Toxicology 189 (1–2), 41–54. Valdes, A.M., Andrew, T., Gardner, J.P., Kimura, M., Oelsner, E., Cherkas, L.F., Aviv, A., Spector, T.D., 2005. Obesity, cigarette smoking, and telomere length in women. Lancet 366 (9486), 662–664. Vincent, H.K., Vincent, K.R., Bourguignon, C., Braith, R.W., 2005. Obesity and postexercise oxidative stress in older women. Med. Sci. Sports Exerc. 37 (2), 213–219. Vincent, H.K., Morgan, J.W., Vincent, K.R., 2004. Obesity exacerbates oxidative stress levels after acute exercise. Med. Sci. Sports Exerc. 36 (5), 772–779. von Zglinicki, T., Pilger, R., Sitte, N., 2000. Accumulation of single-strand breaks is the major cause of telomere shortening in human fibroblasts. Free Radic. Biol. Med. 28 (1), 64–74. von Zglinicki, T., Saretzki, G., Docke, W., Lotze, C., 1995. Mild hyperoxia shortens telomeres and inhibits proliferation of fibroblasts: a model for senescence? Exp. Cell Res. 220 (1), 186–193. Yagi, K., 1987. Lipid peroxides and human diseases. Chem. Phys. Lipids 45 (2–4), 337–351.
Mechanisms of Ageing and Development 129 (2008) 254–260 www.elsevier.com/locate/mechagedev
Exercise training improves the antioxidant enzyme activity with no changes of telomere length Yun-A. Shin a,1, Jun-Hyoup Lee b, Wook Song a, Tae-Won Jun a,* a
Institute of Sports Science, Seoul National University, Sillim-dong, Kwanak-gu, Seoul 151-742, Republic of Korea b Research Institute of Sports Science, Sungkyunkwan University, Suwon, Republic of Korea Received 3 July 2007; received in revised form 24 November 2007; accepted 1 January 2008 Available online 17 January 2008
Abstract The purpose of this study was to determine the changes of both oxidant and antioxidant levels with exercise training in obese middle-aged women. The association between telomere length and oxidative stress with exercise was also examined. Sixteen obese middle-aged women participated in this study. The subjects were randomly divided into exercise group (EX) and control group (CON). EX performed aerobic exercise training for 6 months. DNA was extracted from leukocytes in peripheral blood and their telomere lengths were measured by real time PCR analysis. ˙ 2 max . Resting levels of erythrocyte glutathione peroxidase activity Long-term exercise training decreased body weight and BMI, and increased VO were higher in EX compared to CON. Superoxide dismutase (SOD) activities were higher after the acute exercise test at mid-intensity in postexercise training than in the pre-exercise training conditions. The telomere length did not change significantly after the acute exercise test in the pre-exercise training condition in spite of the increased level of malondialdehyde (MDA) as a marker of oxidative stress. In conclusion, antioxidant enzyme activities were increased following long-term exercise training; however, the lengths of telomere in leukocytes were not influenced by both mid-intensity and high intensity of exercise stress. # 2008 Elsevier Ireland Ltd. All rights reserved. Keywords: Telomere length; Oxidative stress; Antioxidant enzyme activity; Long-term exercise training; Acute exercise test
1. Introduction The elderly population is gradually increasing around the world. Although every human being ages, the aging process varies with respect to the manner and rate of the aging process (Harman, 2001). Many researchers have proposed several aging theories, genomics theories including the cellular senescence and cell death and free radical theories are considered the main theories among them. The aging process is exceedingly complex and multifarious factors affect aging (Knight, 2000). Scientists have been trying to explain the aging process at the cellular level. Cellular senescence is reported to be caused by telomere uncapping, DNA damaging, oxidative stress, activation of tumor genes, lack of growth hormone and nutrition among others (Ben-Porath and Weinberg, 2005).
* Corresponding author. Tel.: +82 2 880 7804; fax: +82 2 886 7804. E-mail address: [email protected] (T.-W. Jun). 1 Present address: Institute of Sports Science, Dankook University, Cheonan, Republic of Korea. 0047-6374/$ – see front matter # 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mad.2008.01.001
Among theses factors, telomeres consist of 5–15 kb repetitive hexanucleotide sequences (TTAGGG), located at the end of each chromosome (Blackburn, 1991). These stabilize the end of the chromosome; protecting them from recombination, fusion, and degradation, as well as preserving genetic information and controlling cellular reproductive ability (Hodes, 1999). Every time the cells go through division, they lose 30–200 DNA nucleotides and the telomeres become shorter (Harley et al., 1990; Counter et al., 1992). As a result, telomere length reflects the history of individual cell division, and telomere length in human cells, found in peripheral blood, has been reported to be a biomarker of cellular senescence (Cawthon et al., 2003). Recent research shows that cardiovascular disease and the accumulation of free radicals shorten telomeres through discontinuous duplication (Fitzpatrick et al., 2007; Kawanishi and Oikawa, 2004). Some causes of cardiovascular diseases are smoking, obesity, hypertension, hyperinsulinemia, psychological stress, and low estrogen levels; each of these factors is also known to increase oxidative stress and result in the reduction in telomere length (Epel et al., 2004; Jeanclos et al., 2000).
Y.-A. Shin et al. / Mechanisms of Ageing and Development 129 (2008) 254–260
Regular moderate exercise has been proposed due to the health benefits, including an increase of maximum oxygen consumption and decreased risk of obesity, cardiovascular disease and the metabolic syndrome (Fogelhoil et al., 2000; Sato et al., 2007). However, acute exercise increases oxidative stress because, during exercise, the increased strain of transporting oxygen to active muscles may damage cellular components. Especially, the oxidative stress by induced exercise in obese persons higher than non-obese persons following exercise (Saiki et al., 2001; Vincent et al., 2004). Numerous reports have documented increases in by-products of lipid peroxidation, especially malondialdehyde (MDA) following exercise (Alessio and Goldfarb, 1988; Jenkins, 1988; Metin et al., 2003). Saiki et al. (2001) reported that obese individuals have greater oxidative stress following acute treadmill exercise than non-obese counterparts. Santos-Silva et al. (2001) reported that resting MDA levels were higher in trained adolescent swimmers compared to the control group. However, not all studies have shown increases in MDA levels especially in response to exercise training. Niess et al. (1996) reported lower levels of plasma MDA in trained subjects than in controlled subjects after exhaustive treadmill exercise and Miyazaki et al. (2001) found the reduction of indices of oxidative stress following strenuous endurance training. These beneficial effects in response to exercise training imply a link between oxidative stress and increased antioxidant defense. Changes in antioxidant enzyme activity in erythrocytes correspond with enhanced protection from oxidative stress (Fielding and Meydani, 1997). Increased levels of blood antioxidant activity at rest were found in trained subjects. In addition, this antioxidant activity was further increased following exercise training (Urso and Clarkson, 2003). However, these conclusions still remain controversial. Tauler et al. (1999) reported no change in erythrocyte superoxide dismutase (SOD) activity in trained individuals following a moderate intensity duathlon. In addition, trained long distance skiers revealed a decrease in erythrocyte SOD activities in the blood following an acute bout of exercise (Hubner-Wozniak et al., 1994). On the basis of these considerations, more studies need to clarify the changes in antioxidant defense adaptation and oxidative stress both after single bouts of exercise and after aerobic exercise training. In addition, not many attempts have been made to establish the association between exercise and the telomere length. Therefore, the purpose of this study was to determine both oxidant and antioxidant enzyme activities in the blood before and after long-term aerobic training in obese middle-aged women. We also investigated the association between telomere length and oxidative stress with exercise.
255
women (Valdes et al., 2005). Furthermore, obese subjects had a greater risk of oxidative stress than non-obese subjects during an oxidative stimulus (Vincent et al., 2005). Therefore, we think telomere length in obese women is more sensitive to oxidative stress and can be changed with exercise training. Half of the subjects entered into a routine of regular exercise, while the control group, consisting of the other half of the subjects, did not participate in any form of regular exercise. None of the participants in this experiment had taken part in any regular aerobic exercise over the previous 6 months. Neither the exercise nor the control group was placed on any specific diet. All participants were not postmenopausal, did not suffer from metabolic disorders, did not smoke, were not taking anti-inflammatory drugs or steroids, and had not undergone surgery within the previous 3 months (We measured total cholesterol, HDL-C, triglyceride, fasting glucose, insulin, and estrogen levels [see Appendix Table 1].) Informed consent was obtained from all subjects prior to their participation in this study. The purpose of the first experiment was to determine whether 6 months of exercise training would encourage the adaptation of the defense system of antioxidants in obese middle-aged women. In the second experiment, we examined whether the length of telomeres was affected by the changes in the levels of oxidants and antioxidants after two different acute exercise tests at mid- and high intensities in pre- and post-exercise training (Fig. 1). These changes of oxidants and antioxidants after the acute exercise tests at moderate and high intensities were examined in pre- and post-exercise training.
2.2. Anthropometry measurements The subjects’ heights were measured on a portable stationmaster to an accuracy of 0.5 cm. Their weights were measured on an Inbody 3.0 (Biospace, Korea) to the nearest 0.1 kg.
2.3. Preliminary testing ˙ 2 max was measured in order to establish Prior to the trials, each subject’s VO their exercise training intensity. Subjects were familiarized with treadmill running and were informed of what was required of them with regards to the experiment. They then completed a graded treadmill exercise test to ˙ 2 max adhering to the Bruce Protocol (Bruce, 1972). determine each of their VO
2.4. Aerobic exercise training Aerobic training was supervised by an experienced physical education instructor and was performed 3 days a week for 6 months. Each session consisted of 10 min of warming up, 45 min of treadmill walking/running at ˙ 2 R (the difference between maximal VO ˙ 2 and resting VO ˙ 2 ), and 5 min 60% VO of cooling down. After 3 months of training, all subjects were examined and ˙ 2 max . their exercise intensity adjusted to their new measured VO
2.5. Acute exercise tests Only the exercise group took part in testing to compare ‘exercise intensity’ and they were asked to abstain from strenuous exercise, alcohol, and coffee for at least
2. Materials and methods 2.1. Subjects and experiment design Sixteen obese middle-aged women (age: 46.81 6.43 years, BMI: 28.55 2.80 kg/m2) participated in this study. Telomere length is differentially maintained at 30–50 years and an accelerated decrease thereafter (Brummendorf et al., 2003; Nawrot et al., 2004). However, telomere length has the association with obesity and obese women have 240 bp shorter telomere length than lean
Fig. 1. Experimental design of the present study. We examined whether the length of telomeres was affected by the changes of oxidant levels and antioxidants activities after two different acute exercise tests in pre-exercise training program. These tests were re-examined after 6 months aerobic exercise training. Acute exercise tests at two different intensities were performed at the level of 400 kcal.
256
Y.-A. Shin et al. / Mechanisms of Ageing and Development 129 (2008) 254–260
24 h beforehand. Tests were performed between 9 a.m. and 10:30 a.m. after an ˙ 2 max treadmill overnight fast. The participants performed 60% and 80% VO exercise, with a 1-week rest between in the two tests. These levels of exercise intensity were chosen as they follow the standards set by the ACSM (2006) in order to improve individual fitness. The energy expenditure in the acute exercise tests at both intensities was set at the level of 400 kcal for all subjects.
2.6. Analysis of oxidative stress and antioxidant enzyme activity For both experiments, serum aliquots were stored at 80 8C until assayed. A total of 10 ml of blood was obtained from the subjects before and after exercise testing after overnight fasting. A Diode Spectrophotometer (HP8452A, USA) was used to assess the MDA levels in the serum, according to the manufacturer’s instructions. In briefly, butylated hydroxyl toluene and chromogenic reagent were added to samples and warmed to 45 8C for 60 min. Absorbance values were followed spectrophotometrically at 586 nm. The MDA levels are reported as mmol serum. GPX activity was determined by colorimetric method. In brief, GPX catalyzes the oxidation of GSH (gluthathione) into GSSR (oxidized form of GSH) in the presence of cumene hydroxide. Then, GSSR can be converted to GSH in the presence of GR (gluthathione reductase) and NADPH. The decrease rate of NADPH to NADP+ in absorbance at 340 nm was then read with EIA reader (Molecular Device, USA). GPX activity is expressed as nmol/(min ml). Analysis of SOD was performed using the spectrophotometric method. Briefly, SOD plays a role in inhibiting the rate of nitro blue tetrazolium (NBT) reduction in the reaction with xanthine oxidase generating superoxide. The rate of reduction of NBT was read at 450 nm. One unit of SOD was defined as the enzyme activity required inhibiting the rate of NBT reduction by 50% in 1 min.
2.7. Analysis of the telomere length in WBC via real-time PCR Genomic DNAs were extracted from the peripheral blood by using Wizard Genomic DNA Purification Kit (Promega, Medison, USA) protocols. The relative ratio of telomere copy number to single gene copy number was measured by quantitative RCR as described by previously Cawthon (2002). Briefly the method is as follows: Eventually the contaminations is observed more sensitive to use by quantitative PCR, so diluted DNA in various concentrations (Applied Biosystem) was used for construction of standard curve and crossing point (Ct) (see Appendix Text; Fig. 1). Telomere primer sequences (50 ! 30 ) were tel 1, GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT; tel 2, TCCCGACTATC-CCTATCCCTATCCCTATCCCTATCCCTA. b-Globin primer sequences were 36B4u, CAG-CAAGTGGGAAGGTGTAATCC; 36B4d, CCCATTCTATCATCAACG-GGTACAA. The final telomere oligo-primer concentrations were tel1, 270 nM; tel 2, 900 nM. The final 36B4 (single copy gene) oligo-primer concentrations were 36B4u, 300 nM; 36B4d, 500 nM. In order to perform the polymerase chain reactions, we began by denaturizing at 94 8C for 3 min. This process was followed by 35 cycles of the following: 30 s of denaturizing at 94 8C, primer annealing at 56 8C for 25 s and, so that we could achieve extension, at 72 8C for 30 s. The end of the amplification cycles were set at 72 8C for 7 min. The formula 2DCt where DC t ¼ Cttelomere Ctb2-globin was used to calculating for telomere per single copy gene (T/S) values. In addition, relative T/S values were determined by sample T/S values compared with reference DNA T/S values. Southern blot analysis was also used primarily to compare the telomere length measured by quantitative PCR (see Appendix Fig. 2).
2.8. Statistical analyses Results were expressed as mean S.D. (standard deviation) using SPSS/PC statistic program (version 12.5 for windows; SPSS Inc., Chicago, IL, USA). Student’s t-test was used to determine the significance differences within group. Between-group comparisons were analyzed using independent t-test. For the changes of telomere length, MDA, SOD, and GPX levels after the acute exercise test in pre- and post-exercise training was assessed by three-way repeated ANOVA. The statistical factors analyzed were the acute exercise intensities, time, and long-term exercise training. Differences were considered statistically significant at p < 0.05.
3. Results 3.1. Physical characteristics of study subjects The changes in the physical characteristics of the subjects after long-term exercise training are shown in Table 1. Body weight ( p < 0.01) and BMI ( p < 0.01) ˙ 2 max (24.4%, p < 0.001) significantly decreased and VO significantly increased after 6-month exercise training. On the other hand, there were no significant changes in control group.
3.2. The resultant changes in oxidant, antioxidant enzymes, and telomere length at rest levels after long-term exercise training The changes in resting MDA levels and antioxidant enzymes activities of subjects in response to long-term exercise training are shown in Table 2. There were no significant changes in MDA levels and SOD activities at rest after aerobic exercise training. GPX activities increased significantly by 12%, for subjects at rest in the aerobic exercise group, after they had finished 6 months exercise training. On the other hand, MDA levels showed a tendency to increase after 6 months in control group ( p = 0.052). The changes in relative T/S values after 6 months were about 0.0003 0.0013 values in exercise group and 0.0144 0.1202 values in control group. In using Southern blot method, telomere length decreased about 16.25 23.26 bp in exercise group and 42.50 65.53 bp in control group. However, the change of telomere length after aerobic exercise training was not significantly different compared to before exercise training in both quantitative PCR and Southern blot method ( p > 0.05) (see Appendix Fig. 2).
Table 1 The changes in the physical characteristics of the subjects after long-term exercise training Variables
Weight (kg) BMI (kg/cm2) ˙ 2 max (ml/(kg min)) VO
Aerobic exercise (n = 8)
Control (n = 8)
Pre
Post
Pre
Post
70.24 8.36 28.34 2.64 25.24 0.94
67.78 8.21** 27.34 2.51** 31.41 1.71***
70.91 7.53 28.77 3.12 20.93 2.79
69.29 6.85 28.11 2.96 21.59 6.34
Values are expressed as mean S.D. BMI: body mass index. ** indicates significant difference compared to pre-exercise training ( p < 0.01). *** indicates significant difference compared to pre-exercise training ( p < 0.001).
Y.-A. Shin et al. / Mechanisms of Ageing and Development 129 (2008) 254–260
257
Table 2 The changes in resting MDA levels, antioxidant enzymes activities, and telomere length of subjects in response to long-term exercise training Aerobic exercise (n = 8)
MDA (mmol) SOD (U/ml) GPX (nmol/(min ml)) Telomere length (mean T/S ratio) Telomere length (kb)
Control (n = 8)
Pre
Post
Pre
Post
1.77 1.96 1.40 0.38 145.88 18.38 0.9962 0.0159 7.68 1.73
1.96 0.88 1.77 0.49 163.28 32.43* 0.9959 0.0146 7.67 1.74
1.09 0.42 1.40 0.47 147.68 17.31 1.0135 0.1277 8.03 2.62
1.94 0.84+ 1.58 0.58 152.21 34.97 0.9991 0.0075 7.99 2.60
Values are expressed as mean S.D. Telomere length means the ratio of the telomere length per standard gene. GPX: glutathione peroxidase; MDA: malondialdehyde; SOD: superoxide dismutase. * indicates significant difference compared to pre-exercise training ( p < 0.05). + shows increased tendency close to significant level in pre- and post-exercise training ( p = 0.052). Table 3 The changes in physical fitness after the acute exercise tests at different intensities in pre- and post-exercise training in exercise group Exercise intensity
˙ 2 max (ml/(kg min)) VO HR (beat/min) Velocity (km/h) Duration (min)+
˙ 2 60% VO
˙ 2 80% VO
max
max
Pre-training
Post-training
Pre-training
Post-training
16.54 0.56 126.07 8.30 4.42 0.43 65.88 9.02
20.25 1.03*** 129.62 6.08 5.24 0.42** 56.93 9.42
20.89 0.75 143.87 9.43 5.90 0.57 52.17 7.18
25.83 1.37*** 149.76 7.00 6.99 0.56** 44.63 7.43*
Values are expressed as mean S.D. * indicates significant difference compared to pre-exercise training ( p < 0.05). ** indicates significant difference compared to pre-exercise training ( p < 0.01). *** Indicates significant difference compared to pre-exercise training ( p < 0.001). + indicates duration for 400 kcal exercise test.
3.3. The changes in physical fitness after the acute exercise tests at different intensities in pre- and post-exercise training
changed after 6 months exercise training compared to preexercise training (Table 4).
The variations of the parameter of physical fitness related to acute exercise tests after long-term exercise training is shown in ˙ 2 (22.4%) and velocity (18.6%) significantly Table 3. VO increased once the level of exertion had risen above 60% ( p < 0.001, <0.01, respectively). At 80% exercise intensity, ˙ 2 (23.6%, p < 0.001) and velocity (18.4%, p < 0.001) VO markedly increased after 6 months exercise training. Compared to the results of pre-exercise training, overall physical fitness after 6-month exercise training showed improvement.
3.5. The changes in oxidative stress and antioxidant enzymes activities after the acute exercise test at two different intensities before and after exercise training
3.4. The changes in telomere length at two acute exercise intensities before and after long-term exercise training Immediately after the acute exercise tests with in both 60% ˙ 2 max , the telomere length was not significantly and 80% VO
MDA levels were considerably higher in the pre-exercise training condition immediately after the acute exercise test at ˙ 2 max (97.4%, p < 0.05) than before the test (Table 4). 80% VO MDA levels after the acute exercise test in post-exercise training condition were also significantly lower than pre˙ 2 max ( p < 0.05, exercise training at both 60% and 80% VO respectively). The change of MDA levels is shown in Fig. 2. However, immediately after the acute exercise tests at both 60% ˙ 2 max , MDA levels were not significantly increased and 80% VO in the post-exercise training condition and there were no ˙ 2 max . MDA levels, a differences between 60% and 80% VO
Table 4 The changes in antioxidant enzymes activities, MDA, and telomere length after the acute exercise tests at different intensities in pre- and post-exercise training ˙ 2 60% VO
Variables
˙ 2 80% VO
max
Before acute exercise
After acute exercise 0.77 0.37** 2.50 0.69**
max
Before acute exercise 1.65 0.53 1.12 0.98
After acute exercise
SOD (U/ml)
Pre-training Post-training
1.27 0.32 1.24 0.58
0.84 0.37** 1.42 0.93
GPx (nmol/(min ml))
Pre-training Post-training
144.29 20.47 169.11 36.23
143.83 21.19 176.41 31.97
144.35 19.76 188.11 26.66
MDA (mmol)
Pre-training Post-training
1.96 0.75 1.92 1.25
2.84 0.57 2.06 0.77
1.89 0.80 2.14 0.61
3.73 1.51* 2.27 0.85
Telomere length (T/S ratio)
Pre-training Post-training
1.00 0.02 1.00 0.01
0.99 0.04 1.00 0.00
1.00 0.01 1.00 0.01
0.98 0.01 1.00 0.01
146.08 17.53 195.74 32.68
Values are expressed as mean S.D. Telomere length means the ratio of the telomere length per standard gene. * indicates significant difference compared to before acute exercise tests ( p < 0.05). ** indicates significant difference compared to before acute exercise tests ( p < 0.01).
258
Y.-A. Shin et al. / Mechanisms of Ageing and Development 129 (2008) 254–260
Fig. 2. The changes in MDA levels, SOD, and GPX activities after the acute exercise tests at different intensities pre- and post-exercise training. Pre means before 6 months exercise training. Post means after 6 months exercise training. * indicates significant difference before and after acute exercise tests in the preand post-exercise training conditions ( p < 0.05). ** indicates significant difference before and after acute exercise tests in pre- and post-exercise training ( p < 0.01).
traditional marker of the oxidative stress in exercise, decreased significantly after 6 months exercise training. SOD activities were significantly reduced during in the preexercise training condition immediately after acute exercise ˙ 2 max tests at both 60% (39.4%, p < 0.01) and 80% VO (49.1%, p < 0.01) and there was no noteworthy alteration ˙ 2 max (Table 4). Also, SOD activities between 60% and 80% VO after the acute exercise test in post-exercise training were ˙ 2 max higher than the pre-exercise training condition at 60% VO ( p < 0.01). The change in SOD activities is shown in Fig. 2. In the post-exercise training condition, SOD activities were significantly increased immediately after the acute exercise test ˙ 2 max (101.6%, p < 0.01). Our results indicate that at 60% VO the antioxidant defense system increased after stimulation induced by long-term exercise training. Immediately after the acute exercise test at both 60% and ˙ 2 max , GPX activates remained unchanged in the pre80% VO exercise training condition and the difference between 60% and ˙ 2 max was negligible (Table 4). However, GPX 80% VO activates after the acute exercise test in the post-exercise training condition were higher than pre-exercise training ˙ 2 max condition at both 60% ( p < 0.05) and 80% VO ( p < 0.01). Also, GPX activates in the rest after the postexercise training condition were higher than the rest levels in the pre-exercise training condition ( p < 0.05). The change in GPX activates is shown in Fig. 2. 4. Discussion The present study shows that long-term aerobic exercise training increases antioxidant defense systems and reduces the up-regulation of oxidative stress in response to acute exercise at high and moderate intensities. Furthermore, these findings suggest that oxidative stress caused by the acute exercise with high intensity may not affect telomere proliferation irrespective of long-term exercise training. Changes in oxidative stress marker response to acute exercise with exercise training are
therefore not associated with concomitant alterations in telomere length. Several previous studies have reported that MDA levels in blood increase after single bouts of exercise. These results correlated with the increases in creatine kinase and lactic dehydrogenase in plasma, markers of muscle damage (Marzatico et al., 1997; Miyazaki et al., 2001). Toskulkao and Glinsukon (1996) reported that sedentary subjects had decreased SOD and GPX activities and had increased MDA levels in blood after 70% HRmax cycle ergometer exercise. Vincent et al. (2004) also reported that lipid hydroperoxide increased following acute aerobic treadmill exercise in obese women. Our finding is in accordance with previous studies which show that antioxidant activities decrease and MDA levels increase after the acute exercise test at high intensity before exercise training. In contrast to prior findings, strenuous endurance training was shown to reduce index of oxidative stress following high intensity exercise. Growing evidence demonstrated that regular exercise training improves antioxidant status (McArdle and Jackson, 2000) and enhances repair system to recover from oxidative damage (Rada´k et al., 2003; Sato et al., 2003). There was a smaller increase in MDA levels in response to the exercise bout after, compared to before, training (Miyazaki et al., 2001). Furthermore, Urso and Clarkson (2003) reported that trained individuals showed up-regulation of SOD and GPX activities in blood at rest, and SOD activity increased in response to an acute exercise test in trained subjects. Metin et al. (2003) suggested that the increase of antioxidant activities in young male football players was due to the elevation of oxidative stress caused by regular exercise. This study showed results similar to those previously described. The improvement in the physical fitness of subjects may be related to no change in MDA and a greater increase in SOD activities after the acute exercise testing in the postexercise training condition compared to the pre-exercise training condition (Yagi, 1987). Sen (1995) also reported that regular physical exercise improved the defense system by decreasing the post-exercise oxidative tress. Furthermore, the subjects in this study were obese women and Olusi (2002) reported that BMI correlates with the systemic oxidative stress. Following 6 months aerobic exercise training, GPX activity for the exercise group increased. In contrast to the exercise group, MDA levels in control group had a tendency to increase after 6 months. These findings are very interesting because high oxidative stress such as the acute exercise with high intensity may increase reactive oxygen species (ROS), especially in obesity with lipotoxic conditions (Kim et al., 2005). In spite of these conditions, regular exercise training had beneficial effects in terms of reducing oxidative stress in our present study. The association of oxidative stress and the telomere length has recently reported that oxidative stress accelerates the rate of telomere shortening in proportion to magnitude in vitro (von Zglinicki et al., 1995, 2000). On the other hand, the reduction of oxidative stress decreases the telomere-shortening rate and delays the replicative senescence (Sitte et al., 1998). The mechanism to explain oxidative stress-induced telomere
Y.-A. Shin et al. / Mechanisms of Ageing and Development 129 (2008) 254–260
shortening is as follows: telomeres have DNA regions (G-rich sequence) which are highly sensitive to oxidative damage. This in turn accelerates telomere shortening through DNA damage and prevents efficient repair (Lansdorp, 2005). Oxidative stress also affects telomere function in several ways, including the rapid and sustained decrease in telomere reverse transcriptase activity, an acceleration of telomere attrition (Blackburn, 2001) and replication errors (Goronzy et al., 2006). With regard to this telomere feature of oxidative response, it was shown that endurance athletes with exercise-associated chronic fatigue have abnormally shorter telomeres than control athletes (Collins et al., 2003). Moreover, the damage, caused by repeated training-induced muscle injury, has increased the proliferation of satellite cells (Collins et al., 2003). Bruunsgaard et al. (1999) reported that young and elderly groups showed significantly shorter telomere length after exhaustive exercise. Unlike previous studies, our results showed that, immediately after the acute exercise test in both 60% and 80% ˙ 2 max , the telomere length did not significantly change VO before and after 6-month exercise training. These results suggest that exercise itself could not be the critical factor in the shortening of the telomere length. Radak et al. (2001) also showed that telomerase activity in rat skeletal muscle was not significantly altered by mild and strenuous exercise training. Recent study has demonstrated that obese women have 240 bp shorter telomere length than lean women, which increase the white blood cell turnover and telomere attrition each cell replication, since obesity up-regulates the oxidative stress and inflammation (Valdes et al., 2005). Even though the results in this study did not reach a statistically significant level, the rate of telomere length shortening was faster in control group than in exercise group. Previous study reported that the decrease in relative T/S values per year was 0.0052 in middle-aged women (Nordfjall et al., 2005) and a loss of 31–63 bp per year in adulthood (Iwama et al., 1998). Our study showed similar telomere attrition rate for middle-aged women with previous studies, but the rate of telomere shortening in exercise group was less than previous studies (Iwama et al., 1998; Nordfjall et al., 2005). Therefore, the findings in this study are very interesting because this study was performed strictly in obese women, which could have more inflammatory response than lean subjects. Long-term exercise training down-regulated oxidative stress and improved the state of obesity in our obese subjects. Considering these results, we suggest that exercise may improved health in middle-aged women includes a decrease of weight and oxidative stress and this experiment has the possibility to reduce the concern that exercise may affect the shortening of telomere length, which is the marker of the aging process. However, our study has small numbers of subjects (n = 16) and much more subjects should be needed for the follow up study to examine the association of the telomere length and exercise benefit. In conclusion, there are increases in the activities of the antioxidant defense system following long-term exercise training and these indicate that exercise-induced variations
259
in antioxidant enzymes may be relevant in maintaining the length of telomeres. Also, oxidative stress caused by exercise would not affect the aging process as well as the telomere length shortening. Acknowledgments This work has been granted by the Korea Research Foundation (Program of Promotion of Predominance Research and Health Science, Project 2005, KRF-2005-041-G00154). The authors are grateful to NICEM research workers (SeungYoun Yi, Jong-Sung Lim, Yeoun-Hee Kim) and Professor Bob Hickner, Jun-Ho Lee & Kyoung-Young Lee for their technical assistance and editorial support. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.mad.2008.01.001. References ACSM, 2006. ACSM’s Guidelines for Exercise Testing and Prescription, 7th edition. American College of Sports Medicine Inc./Lippincott Williams & Wilkins. Alessio, H.M., Goldfarb, A.H., 1988. Lipid peroxidation and scavenger enzymes during exercise: adaptive response to training. J. Appl. Physiol. 64 (4), 1333–1336. Ben-Porath, I., Weinberg, R.A., 2005. The signals and pathways activating cellular senescence. Int. J. Biochem. Cell Biol. 37 (5), 961–976. Blackburn, E.H., 2001. Switching and signaling at the telomere. Cell 106 (6), 661–673. Blackburn, E.H., 1991. Structure and function of telomeres. Nature 350 (6319), 569–573. Brummendorf, T.H., Ersoz, I., Hartmann, U., Bartolovic, K., Balabanov, S., Wahl, A., Paschka, P., Kreil, S., Lahaye, T., Berger, U., Gschaidmeier, H., Bokemeyer, C., Hehlmann, R., Dietz, K., Lansdorp, P.M., Kanz, L., Hochhaus, A., 2003. Telomere length in peripheral blood granulocytes reflects response to treatment with imatinib in patients with chronic myeloid leukemia. Blood 101 (1), 375–376. Bruunsgaard, H., Jensen, M.S., Schjerling, P., Halkjear-Kristensen, J., Ogawa, K., Skinhoi, P., Pedersen, B.K., 1999. Exercise induces recruitment of lymphocytes with activated phenotype and short telomeres in young and elderly humans. Life Sci. 65 (24), 2623–2633. Bruce, R.A., 1972. Multistage treadmill test of submaximal and maximal exercise. In: American Heart Association, Exercise Testing and Training of Apparently Healthy Individuals; A Handbook for Physicians. American Heart Association, New York, pp. 32–34. Cawthon, R.M., Smith, K.R., O’Brien, E., Sivatchenko, A., Kerber, R.A., 2003. Association between telomere length in blood and mortality in people aged 60 years or older. Lancet 361 (9355), 393–395. Cawthon, R.M., 2002. Telomere measurement by quantitative PCR. Nucleic Acids Res. 30 (10), e47. Collins, M., Renault, V., Grobler, L.A., St Clair Gibson, A., Lambert, M.I., Wayne, Derman, E., Butler-Browne, G.S., Noakes, T.D., Mouly, V., 2003. Athletes with exercise-associated fatigue have abnormally short muscle DNA telomeres. Med. Sci. Sports Exerc. 35 (9), 1524–1528. Counter, C.M., Avilion, A.A., LeFeuvre, C.E., Stewart, N.G., Greider, C.W., Harley, C.B., Bacchetti, S., 1992. Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J. 11 (5), 1921–1929. Epel, E.S., Blackburn, E.H., Lin, J., Dhabhar, F.S., Adler, N.E., Morrow, J.D., Cawthon, R.M., 2004. Accelerated telomere shortening in response to life stress. Proc. Natl. Acad. Sci. U.S.A. 101 (49), 17312–17315.
260
Y.-A. Shin et al. / Mechanisms of Ageing and Development 129 (2008) 254–260
Fielding, R.A., Meydani, M., 1997. Exercise, free radical generation, and aging. Aging (Milano) 9 (1–2), 12–18. Fitzpatrick, A.L., Kronmal, R.A., Gardner, J.P., Psaty, B.M., Jenny, N.S., Tracy, R.P., Walston, J., Kimura, M., Abraham, A., 2007. Leukocyte telomere length and cardiovascular disease in the cardiovascular health study. Am. J. Epidemiol. 165 (1), 14–21. Fogelhoil, M., Kijala, U., Kaprio, J., Sarna, S., 2000. Predictors of weight change in middle-aged and old men. Obes. Res. 8, 267–273. Goronzy, J.J., Fujii, H., Weyand, C.M., 2006. Telomeres, immune aging and autoimmunity. Exp. Gerontol. 41 (3), 246–251. Harley, C.B., Futcher, A.B., Greider, C.W., 1990. Telomeres shorten during ageing of human fibroblasts. Nature 345 (6274), 458–460. Harman, D., 2001. Aging: overview. Ann. N.Y. Acad. Sci. 928, 1–21. Hodes, R.J., 1999. Telomere length, aging, and somatic cell turnover. J. Exp. Med. 190 (2), 153–156. Hubner-Wozniak, E., Panczenko-Kresowka, B., Lerczak, K., Psnik, J., 1994. Effects of graded treadmill exercise on the activity of blood antioxidant enzymes, lipid peroxides and nonenzymatic anti-oxidants in long-distance skiers. Biol. Sport 11 (4), 217–226. Iwama, H., Ohyashiki, K., Ohyashiki, J.H., Hayashi, S., Yahata, N., Ando, K., Toyama, K., Hoshika, A., Takasaki, M., Mori, M., Shay, J.W., 1998. Telomeric length and telomerase activity vary with age in peripheral blood cells obtained from normal individuals. Hum. Genet. 102 (4), 397– 402. Jeanclos, E., Schork, N.J., Kyvik, K.O., Kimura, M., Skurnick, J.H., Aviv, A., 2000. Telomere length inversely correlates with pulse pressure and is highly familial. Hypertension 36 (2), 195–200. Jenkins, R.R., 1988. Free radical chemistry. Relationship to exercise. Sports Med. 5 (3), 156–170. Kawanishi, S., Oikawa, S., 2004. Mechanism of telomere shortening by oxidative stress. Ann. N.Y. Acad. Sci. 1019, 278–284. Kim, S., Sohn, I., Lee, Y.S., Lee, Y.S., 2005. Hepatic gene expression profiles are altered by geistein supplementation in mice with diet-induced obesity. J. Nutr. 135 (1), 33–41. Knight, J.A., 2000. The biochemistry of aging. Adv. Clin. Chem. 35, 1–62 Review. Lansdorp, P.M., 2005. Major cutbacks at chromosome ends. Trends Biochem. Sci. 30, 388–395. McArdle, A., Jackson, M.J., 2000. Exercise, oxidative stress and ageing. J. Anat. 197 (Pt 4), 539–541. Marzatico, F., Pansarasa, O., Bertorelli, L., Somenzini, L., Della Valle, G., 1997. Blood free radical antioxidant enzymes and lipid peroxides following longdistance and lactacidemic performances in highly trained aerobic and sprint athletes. J. Sports Med. Phys. Fitness 37 (4), 235–239. Metin, G., Atukeren, P., Alturfan, A.A., Gulyasar, T., Kaya, M., Gumustas, M.K., 2003. Lipid peroxidation, erythrocyte superoxide-dismutase activity and trace metals in young male footballers. Yonsei Med. J. 44 (6), 979–986. Miyazaki, H., Oh-Ishi, S., Ookawara, T., Kizaki, T., Toshinai, K., Ha, S., Haga, S., Ji, L.L., Ohno, H., 2001. Strenuous endurance training in humans reduces oxidative stress following exhausting exercise. Eur. J. Appl. Physiol. 84 (1–2), 1–6. Nawrot, T.S., Staessen, J.A., Gardner, J.P., Aviv, A., 2004. Telomere length and possible link to X chromosome. Lancet 363 (9408), 507–510. Niess, A.M., Hartmann, A., Gru¨nert-Fuchs, M., Poch, B., Speit, G., 1996. DNA damage after exhaustive treadmill running in trained and untrained men. Int. J. Sports Med. 17 (6), 397–403.
Nordfjall, K., Larefalk, A., Lindgren, P., Holmberg, D., Roos, G., 2005. Telomere length and heredity: indications of paternal inheritance. Proc. Natl. Acad. Sci. U.S.A. 102 (45), 16374–16378. Olusi, S.O., 2002. Obesity is an independent risk facot for plasma lipid peroxidation and depletion of erythrocyte cytoprotective enzymes in humans. Int. J. Obes. Relat. Metab. Disord. 26, 1159–1164. Rada´k, Z., Apor, P., Pucsok, J., Berkes, I., Ogonovszky, H., Pavlik, G., Nakamoto, H., Goto, S., 2003. Marathon running alters the DNA base excision repair in human skeletal muscle. Life Sci. 72 (14), 1627–1633. Radak, Z., Taylor, A.W., Sasvari, M., Ohno, H., Horkay, B., Furesz, J., Gaal, D., Kanel, T., 2001. Telomerase activity is not altered by regular strenuous exercise in skeletal muscle or by sarcoma in liver of rats. Redox Rep. 6 (2), 99–103. Saiki, S., Sato, T., Kohzuki, M., Kamimoto, M., Yosida, T., 2001. Changes in serum hypoxanthine levels by exercise in obese subjects. Metabolism 50 (6), 627–630. Santos-Silva, A., Rebelo, M.I., Castro, E.M., Belo, L., Guerra, A., Rego, C., Quintanilha, A., 2001. Leukocyte activation, erythrocyte damage, lipid profile and oxidative stress imposed by high competition physical exercise in adolescents. Clin. Chim. Acta 306 (1–2), 119–126. Sato, Y., Nagasaki, M., Kubota, M., Uno, T., Nakai, N., 2007. Clinical aspects of physical exercise for diabetes/metabolic syndrome. Diabetes Res. Clin. Pract. 77 (1), S87–S91. Sato, Y., Nanri, H., Ohta, M., Kasai, H., Ikeda, M., 2003. Increases of human MTH1 and decreases of 8-hydroxyde-oxyguanosine in leukocyte DNA by acute and chronic exercise in healthy male subjects. Biochem. Biophys. Res. 305, 333–338. Sen, C.K., 1995. Oxidants and antioxidants in exercise. J. Appl. Physiol. 79, 675–686. Sitte, N., Saretzki, G., von Zglinicki, T., 1998. Accelerated telomere shortening in fibroblasts after extended periods of confluency. Free Radic. Biol. Med. 24 (6), 885–893. Tauler, P., Gimeno, I., Aguilo´, A., Guix, M.P., Pons, A., 1999. Regulation of erythrocyte antioxidant enzyme activities in athletes during competition and short-term recovery. Pflugers Arch. 438 (6), 782–787. Toskulkao, C., Glinsukon, T., 1996. Endurance exercise and muscle damage: relationship to lipid peroxidation and scavenging enzymes in short and long distance runners. Jpn. J. Phys. Fitness Sport Med. 45, 63–70. Urso, M.L., Clarkson, P.M., 2003. Oxidative stress, exercise, and antioxidant supplementation. Toxicology 189 (1–2), 41–54. Valdes, A.M., Andrew, T., Gardner, J.P., Kimura, M., Oelsner, E., Cherkas, L.F., Aviv, A., Spector, T.D., 2005. Obesity, cigarette smoking, and telomere length in women. Lancet 366 (9486), 662–664. Vincent, H.K., Vincent, K.R., Bourguignon, C., Braith, R.W., 2005. Obesity and postexercise oxidative stress in older women. Med. Sci. Sports Exerc. 37 (2), 213–219. Vincent, H.K., Morgan, J.W., Vincent, K.R., 2004. Obesity exacerbates oxidative stress levels after acute exercise. Med. Sci. Sports Exerc. 36 (5), 772–779. von Zglinicki, T., Pilger, R., Sitte, N., 2000. Accumulation of single-strand breaks is the major cause of telomere shortening in human fibroblasts. Free Radic. Biol. Med. 28 (1), 64–74. von Zglinicki, T., Saretzki, G., Docke, W., Lotze, C., 1995. Mild hyperoxia shortens telomeres and inhibits proliferation of fibroblasts: a model for senescence? Exp. Cell Res. 220 (1), 186–193. Yagi, K., 1987. Lipid peroxides and human diseases. Chem. Phys. Lipids 45 (2–4), 337–351.