Existence of two mature sequences of cubifrin neuropeptide and their effects on spawning in the sea cucumber, Holothuria scabra

Journal Pre-proof Existence of two mature sequences of cubifrin neuropeptide and their effects on spawning in the sea cucumber, Holothuria scabra

Arada Chaiyamoon, Yotsawan Tinikul, Supakant Chaichotranunt, Tanes Poomthong, Worawit Suphamungmee, Prasert Sobhon, Ruchanok Tinikul PII:

S0044-8486(19)31810-1

DOI:

https://doi.org/10.1016/j.aquaculture.2019.734753

Reference:

AQUA 734753

To appear in:

aquaculture

Received date:

16 July 2019

Revised date:

6 November 2019

Accepted date:

17 November 2019

Please cite this article as: A. Chaiyamoon, Y. Tinikul, S. Chaichotranunt, et al., Existence of two mature sequences of cubifrin neuropeptide and their effects on spawning in the sea cucumber, Holothuria scabra, aquaculture (2018), https://doi.org/10.1016/ j.aquaculture.2019.734753

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2018 Published by Elsevier.

Pre-proof of November 6th, 2019 Chaiyamoon etJournal al_ AQUA_2019_1671R1_As

1

Existence of two mature sequences of cubifrin neuropeptide and their effects on spawning in the sea cucumber, Holothuria scabra

Arada

Chaiyamoon1,2,

Yotsawan

Tinikul1,

Supakant

Chaichotranunt4,

Tanes

Poomthong4, Worawit Suphamungmee1, Prasert Sobhon1, Ruchanok Tinikul3,*

Department of Anatomy, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok

of

1

2

ro

10400, Thailand

Department of Anatomy, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002,

Department of Biochemistry and Center for Excellence in Protein and Enzyme Technology,

re

3

-p

Thailand

Coastal Fisheries Research and Development Center, Klongwan, Prachuabkirikhan 77000,

Jo ur

Thailand

na

4

lP

Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand

*Correspondence should be addressed to:

Asst. Prof. Ruchanok Tinikul, Ph.D. Department of Biochemistry and Center for Excellence in Protein and Enzyme Technology, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand Tel: (66)2-201-5607 Fax: (66)2-354-7174 E-mail addresses: [email protected], [email protected]

Pre-proof of November 6th, 2019 Chaiyamoon etJournal al_ AQUA_2019_1671R1_As

2

Abstract NG-related neuropeptide is a myoactive neuropeptide identified in deuterostome invertebrates. Recent studies indicated that in sea cucumbers NG-related neuropeptide can stimulate muscle contraction and is involved in reproduction, including oocyte maturation and gamete spawning. In the present study, we first characterized the NG-related neuropeptide precursor, named cubifrin in Holothuria scabra and further investigated its effect on spawning. The deduced amino acid sequence of the neuropeptide precursor transcript provided five copies

of

of two different mature sequences and were designated as cubifrin-Y and cubifrin-F based on

ro

C-terminal amino acid sequences of NGIWYamide and NGIWFamide. Interestingly,

-p

physiological bioassay demonstrated that the newly identified cubifrin-F was more potent in

re

stimulating spawning with about 70% success rate, than cubifrin-Y that could stimulate only 10% spawning, compared with the control group. The in situ hybridization showed intense

lP

expression of cubifrin transcript within the wall of the ovarian tubule at late ovarian stages,

na

suggesting that cubifrin was produced locally and stimulated spawning by causing contraction of the wall of ovarian tubule. Taken together, gained knowledge provided important insight

Jo ur

into spawning mechanisms which could be applied by using these cubifrin amides to stimulate spawning of broodstocks for seed and larval productions in aquaculture of this sea cucumber species.

Keywords: NG-related neuropeptide; cubifrin; spawning; sea cucumber; Holothuria scabra

Pre-proof of November 6th, 2019 Chaiyamoon etJournal al_ AQUA_2019_1671R1_As

3

1. Introduction Because of its high nutritional and medicinal properties, the white sea cucumber, Holothuria scabra, is one of a premium economic marine species for domestic consumption and export in Asian countries, including China, Japan, ASEAN and Thailand (Bordbar et al., 2011). The H. scabra are found in shallow sea water along the coastlines of tropical IndoPacific region, and are harvested from their natural habitat mostly for their body walls that are processed into dried products called beche-de-mer, and the products are sold widely in Asian

of

as well as some European markets (Bordbar et al., 2011; Uthicke et al., 2010). Because of high

ro

demand the wild population is vulnerable to over exploitation and their number has been

-p

reduced considerably in the past few years, hence their culture must be promoted to satisfy the

re

demand. Aquaculture of this species is limited by low production of gametes and larvae due to asynchronized spawnings of the male and female broodstocks in captivity, and poor

lP

understanding of the neuroendocrine controls of the gonad maturation, gamete formation and

na

spawning which are critical to the success of increased productions of seeds and larvae. The nervous and reproductive tissues in invertebrates produce and release many

Jo ur

hormonal substances that control gonad maturation, gamete production and spawning (Benzie 1998; Nagaraju, 2011; Tinikul et al., 2016, 2017; Alfaro-Montoya et al., 2019). In sea cucumbers the nervous system is composed of five radial nerve cords running along the body length and the nerve ring surrounding the mouth (Mashanov et al., 2006; 2009; Chaiyamoon et al., 2018). Transcriptomic analyses of nervous system in echinoderms have identified and elucidated many groups of putative neuropeptide (NP) genes. About 40 putative NP genes were identified in starfish A. rubens (Semmens and Elphick, 2017), while 17 and 20 putative NP genes were reported in the sea cucumber, A. japonicus (Rowe et al., 2004; 2014) and sea urchin, S. purpuratus (Rowe and Elphick, 2012), respectively. Recently, our research group has found 26 putative NP genes in H. scabra transcriptomes (Suwansa-Ard et al., 2018). The predicted

Pre-proof of November 6th, 2019 Chaiyamoon etJournal al_ AQUA_2019_1671R1_As

4

putative NP library has provided the basis for our further identification of novel NPs in H. scabra. Neuropeptide NGIWYamide was originally isolated from radial nerve cord and nerve ring of Japanese sea cucumber, Apostichopus japonicas (Inoue et al., 1999; Kato et al., 2009). NGIWYamide is a myoactive NP related to NG-peptide found in vertebrates (Elphick MR 2010; Semmens DC et al., 2013). It has been reported to induce contraction of body wall and intestinal muscles of the sea cucumber A. japonicus (Inoue et al., 1999; Ohtani et al., 1999),

of

and to stimulate tube feet mobility in star fish, Asterina pectinifera (Saha et al., 2006). The

ro

related NG-peptide, NGFFFamide identified in the sea urchin, Strongylocentrotus purpuratus

-p

also functioned in contraction of tube feet and esophagus (Elphick and Rowe, 2009). Analysis

re

of the transcripts from Gene Bank database also found NGFFYamide in Asterias rubens and Ophionotus victoriae (Semmens et al., 2015). The immunolocalization using antibody raised

lP

against NGIWYamide, detected its presence in various tissues, including radial nerve code,

na

nerve ring, intestinal nerve, body wall muscle; in physiological testing this NP regulated muscle contraction (Inoue et al., 1999). Other reports on physiological testing of NGIWYamide also

Jo ur

showed that this NP could also stimulate oocyte maturation and gamete spawning (Kato et al., 2009; Fujiwara et al., 2010). As a resulting of causing head waving behavior in sea cucumber after its administration, this NP was named cubifrin (Kato et al., 2009). Interestingly, effective doses of NGIWYamide that could stimulate spawning were much lower than those that caused muscle contraction. The receptor of NG-related peptide has recently identified in sea urchin, S. purpuratus as an orthologue of vertebrate neuropeptide-S (NPS) and crustacean cardioactive peptide (CCAP) receptors and NGFFFamide was confirmed to be its cognate ligand (Semmens et al., 2015). The receptor was found to exerts their function in Ca2+ activation responding to NG-peptide with dose- and sequence-dependent manners. The receptors of VP/OT superfamily peptides belong to a G protein-coupled receptor superfamily and have been shown to manifest

Pre-proof of November 6th, 2019 Chaiyamoon etJournal al_ AQUA_2019_1671R1_As

5

their function through an increasing of intracellular calcium ion or inducing the cAMP production (Gimpl and Fahrenholz, 2001; Kawada et al., 2008). In the present study, we identified and characterized the cubifrin NP precursor in H. scabra. From this precursor, two mature sequences with different C-terminal sequences of NGIWYamide and NGIWFamide were found and designated as cubifrin-Y and -F. In functional bioassay, we demonstrated that cubifrin-F had higher potency in stimulating spawning than cubifrin-Y. In addition, using in situ hybridization, we found expression of

of

cubifrin gene in the wall of ovarian tubules which together constituted the ovary of H. scabra.

ro

Hence, we suggested that these NP stimulated the contraction of ovarian tubular wall to result

-p

in spawning of the gametes. This knowledge could be applied in the seed and larval production

lP

2. Materials and methods

re

for commercial-scale aquaculture of this species.

na

2.1. Experimental animals and tissue collections Adult female sea cucumbers, H. scabra, with 250 ± 55 g body weight, were obtained

Jo ur

from Coastal Fisheries Research and Development Center, Prachuap Khiri Khan Province, Thailand. Female sea cucumbers were kept in concrete tanks (1×10×10 meter) containing circulating seawater at 25-26˚C, and the seawater was changed every week. They were fed once daily with seaweed and shrimp feed. The nervous system (radial nerve cord and nerve ring) and gonadal tissues were collected and kept at -80ºC for RNA extraction. Experiments involving these animals were performed carefully according to the standards for animal care as prescribed by Faculty of Science, Mahidol University.

Pre-proof of November 6th, 2019 Chaiyamoon etJournal al_ AQUA_2019_1671R1_As

6

2.2. RNA extraction and first strand cDNA synthesis Total RNA from the pooled tissues of radial nerve cords, nerve rings and gonads was isolated using TriPure isolation reagent (Roche, IN, USA) by following the manufacturer's protocol. The tissues were homogenized in ice cold Tripure reagent to disrupt cells and denature endogenous nucleases. The suspension was then incubated for 5 min at room temperature (RT), before being centrifuged at 12,000 rpm, 4°C, for 10 min. The supernatant was collected and then 0.2 ml of chloroform per 1 ml of Tripure reagent was added with gentle

of

flip-flop for 15 sec. The solution was further incubated at RT for 3 min, and centrifuged at

ro

12,000 rpm 4°C for 15 min. The aqueous phase containing RNA was collected in new sterile

-p

tube. A 0.5 ml of isopropanol was added to precipitate RNA and incubated at -80°C for 15 min

re

to enhance the yield of RNA precipitation. Then, the suspension was centrifuged at 12,000 rpm, 4°C, for 10 min. The RNA pellet was washed with 75% EtOH and absolute ethanol in

lP

DEPC-treated water (diethylpyrocarbonate-treated; 1 ml DEPC in 1000 ml H2O) and followed

na

by centrifugation at 12,000 rpm, 4°C, for 10 min. The pellet was dried by lamina flow and dissolved in DEPC-treated water. The quality and concentration of total RNA were determined

Jo ur

by 1% w/v agarose gel electrophoresis and were checked by spectrophotometry (NanoDrop 1000; Thermo Fisher Scientific, DE, USA). The first strand cDNA synthesis was carried out by following the manufacturer’s protocols (Fermentus, Lithuania). Briefly, the reaction mixture was prepared (1μg of total RNA, 1 µl of DNase-I, 1 µl of 10x reaction buffer, and DEPC-treated water up to 10 µl) and incubated at 37ºC for 30 min. A 1 µl of 50 mM EDTA was added and then incubated at 65 ºC for 10 min. The first strand cDNA synthesis was performed by using Revert Aid Reverse Transcriptase (Fermentas, Lithuania) and SMART primer (SMIII+) from SMART cDNA Library Construction Kit (Clone Tech, USA), and was used as templates for cDNA amplification in PCR experiments. The reaction consisted of 10 µl of RNA template, 4 µl of

Pre-proof of November 6th, 2019 Chaiyamoon etJournal al_ AQUA_2019_1671R1_As

7

5x reaction buffer, 2 µl SMIII+ primer, 2 µl of 10 mM dNTP mix, 1 µl of 200 units reverse transcriptase, and 1 µl of DEPC-treated water.

2.3. Cloning cDNA of preprocubifrin gene and sequence analysis Specific primers of prepro-cubifrin gene (forward primer of ATGGCG GTGGAAGCTAGGATTGTTTTC

and

reverse

primer

of

CTACATCACCTCATC

CGCAACACT TG) were designed based on the sequence obtained from our transcriptomic

of

data (Suwansa-ard et al., 2018). The amplified PCR fragments were cloned into TA cloning kit

ro

pGEMT easy® (Promega, USA). The reaction mixture was prepared as follows: 5 µl of 2x

-p

rapid ligation buffer, 1 µl of pGEMT vector, 1 µl of T4 DNA ligase, and 3 µl of the purified

re

PCR product. The reaction was mixed gently and incubated at 4ºC overnight. Recombinant plasmid containing inserted gene was then stored at -20ºC until used for transformation into

lP

bacterial cells. Transformation process was performed in competent E. coli cells, strain XL1

na

(Blue), by CaCl2/heat shock method and bacterial cells harboring recombinant plasmids were selected by blue/white colony selection. The plasmid DNA containing the gene of interest was

Jo ur

isolated from E. coli using GeneJET Plasmid Miniprep kit (Fermentas, Lithuania). Lastly, cDNA was analyzed by Macrogen Inc., Korea, to obtain nucleotide sequences.

2.4. Gene and protein analyses and prediction of mature hscubifrin Nucleotide sequences were translated to amino acids by ExpaSy translate tool (http://web.expasy.org/translate/). Deduced-amino acid sequence of NP cubifrin was compared with other species using sequence alignment ClustalOmega (https://www.ebi.ac.uk/ Tools/msa/clustalo/). Prediction of signal peptide was performed using the SignalP 4.1 program, http://www.cbs.-dtu.dk/services/SignalP/. Post translational modifications were

Pre-proof of November 6th, 2019 Chaiyamoon etJournal al_ AQUA_2019_1671R1_As predicted

using

NeuroPred

application

(http://neuroproteomics.

8

scs.illinois.edu/cgi-

bin/neuropred.py) depending on homology to other known peptides.

2.5. Expression and distribution of preprocubifrin transcript by in situ hybridization A pGEM plasmid containing cubifrin gene was used as a template for cubifrin gene amplification using M13 forward (5´-GTAAAACGACGGCCAGT-3´) and M13 reverse (5´AACAGCTATGACCATG-3´) primers. The PCR product was purified using QIA quick PCR

of

Purification kit (Qiagen, Hilden, Germany). Riboprobe was then synthesized by DIG RNA

ro

labeling kit (Roche Applied Science, Mannheim, Germany). The reaction was composed of

-p

purified PCR product of cubifrin gene (150 ng) as a template, 2 μl of 10x concentrated DIG

re

RNA labeling mix, 2 µl of 10x Transcription buffer, 2 µl of T7 or SP6 RNA polymerase (for antisense and sense riboprobe syntheses) and RNase-free water up to 20 μl at 37˚C, for 2 h.

lP

The reaction was stopped by adding 2 µl of DNase-I following the manufacturer’s protocol

na

(Roche, Germany) to remove the DNA template at 37ºC, for 15 min and then followed by 1 µl of 0.5 M EDTA at -20˚C, overnight. The riboprobe was precipitated by adding 2.5 µl of 4 M

Jo ur

LiCl EtOH, washed with EtOH by centrifugation at 4˚C, for 15 min. Finally, the dried pellet was dissolved with DEPC-treated water and stored at -80˚C until used. The nervous tissues and gonads were fixed by 4% paraformaldehyde in 0.1M PBS pH 7.4, then embedded in paraffin blocks and sectioned at

5-6 µm thickness. The tissues

were mounted onto saline-coated slides. Deparafinization of the sections was carried out by immersing them in fresh xylene solution and decreasing concentrations of ethanol. The sections were washed two times in 0.1 M DEPC-treated PBS (15 min each) before post-fixed with DEPC-treated PBS containing 0.4% paraformaldehyde solution at 4oC for 30 min, and washed three times with 0.1 DEPC-treated PBS containing 0.3% Tween-20 (15 min each). The sections were then incubated with prehybridization solution (50% formamide in 5X SSC solution; 0.1%

Pre-proof of November 6th, 2019 Chaiyamoon etJournal al_ AQUA_2019_1671R1_As

9

Tween-20, pH 6.0, 40 µg/ml salmon sperm DNA, 500 µg/ml RNase-free tRNA) to prevent non-specific binding at 37 ºC for 10 min. After removing the buffer, the sections were incubated with hybridization buffer (40% formamide, 10% dextran sulfate, 1x Denhardt’s solution, 4x SSC, 10 mM DTT, 1 mg/ml RNase-free tRNA, 1 mg/ml sheared salmon sperm DNA) containing 10 ng sense or anti-sense DIG-labeled riboprobe and incubated at 42oC overnight in a humid chamber. The sections were then washed with 4XSSC at 55 ºC, 2XSSC at 55 ºC, 2XSSC containing 0.1% Tween-20 at room temperature (15 min each), respectively,

of

followed by maleic acid buffer (MAB, 0.1 M maleic acid and 0.15 M NaCl, pH 7.5) at 37 ºC,

ro

for 15 min.

-p

In detection steps, the sections were incubated with blocking buffer (2% v/v sheep

re

serum and 2 mg/ml bovine serum albumin in MAB) at 37 ºC for 3 h. Subsequently, the sections were incubated with anti-Digoxigenin-alkaline phosphatase-conjugated antibody (Roche,

lP

Germany) at 1:5000 dilution in blocking buffer at 4 ºC overnight. After being washed in buffer

na

(100 mM Tris-HCl, 150 mM NaCl, pH 7.5), the color development was conducted by incubation in NBT/BCIP alkaline phosphatase substrate solution (Roche, Germany). When the

Jo ur

color was optimal, the reaction was stopped by adding stop buffer (10 mM Tris-HCl, 1 mM EDTA 0.2 in DEPC-treated water pH 8.1) for 15 min. Finally, the sections were dehydrated with serial alcohol before mounting with Permount (Bio-Optica, Milan, Italy), viewed and photographed under a Nikon ECLIPSE E600 light microscope.

2.6. Effects of cubifrin on gamete spawning Effects of the NP were investigated by using in vivo bioassays. From amino acid sequence analysis, two forms of cubifrin were identified and used in functional assays on spawning. Both cubifrin-Y and cubifrin-F were custom synthesized by Genescript (NJ, USA) and dissolved in the 0.9% normal saline solution. The sea cucumbers were divided into three

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

10

experimental groups: cubifrin-Y- injected group (n = 39), cubifrin-F- injected group (n = 39), and control group (n = 19). In each experimental group, the mature sea cucumbers were injected with each cubifrin at the dose of 6.5 ng/g BW into the body cavity. Animals in control group were injected with 0.9% normal saline solution. All sea cucumbers were injected by using a 23 gauge needle into the body cavity through the region on the ventral surface. Subsequently, the injected sea cucumbers were kept individually in a round plastic vessel each with 10 liters of sea water to observe spawning for 48 h. The numbers of spawned animals and spawning time

ro

of

were recorded before they were transferred to the culture tanks.

-p

3. Results

re

3.1. Nucleotide sequence of cubifrin gene and active peptides The transcript encoding the NP precursor of cubifrins was identified from

lP

transcriptomic data retrieved from radial nerve cord and gonadal tissue of H. scabra (Suwansa-

na

ard et al., 2018). The gene was cloned by RT-PCR to confirm the DNA sequence. The putative transcript included 42 bp and 461 bp of 5’ and 3’ untranslated regions (UTR), respectively.

Jo ur

The deduced amino acid sequence from the open reading frame (ORF) comprised 229 amino acids with a predicted N-terminus of 24 amino acid signal peptide sequence. The hormone precursor sequence, predicted with the Neuropred program (Suwansa-Ard et al., 2018) includes multiple dibasic cleavage sites and five mature neuropeptide sequences, including four copies of NGIWYamide sequence (hscubifrin-Y) and a single copy of NGIWFamide sequence (hscubifrin-F). Details of nucleotide, deduced amino acid and predicted mature sequences of the NP precursor of cubifrins are shown in Fig. 1. Overall dibasic cleavage sites and rearrangement of mature sequence in the precursor sequence resemble the reported sequence of A. japonicas (Fig. 2), in which the NP precursor could give raise to five copies of mature NGIWYamide

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

11

sequences (Kato et al., 2009). However, the existence of two mature sequences (hscubifrin-Y and hscubifrin-F) in the same gene is distinctive of H. scabra and this is in contrast to previous reports of echinoderm cubifrin.

3.2. The effects of cubifrins on H. scabra gamete spawning Previously, cubifrins had been shown to have a stimulatory effect on oocyte maturation and gamete spawning in A. japonicas sea cucumber (Kato et al., 2009; Fujiwara et al., 2010).

of

Therefore, spawning stimulation by hscubifrins was investigated in H. scraba. As there are two

ro

mature sequences of the NP with the last position of amino acid changed from tyrosine

-p

(NGIWYamide) to phenylalanine (NGIWFamide), the question is which one is more effective

re

in stimulation of spawning. The effects of cubifrins on spawning were investigated by observing the number of spawned wild-caught sea cucumbers after peptide administration. In

lP

the control group, the animals did not spawn following the injection by normal saline, whereas

na

cubifrin-injected groups showed spawning by both males and females. Cubifrin-Y-injected sea cucumbers exhibited spawning at 10.26%, and all animals that spawned were males. Cubifrin-

Jo ur

F injected group showed about 69.23% spawning with approximately half of them males and the other half females (Fig. 3). These results clearly indicated that the percentages of spawned sea cucumbers in both injected groups were significantly higher than the control group and the cubifrin-F exhibited more potent effect on spawning stimulation.

3.3. Investigation of spawning behaviors after administration of cubifrins The behaviors of H. scarba after cubifrin administration were observed after hormonal injection. The gamete shedding in the cubifrin Y-injected group started at about 16 h, while in the cubifrin F-injected group the shedding began at 31 h. The reproductive behaviors before gamete shedding depend on sex and typically included: (1) climbing up the wall of the tank;

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

12

(2) raising up and waving of the head in circular or side to side motion; (3) shedding gametes from the gonadal duct through gonopores in the head region. However, most females did not show waving of the heads and the two sexes completely shedded the gametes within 2 h after spawning began (Fig. 4). 3.4. Expression of cubifrin precursor transcript by in situ hybridization Cubifrin NPs could stimulate the spawning as demonstrated by the previous experiments. We then investigated the expression of cubifrin precursor gene in an ovary using

of

in situ hybridization (ISH) to see whether the peptides are produced locally to affect spawning

ro

process. Light micrograph of hematoxylin and eosin (H & E) staining section shows that of

-p

late stage of ovary (Fig. 5A and 5B) is composed of multiple tubules. Each ovarian tubule is

re

surround by a wall comprising three layers: the outer epithelium (Oep), the middle layer of muscle (M) plus connective tissue, and the inner epithelium (Iep). The tubular lumen contains

lP

vitellogenic oocytes (Oc3) with spherical shape, and mature oocytes (Oc4) with yolk and

na

cytoplasmic granules. The nuclei of these late stage oocytes appear light blue with darker nucleoli. The cytoplasm of these cells is highly eosinophilic with red color, and the outer region

Jo ur

of Oc4 is covered by a thick jelly coat (Fig. 5B). When the expression of hscubifrin transcripts was investigated in the late ovarian stages, the expression of hscubifrin mRNA transcripts was detected at highest intensity in the inner epithelium of the ovarian tubular wall (Fig. 5C-E). No staining was detected in any tissues when stained with a sense riboprobe (negative control) (Fig. 5F).

4. Discussion In the present study, we are the first to report on the cubifrin NP precursor in H. scabra, that was very distinctive from the previously reported cubifrin precursors and related NPs in other echinoderms (Elphick, 2012; Semmens et al., 2013; 2015). The transcript of hscubifrin

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

13

precursor was cloned and its sequence was consistent with what appears in our transcriptomic data (Suwansa-ard et al., 2018). As cubifrin belongs to NG peptide family (Semmens et al., 2015), the sequence of the hscubifrin precursor was analyzed and compared with sequences of NG peptide precursors that were previously reported in other echinoderms (Iwakoshi et al., 1995; Ohtani et al., 1999; Elphick, 2012; Semmens et al., 2015). The sequence of the hscubifrin precursor was similar to the cubifrin precursor from A. japonicas, as there are five copies of mature NPs placing at C-terminal part, and there is a lack of conserved C-terminal neurophysin

of

domain (Semmens et al., 2015). The neurophysin domain is rich in conserved cysteine residues

ro

that are generally placed at C-terminus of the NG peptide precursor sequences (Elphick and

-p

Rowe, 2009). The presence of neurophysin-like sequence suggests an evolutionary association

re

of NG-peptides with vasopressin/oxytocin-like NPs in chordates (Elphick and Rowe, 2009; Semmens et al., 2013). The sea cucumber cubifrin precursors from both H. scabra and A.

lP

japonicas were different from other NG peptide precursors identified in sea urchin and star

na

fish, as all of the latter sequences contain a neurophysin-like domain. The absence of a neurophysin-like domain in sea cucumber cubifrin precursors suggests another evolutionary

Jo ur

diversion of this NP in Echinodermata. Although the sequence of hscubifrin is very similar to the A. jarponicus cubifrin, only one out of five NP copies was NGIWFamide containing different C-terminus amino acid sequence by changing from tyrosine to phenylalanine, while all five active sequences of A. jarponicus are NGIWYamide (Fujiwara et al., 2010; Kato et al., 2009). In addition, only one mature sequence of cubifrin was identified in other echinoderms. For example, only two copies of the same mature sequence of NGFFFamide and NGFFYamide were found in the sea urchin, S. purpuratus and star fish (Asterias rubens), respectively (Elphick and Rowe, 2009). Likewise, a putative transcript in transcriptome of Ophionotus victoriae (Class Ophiuroidea) revealed only one copy of each NGFFFamide and NGFFYamide (Semmens et al., 2015). The hscubifrin NP precursor gave rise to two mature sequences of

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

14

mature sequences designated as cubifrin-Y (NGIWYamide) and cubifrin-F (NGIWFamide) based on the amino acid at C-terminus. This is the first time that the two mature sequences of cubifrins have been found in the same gene identified in this sea cucumber. The effects of hscubifrin-F and -Y on spawning have been demonstrated in H. scarba (Fig. 3) and hscubifrin-F showed higher potency than hscubifrin-Y at about 70 % to 10 %, respectively, while none of the control animals injected with normal saline showed spawning. This is consistent with the previous functional bioassay, which showed that cubifrin

of

NGIWYamide could stimulate spawning in A. japonicas (Kato et al., 2009; Fujiwara et al.,

ro

2010). The NGIWYamide and NGFFFamide were identified as myoactive NPs in Phylum

-p

Echinodermata (Iwakoshi et al., 1995; Ohtani et al., 1999). These neuropepetides have been

re

shown to cause contraction of sea urchin tube feet and oesophagus (Elphick and Rowe, 2009), star fish tube foot, and sea cucumber body wall muscle (Inoue et al., 1999; Saha et al., 2006)

lP

which were dose-dependent. As these myoactive NPs trigger muscle contraction via receptor

na

activation, their potency may be attributed to the changing of C-terminal amino acid from tyrosine (with hydroxyl group) to phenylalanine (without hydroxyl group) that may alter its

Jo ur

affinity, and consequently affecting their potencies. The NGFFFamide was previously reported to be a cognate ligand to NPS/CCAP-type receptor identified in S. purpuratus, which belongs to G protein-coupled receptor (Semmens et al., 2015). The receptor activation was tested with different NG-peptide sequences and results showed that the different NP sequences provided different activation potencies. The NGFFFamide had 10-fold higher stimulation potency compared to the NGFFYamide (Semmens et al., 2015), suggesting OH group in NG-peptide was important for activation of the identified NPS/CCAP-type receptor. Recently, there was report by Chieu and coworker (2019) that the relaxin-like gonad-stimulating peptide (RGP) identified in H. scabra was also able to stimulate spawning in sea cucumber. The recombinant RGP was produced in Pichia pastoris and had high potent in inducing in vitro germinal vesicle

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

15

breakdown and spawning. The injection of sea cucumber with purified RGP displayed head waving behavior followed by spawning as observed in cubifrin case. However, mechanism and receptor responsible for the RGP action remains unknown (Chieu et al., 2019). The expression of cubifrin transcript at inner epithelium of the wall of ovarian tubules of late stage ovary demonstrated specific site of production and action of this spawning inducer. In the sea cucumber A. japonicus, the immunoreacivity of NGIWYamide has been detected in the radial nerve cord and the body wall dermis, indicating that this NP is involved in muscle

of

contraction (Inoue et al., 1999). Our finding of cubifrin transcript in the wall of ovarian tubules

ro

supported the notion that it stimulated the contraction of smooth muscle cells in the tubules’

-p

wall which helped to squeeze late oocytes into the gonoduct during spawning. After injecting

re

NGIWFamide into the body cavity, mature H. scabra showed progression of reproductive behaviors, including wall-climbing, head waving, followed by gamete shedding. The same

lP

sequential reproductive behaviors were also observed after injection of cubifrin NGIWYamide

na

into sea cucumbers A. japonicus (Fujiwara et al., 2010). Similarly, a number of previous reports have also shown the raising and head-waving behaviors during gamete shedding in various

Jo ur

species of sea cucumbers, such as A. mauritiana, A. japonicus, H. fuscogilva after being treated with cubifrin (Al Rashdi et al., 2012; Fujiwara et al., 2010; Battaglene et al., 2002; Morgan, 2000). In A. japonicus, NGIWYamide caused not only contraction of the ovarian-based muscle that resulted in spawning, but also muscular activity and movement of the tentatcles and intestine (Inoue et al., 1999). Interestingly, the perivisceral coelomic fluid collected after spawning acts as inductive substance of spawning by other mature tropical hulothurians, with a time course similar to the induction of spawing by cubifrin injection, suggesting that a substance that induces spawning is secreted into the body cavity before spawning (Mercier and Hamel, 2002). In A. japonicus, spawning period occurred after treatment with cubifrin for about 11-day intervals and it was shown that the cubifrin was capable of being used to significantly

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

16

induce spawning in both males and females at very low doses, this peptide is easily prepared by chemical synthesis (Fujiwara et al., 2010), hence it could have practical use in farming situation. In our study, we found that both males and females could be stimulated to spawn with cubifrin-F, and this NP promoted faster spawning behavior in males than in females. Taken together, the induction of spawning by using cubifrin-F in H. scabra is an effective and easy method that could be used to replace the induction of spawning by temperature shock which was reported to have 35% success rate (Battaglene et al., 2002) and spawning by

of

spirulina with only 5% success rate compared to cubifrin-F-induced spawning about 70%

ro

success rate.

-p

In conclusion, the cubifrin precursor transcript in H. scarba was cloned and

re

characterized. This NP precursor provided two mature sequences comprising four copies of NGIWYamide and one copy of NGIWFamide designated as cubifrin-Y and -F, respectively.

lP

The bioassay on spawning induction demonstrated higher potency of cubifrin-F over cubifrin-

na

Y. The finding of cubifrin transcript along the inner epithelium of the walls of ovarian tubules

Jo ur

of mature ovary implicates the site of production and action of this NP in spawning activation.

Acknowledgements

This research was financially supported by a grant from Agricultural Research Development Agency (Public Organization), and Faculty of Science, Mahidol University to RT and YT, the Research Assistantship scholarships (2016, graduate Mahidol University to AC, and National Research Council of Thailand (NRCT) scholarships (2017) to AC. We are grateful to Dr. Saowaros Suwansa-ard for providing useful suggestions. We thank the Center of Nanoimaging (CNI) and the Central Instrument Facility (CIF), Faculty of Science, Mahidol University for technical assistance.

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

17

References Al Rashdi, K.M., Eeckhaut, I., Claereboudt, M., 2012. A manual on hatchery of sea cucumber Holothuria scabra in the sultanate of Oman. Ministry of Agriculture and Fisheries Wealth. Aquaculture Centre, Muscat, Sultanate of Oman. 2012. Alfaro-Montoya, J., Braga, A., Umaña-Castro, R., 2019. Research frontiers in penaeid shrimp reproduction: Future trends to improve commercial production. Aquaculture 503, 70-87.

of

Battaglene, S.C., Seymour, J.E., Ramofafia, C., Lane, I., 2002. Spawning induction of three

ro

tropical sea cucumbers, Holothuria scabra, H. fuscogilva and Actinopyga mauritiana. Aquaculture 207, 29-47.

-p

Benzie, J.A.H., 1998. Penaeid genetics and biotechnology. Aquaculture 164, 23-47.

re

Bordbar, S., Anwar, F., Saari, N., 2011. High-value components and bioactives from sea

lP

cucumbers for functional foods. Mar Drugs. 9, 1761-1805. Chaiyamoon, A., Tinikul, R., Chaichotranunt, S., Poomthong, T., Suphamungmee, W.,

na

Sobhon, P., Tinikul, Y., 2018. Distribution and dynamic expression of serotonin and

Jo ur

dopamine in the nervous system and ovary of Holothuria scabra during ovarian maturation. J Comp Physiol A Neuroethol Sens Neural Behav Physiol. 204, 391-407. Chieu1, H.D., Turner, L., Smith, M.K., Wang, T., Nocillado, J., Palma, P., Suwansa-ard, S., Elizur, A., Cummins, C.F., 2019. Aquaculture breeding enhancement: maturation and spawning in sea cucumbers using a recombinant relaxin-like gonad-stimulating peptide. Frontiers in Genetics. 10, 1-14. Elphick, M.R., 2010. NG peptides: a novel family of neurophysin-associated neuropeptides. Gene 458, 20-26. Elphick, M.R., Rowe, M.L., 2009. NGFFFamide and echinotocin: structurally unrelated myoactive neuropeptides derived from neurophysin-containing precursors in sea urchins. J. Exp. Biol. 212, 1067-1077.

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

18

Elphick, M.R., 2012. The protein precursors of peptides that affect the mechanics of connective tissue and/or muscle in the echinoderm Apostichopus japonicus. PLoS ONE 7, e44492. Fujiwara, A., Yamano, K., Ohno, K., Yoshikuni, M., 2010. Spawning induced by cubifrin in the Japanese common sea cucumber Apostichopus japonicus. Fish Sci. 76, 795-801. Gimpl, G., Fahrenholz, F., 2001. The oxytocin receptor system: structure, function, and regulation. Physiol. Rev. 81,629-683. Inoue, M., Birenheide, R., Koizumi, O., Kobayakawa, Y., Muneoka, Y., Motokawa, T., 1999.

of

Localization of the neuropeptide NGIWYamide in the holothurian nervous system and

ro

its effects on muscular contraction. Proc. Biol. Sci. 266, 993-993.

-p

Iwakoshi, E., Ohtani, M., Takahashi, T., Muneoka, Y., Ikeda, T., Fujita, T., Minakata, H.,

re

Nomoto, K., 1995. Comparative aspects of structure and action of bioactive peptides isolated from the sea cucumber Stichopus japonicus. In Peptide Chemistry (ed. M. Ohno),

lP

pp. 261-264.

na

Kato, S., Tsurumaru, S., Taga, M., Yamane, T., Shibata, Y., Ohno, K., Fujiwara, A., Yamano, K., Yoshikuni, M., 2009. Neuronal peptides induce oocyte maturation and gamete

Jo ur

spawning of sea cucumber, Apostichopus japonicus. Dev. Biol. 326, 169-176. Katow, H., Katow, T., Moriyama, A., 2009. Gonad-stimulating substance-like molecule from the radial nerve of the sea cucumber. Int J Dev Biol. 53, 483-491. Kawada, T., Sekiguchi, T., Itoh, Y., Ogasawara, M., Satake, H., 2008. Characterization of a novel vasopressin/oxytocin superfamily peptide and its receptor from an ascidian, Ciona intestinalis. Peptides. 29, 1672-1678. Mashanov, V.S., Zueva, O.R., Heinzeller, T., Aschauer, B., Naumann, W.W., Grondona, J.M., Cifuentes, M., Garcia-Arraras, J.E., 2009. The central nervous system of sea cucumbers (Echinodermata: Holothuroidea) shows positive immunostaining for a chordate glial secretion. Front Zool. 6, 11.

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

19

Mashanov, V.S., Zueva, O.R., Heinzeller, T., Dolmatov, I.Y., 2006. Ultrastructure of the circumoral nerve ring and the radial nerve cords in holothurians (Echinodermata). Zoomorphology 125, 27-38. Mercier, A., Hamel, J-F., 2002. Perivisceral coelomic fluid as a mediator of spawning induction in tropical holothurians. Invertebr Reprod Dev. 41, 223-234. Morgan, A.D., 2000. Aspects of the reproductive cycle of the sea cucumber Holothuria scabra (Echinodermata: Holothuroidea). Bull. Mar. Sci. 66, 47-57.

of

Nagaraju, G.P., 2011. Reproductive regulators in decapod crustaceans: an overview. J. Exp.

ro

Biol. 214, 3–16.

-p

Ohtani, M., Iwakoshi, E., Muneoka, Y., Minakata, H. and Nomoto, K., 1999. Isolation and

re

characterisation of bioactive peptides from the sea cucumber, Stichopus japonicus. In Peptide Science: Present and Future (ed. Y. Shimonishi), pp. 419-420. Dordrecht, The

lP

Netherlands: Kluwer Academic Publishers.

na

Rowe, M.L., Achhala, S., Elphick, M.R., 2014. Neuropeptides and polypeptide hormones in echinoderms: new insights from analysis of the transcriptome of the sea cucumber

Jo ur

Apostichopus japonicus. Gen Comp Endocrinol. 197, 43-55. Rowe, M.L., Elphick, M.R., 2012. The neuropeptide transcriptome of a model echinoderm, the sea urchin Strongylocentrotus purpuratus. Gen Comp Endocrinol 179, 331-344. Saha, A. K., Tamori, M., Inoue, M., Nakajima, Y. and Motokawa, T., 2006. NGIWYamideinduced contraction of tube feet and distribution of NGIWYamide-like immunoreactivity in nerves of the starfish Asterina pectinifera. Zool. Sci. 23, 627-632. Semmens, D.C., Beets, I., Rowe, M.L., Blowes, L.M., Oliveri, P., Elphick, M.R., 2015. Discovery of sea urchin NGFFFamide receptor unites a bilaterian neuropeptide family. Open Biol. 5, 150030.

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

20

Semmens, D.C., Dane, R.E., Pancholi, M.R., Slade, S.E., Scrivens, J.H., Elphick, M.R., 2013. Discovery of a novel neurophysin-associated neuropeptide that triggers cardiac stomach contraction and retraction in star fish. J. Exp. Biol. 216, 4047-4053. Semmens, D.C., Elphick, M.R., 2017. The evolution of neuropeptide signalling: insights from echinoderms. Brief Funct Genomics. 16, 288-298. Suwansa-Ard, S., Chaiyamoon, A., Talarovicova, A., Tinikul, R., Tinikul, Y., Poomtong, T., Elphick, M.R., Cummins, S.F., Sobhon, P., 2018. Transcriptomic discovery and

of

comparative analysis of neuropeptide precursors in sea cucumbers (Holothuroidea).

ro

Peptides 99, 231-240.

-p

Tinikul, Y., Poljaroen, J., Tinikul, R., Sobhon, P., 2016. Changes in the levels, expression, and

re

their possible roles of serotonin and dopamine during embryonic development in the

80.

lP

giant freshwater prawn, Macrobrachium rosenbergii. Gen Comp Endocrinol. 225, 71-

na

Tinikul, Y., Engsusophon, A., Kruangkum, T., Thongrod, S., Tinikul, R., Sobhon, P., 2017 Neuropeptide F stimulates ovarian development and spawning in the female giant

Jo ur

freshwater prawn, Macrobrachium rosenbergii, and its expression in the ovary during ovarian maturation cycle. Aquaculture 469, 128-136. Uthicke, S., Thompson, A., Schaffelke, B., 2010. Effectiveness of benthic foraminiferal and coral assemblages as water quality indicators on inshore reefs of the Great Barrier Reef, Australia. Coral Reefs 29, 209–225.

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

21

Legend to figures

Figure 1. The complete cDNA and amino acid sequences of hscubifrin precursor identified from transcriptomic analysis. The predicted N-terminal signal peptide (24 amino acids) is shown in bold letters and the dibasic processing sites are shown in dark gray. Mature sequences of hscubifrin are light grey, with a C-terminal amidation position of glycine residue shown in

of

white letters.

ro

Figure 2. Comparison of the deduced amino acid sequences of cubifrin precursor between H.

-p

scabra and A. japonicus. A star indicates identical amino acid. A colon and single dot indicate

lP

re

highly conserved and conserved amino acids, respectively.

Figure 3. Effect of cubifrins on gamete spawning in H. scabra. Histograms showing the

na

percentage of spawned sea cucumbers per total sea cucumbers after injections with two types of cubifrins compared with the control group. The newly identified cubifrin-F was more potent

Jo ur

in stimulating spawning with about 69% success rate, than cubifrin-Y that could stimulate only 10% spawning compared with the control group.

Figure 4. The sea cucumbers, H. scabra, injected with cubifrins showing reproductive behaviors before spawning and shedding period: (A) and (B), a male releasing sperm; (C) and (D), a female shedding eggs. The reproductive behaviors before gamete shedding typically included: climbing up the wall of the tank; raising up and waving of the head in circular or side to side motion; and finally shedding gametes from the gonadal duct through gonopores in the head region.

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

22

Figure 5. Histology of the ovary and in situ hybridization detecting hscubifrin expression in the mature ovary of H. scabra. (A) Low magnification and (B) high magnification of an ovarian tubule containing premature oocytes (Oc3) and fully mature oocyte (Oc4) stained with hematoxylin and eosin (H&E) showing large euchromatic nuclei with prominent nucleoli and eosinophilic cytoplasm. The wall of ovarian tubule comprises outer epithelium (Oep), a middle layer of muscular mixed with connective tissue (M) and inner epithelium (Iep). (C,D) Low magnifications showing, by in situ hybridization, the expression of hscubifrin gene (in blue

of

color) in the wall of ovarian tubules (Cap) of fully mature ovaries (E) Higher magnification

ro

of the boxed area inserted in D, showing strong expression of hscubifrin at inner epithelium of

-p

the wall of an ovarian tubule (arrowheads). (F) Negative control using cubifrin sense riboprobe

re

shows no staining in the ovary. Cap,-ovarian tubular wall; Oc3, vitellogenic oocyte; Oc4,

Jo ur

na

lP

mature oocyte.

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

23

Department of Biochemistry Faculty of Science, Mahidol University, 272 Rama VI Road, Ratchathewi District, Bangkok, 10400, Thailand Tel: (66)2-201-5607, Fax: (66)2-354-7174

of

November 6th, 2019

Dear Prof. Dr. Wayne O'Connor, Ph.D.

ro

Section Editor (Invertebrate Physiology),

re

-p

Aquaculture, Elsevier

lP

We are submitting a revised manuscript entitled “Existence of two mature sequences of cubifrin neuropeptides and their effects on spawning in the sea

na

cucumber, Holothuria scabra” (Ms. No. AQUA_2019_1671R1), for your approval to publish

Jo ur

in Aquaculture.

We would like to confirm that all the authors have no conflict of interest. We thank you very much for your kind consideration.

Yours sincerely,

Assistant Professor Ruchanok Tinikul, Ph.D. Corresponding Author

E-mail address: [email protected], [email protected]

Jo ur

na

lP

re

-p

ro

of

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

24

Journal Pre-proof of November 6th, 2019 Chaiyamoon et al_ AQUA_2019_1671R1_As

25

Chaiyamoon et al_submitted to Aquaculture (Ms. No. AQUA_2019_1671R1)

Highlights



The cubifrin neuropeptide precursor in H. scabra was newly identified to be cubifrin-Y

of

(NGIWYamide) and cubifrin-F (NGIWFamide).

The newly identified cubifrin-F was more potent in stimulating spawning.



The in situ hybridization showed intense expression of cubifrin transcript within the wall of

These cubifrins could be used to stimulate of spawning of H. scabra broodstocks for seed and

na

lP

larval productions in sea cucumber aquaculture.

Jo ur



re

the ovarian tubule of late stage ovary.

-p

ro

