- Email: [email protected]
Exogenous GABA alleviates alkaline stress in Malus hupehensis by regulating the accumulation of organic acids
Scientia Horticulturae xxx (xxxx) xxxx
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Exogenous GABA alleviates alkaline stress in Malus hupehensis by regulating the accumulation of organic acids Yuxing Li1, Boyang Liu1, Yuxiao Peng, Chenlu Liu, Xiuzhi Zhang, Zhijun Zhang, Wei Liang, Fengwang Ma, Cuiying Li* State Key Laboratory of Crop Stress Biology for Arid Areas/Shaanxi Key Laboratory of Apple, College of Horticulture, Northwest A&F University, Yangling, Shaanxi, 712100, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Exogenous GABA Antioxidant enzymes Organic acid Alkaline stress
Alkaline stress affects the apple production in northwestern China. Here, Malus hupehensis was used as a material to study the influence of exogenous γ-aminobutyric acid (GABA) application on seedlings under alkaline stress in hydroponics. 0.5 mM GABA was identified as the most suitable concentration to alleviate alkaline stress. Compared with the control, exogenous GABA significantly increased biomass, root growth, and scavenging activities of reactive oxygen species in apple seedlings under alkaline stress. In addition, the photosynthetic characteristics and total chlorophyll concentration increased remarkably in response to GABA application. Exogenous GABA also significantly increased the contents of malate, citric acid, and succinate by promoting the GABA shunt. Furthermore, the activities of malate dehydrogenase, citrate synthase, isocitrate dehydrogenase, and aconitase increased in response to GABA application. These results are important to indicate the use of exogenous substances to improve the resistance of apples to alkaline stress.
1. Introduction
(MDA) increased, and the seedling biomass and chlorophyll concentration decreased markedly. Other studies reported that the scavenging abilities of reactive oxygen species (ROS) decreased in response to ROS accumulation in apple seedlings under alkaline stress (Zhang et al., 2016; Gong et al., 2017). These studies indicated that alkaline stress affected both the growth and the development of apples. Organic acids are compounds with low molecular weight that have carboxyl groups and exert buffering effects. There are many types of organic acids in plants such as malic acid, citric acid, succinic acid, oxalic acid, and malonic acid (Ma et al., 2015). Different plants use a diversity of species and contents of organic acids. Organic acids are also important intermediate products for the material and energy metabolism in plants. They play a significant role during plant adaptation to various stresses. Organic acids regulate and adapt to different stresses in plants such as drought, saline-alkali, and metal ion stresses (Fougère et al., 1991; Chen et al., 2009; Li et al., 2017; Fu et al., 2019). For example, Elaeagnus angustifolia accumulates organic acids to improve alkaline resistance (Guo et al., 2009). In response to aluminum damage, the roots of Fagopyrum esculentum and Cassia tora also accumulate or
Soil greatly contributes to plant growth and yield. However, soil salinization and alkalization are key soil problems. The stress factors of salt-alkaline soils on plants include osmotic stress, ion toxicity, high pH, and a decrease in mineral availability (Gillespie and Pope, 1990; Rincon and Gonzales, 1992). Salt stress and alkaline stress have differentcauses. While the former is caused by NaCl and Na2SO4, the latter is caused by NaHCO3 and Na2CO3. To date, many studies examined the role of salt stress in plants and numerous plants with salt resistance have been developed (Zhu, 2000; Shi and Sheng, 2005; Shi and Wang, 2005; Zhao et al., 2018; Barajas-Lopez et al., 2018). However, comparatively few studies investigate plant responses to alkaline stress. The largest and the most desirable apple-producing area of China is the Loess Plateau (Zhou et al., 2015). Whereas, the soil alkalization of this area is not conducive to the growth of apples (Wen et al., 2017). Our previous study reported that alkaline stress damages the root system of apple trees (Zhang et al., 2016). After 15 days of stress, both the relative electrolyte leakage (REL) and malondialdehyde content
Abbreviations: GABA, γ-aminobutyric acid; ROS, reactive oxygen species; MDH, malate dehydrogenase; CS, citrate synthase; ICD, isocitrate dehydrogenase; ACO, aconitase; REL, relative electrolyte leakage; Chl, Chlorophyll; Fv/Fm, The maximal quantum yield of PSⅡ; SOD, superoxide dismutase; CAT, catalase; POD, peroxidase; Glu, Pn, photosynthetic rate, glutamate; Gs, stomatal conductance; Ci, intercellular CO2 concentration; TCA, tricarboxylic acid metabolism ⁎ Corresponding author. E-mail address: [email protected] (C. Li). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.scienta.2019.108982 Received 7 July 2019; Received in revised form 18 September 2019; Accepted 25 October 2019 0304-4238/ © 2019 Published by Elsevier B.V.
Please cite this article as: Yuxing Li, et al., Scientia Horticulturae, https://doi.org/10.1016/j.scienta.2019.108982
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
secrete organic acids to resist stress (Yang et al., 2016). γ-aminobutyric acid (GABA) exists in all living beings and is comprised of a four-carbon non-protein amino acid. GABA was first identified in potato tubers (Dent et al., 1947), and later in the brain (Awapara et al., 1950; Roberts and Frankel, 1950; Udenfriend, 1950). GABA is a neurotransmitterof animal and human brains (Bower et al., 2004). In plants, GABA has a particularly wide range of features. It participates in the Ca2+ signaling response, dimensional C/N balance, insect defense, and pollen tube development (MacGregor et al., 2003; Aaron et al., 2008; Beltrán et al., 2009; Yu et al., 2014). In addition, GABA functions as a signaling molecule under stress conditions (Bouché and Fromm, 2004). For instance, exogenous GABA improved PEG-induced drought tolerance in Trifolium repens (Yong et al., 2017). GABA-T deficiency incurs root defects and alters cell wall composition in response to salt stress (Renault et al., 2013). However, no report has been published about the effects of exogenous GABA application under alkaline stress in apple seedlings. The present study investigated whether GABA supplementation could alleviate the growth inhibition caused by alkaline stress. Our hypothesis is that exogenous GABA will improve the plant tolerance to alkaline stress. To test this hypothesis, (i) the photosynthetic responses; (ii) antioxidant activity; and (iii) organic acid accumulation were evaluated.
Table 1 Gene information and primers used for real-time quantitative PCR. Primers name
sequences
RT-GAD1-F RT-GAD1-R RT-GAD2-F RT-GAD2-R RT-GAD3-F RT-GAD3-R RT-GABA-T-F RT-GABA-T-R RT-SSADH1-F RT-SSADH1-R RT-SSADH2-F RT-SSADH2-R RT-EF-1α-F RT-EF-1α-R
CAGCCAATGCGGAACATGTA CCGGCTGAAATCCTCCCTAA AGTAGTTGATGCCGGCTGCTA CATACTCAGGAGCCCCTTTT CGGTGGGACAGACACAGAGA CACTCCGACTAGTAGCATTTTGCA GAGCATTGCCCCAAGATTTC TCCCCTATGATTGGACTGTCACA CAGTGGCACCCCTTTTGC GCAGCTAACCCTGCATTGGT TCATACTTTGATACCTCATCCTCCAT GAGCAGCAGGATAGAAATTTGAATG ATTCAAGTATGCCTGGGTGC CAGTCAGCCTGTGATGTTCC
group: Hoagland's nutrient solution adding 0.5 mM GABA; 3) AL group: Hoagland's nutrient solution plus 1 M NaHCO3 and 1 M Na2CO3 (1:1) and the pH was adjusted to 9.0 ± 0.1; and 4) AL + GABA group: pH to 9.0 ± 0.1 with Hoagland's nutrient (1 M NaHCO3 and 1 M Na2CO3 (1:1) solution), supplemented with 0.5 mM GABA. 2.4. Measurements of gas exchange parameters
2. Materials and methods
Photosynthetic indexes were measured with a portable photosynthesis system LI-6400 (LICOR, Huntington Beach, CA, USA) according to Sun et al. (2018). Measurements were performed between 09:00 and 12:00 on the third to fifth mature leaves from the top of selected plant stems. All photosynthetic measurements were taken at 1000 μmol m−2 s-1 and at constant airflow rate of 500 μmol s-1. The CO2 concentration in toe cuvette was set at 400 μmol mol-1 air.
2.1. Plant materials and experimental design Apomictic Malus hupehensis seedlings were used in this study. After stratification in sand at 0 °C to 4 °C for 50 days, seeds with the same germination state were selected for sowing (50-hole tray) and one seed per hole was selected via seedling substrate. Seedlings were grown outdoors under normal management. M. hupehensis seedlings of similar size were transplanted into a hydroponic system at the 5–6 true leaf stage. Hydroponic culturing techniques were conducted according to Bai et al. (2013), and each of the hydroponic plastic basins (52 cm × 37 cm × 15 cm) contained 15 L 1/2 Hoagland nutrient solution (Hoagland and Arnon, 1950), which was refreshed every 5 days. Plants grew under uniform conditions with LED light illumination (16 h/8 h; day/night) at 18 °C to 24 °C. All experiments were performed at the Northwest A&F University, Yangling (N34°20, E108°24), China, from March of 2018 to March of 2019.
2.5. Biomass measurements The seedlings were selected after 15 days treatment. The plants were washed with distilled water and dried with absorbent paper. Each plant was divided into above ground (shoots and leaves) and belowground parts (roots) and the fresh weights of both were measured. Finally, tissues were deactivated with enzymes at 105 °C for 30 min and then oven-dried at 65 °C to constant weight for dry-weight measurement.
2.2. Screening for optimum GABA concentrations 2.6. Investigation of chlorophyll, Fv/Fm, relative electrolyte leakage, and root architecture
After seedlings had adapted to the new environment for 10 days, seedlings with consistent growth were randomly divided into seven groups, which either received 0 (as the control group, pH = 6.0 ± 0.1), 0, 0.2, 0.5, 1, 5, or 10 (as the alkaline treatment groups, pH = 9.0 ± 0.1) mM GABA as part of the normal nutrient solution. 1 M NaHCO3 and 1 M Na2CO3 (1:1) were applied to adjust the solution pH to 9.0 ± 0.1 as alkaline treatment for the seedlings. Furthermore, the pH of the control treatment was adjusted to 6.0 ± 0.1 by adding concentrated sulfuric acid (H2SO4). Alkaline stress conditions were induced for plants in six groups (0, 0.2, 0.5, 1, 5, or 10 mM GABA) and one group served as control (0 mM GABA). GABA was refreshed every 5 days along with the nutrient solution, and the pH of each group was adjusted every day asdescribed above. The physiological indexes of plants were calculated after 15 days of treatment.
Chlorophyll (Chl) was extracted with 80% acetone and the concentrations were determined spectrophotometrically based on the method of Lichtenthaler and Wellburn (1983). The maximal quantum yield of PSⅡ (Fv/Fm) was measured using an Open Fluor Cam FC 800-O multispectral fluorescence imager (Photon Systems Instruments, Brno, Czech Republic). REL was measured according to Dionisio-Sese and Tobita (1998). Root architecture was analyzed with WinRHIZO (Epson Perfection V700, Canada, Regent Instruments). 2.7. Determination of ROS accumulation and antioxidant enzyme activities H2O2 contents, activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) were measured with specific detection kits according to the manufacturer’s instructions (Suzhou Comin Biotechnology Co., Ltd., Suzhou, China). Briefly, 100 mg of fresh leaves were weighed for each biological repetition. Extraction and color reactions of H2O2, SOD, CAT, and POD were conducted with the specific reagents in the kits. The absorption was measured by SHIMADZU UV2600 spectrophotometer (Kyoto, Japan). The H2O2 contents and
2.3. Hydroponics study According to the results of the screening study, 0.5 mM GABA was selected as suitable dose for farther experiment. After 10 days of preculture, the transplanted seedlings were divided into four groups: 1) CK: Hoagland's nutrient solution (pH = 6.0 ± 0.1); 2) CK + GABA 2
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Fig. 1. Effects of the different concentrations of exogenous GABA on the growth and relative electrolytic leakage (REL) of Malus hupehensis seedlings under alkaline stress for 15 days. (A) The phenotype of the seedings. (B) The relative electrolytic leakage of the leaves and roots. CK, control; AL, alkaline stress; 0.2 mM: AL + 0.2 mM GABA; 0.5 mM: AL + 0.5 mM GABA; 1 mM: AL + 1 mM GABA; 5 mM: AL + 5 mM GABA; 10 mM: AL + 10 mM GABA. Data are means ± SD of 3 replicate samples. Values with the different letters are significantly different (P < 0.05).
Fig. 2. Effects of 0.5 mM exogenous GABA on the growth and root architecture of M. hupehensis under alkaline stress for 15days. (A) The phenotype of M. hupehensis seeding grown for 15days. (B) Plant height. (C) Total fresh weight and total dry weight. (D) Root architecture including length, volume, surface area, average diameter, tips and forks. CK, control; CK + GABA, 0.5 mM GABA under normal condition; AL, alkaline stress; GABA + AL, 0.5 mM GABA under alkaline stress. Data are means ± SD of 4 replicate samples. Values with different letters are significantly different (P < 0.05).
0.22-μm water syringe filter for measurement. The samples were analyzed with an Agilent 1200 liquid chromatograph with a diode array detector(DAD, Agilent Technology, Palo Alto, CA, U S A). For separation, an Inertsil ODS-3 column (5.0 μm particle size, 4.6 × 250 mm; GL Sciences Inc., Tokyo, Japan) was used. KH2PO4 (20 mM, pH of 2.4) was used as mobile phase at a flow rate of 0.8 mL min−1.The DAD was set to 210 nm to detect organic acids. The standard curves were linear from 0.025 − 2.5 mg mL−1. All organic acid standards were obtained from Sigma-Aldrich (St. Louis, MO, USA). The organic acid content was calculated using the standard curve and peak areas. The activities of malate dehydrogenase (MDH), citric acid synthase
enzyme activities (SOD, CAT, and POD) were calculated according to the formula in the instructions. Three biological repeats were measured for each sample. 2.8. Extraction and determination of organic acids and enzyme activities Organic acids were extracted and measured according to Ma et al. (2015) with modifications. Here, 100 mg of fresh leaves were homogenized with 1 mL double distilled water (ddH2O), the mixture was ultrasonically extracted for 30 min at 25 °C, and centrifuged for 10 min at 6000 r/min. The supernatant was absorbed and filtered through a 3
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Fig. 3. Effects of 0.5 mM exogenous GABA on photosynthetic indices, chlorophyll content and oxidative damage of M. hupehensis seedlings under alkaline stress for 15 days. (A) Photosynthetic indices including photosynthetic rate, stomatal conductance and intercellular CO2 concentration. (B) Total chlorophyll content. (C) Fv/ Fm. (D) Relative electrolytic leakage. CK, control; CK + GABA, 0.5 mM GABA under normal condition; AL, alkaline stress; GABA + AL, 0.5 mM GABA under alkaline stress. Data are means ± SD of 4 replicate samples. Values with different letters are significantly different (P < 0.05).
2.10. qRT-PCR analysis
(CS), isocitrate dehydrogenase (ICD), and aconitase (ACO) were measured and the compounds were purified via ELISA detection kits according to the manufacturer's instructions (ELISA Biotechnology Co., Shanghai, China). Here, 100 mg of fresh leaves were homogenized in 0.9 mL of ice-cold 0.01 mol L−1 phosphate buffer (pH of 7.4). Samples were then transferred to a 2-mL tubeand centrifuged at 6000 r/min for 10 min at 4 °C, and the supernatant was collected.
The total RNAs of all samples were extracted with a TIANGEN RNAprep pure plant kit (TIANGEN Biotech Co., Ltd., Beijing, China) according to the manufacturer's instructions. Quantitative real-time PCR (qRT-PCR) was performed on an ABI StepOnePlus real-time PCR system (Applied Biosystems, Singapore) using a SYBR Premix Ex TaqII (Takara, Kyoto, Japan). All primers are listed in Table 1. Transcripts of the Malus elongation factor 1 alpha gene (EF-1a; DQ341381) were used to reference genes (Sun et al., 2018). The relative expression level of genes was calculated by the 2−ΔΔCT method (Livak and Schmittgen, 2001). Three independent biological replications were performed per sample.
2.9. Extraction and determination of GABA and glutamate contents GABA and glutamate (Glu) contents were extracted and measured as described by Jin et al. (2019). The samples were analyzed by liquid chromatography-mass spectrometry (LC–MS, LC:AC, ExionLC; MS:Qtrap5500, AB Sciex). Mobile phase A was methanol, mobile phase B was 0.1% methanoic acid, the flow rate was 0.3 mL min−1, and 10 μL was used as sample injection volume. In addition, amino acids were broken and scanned by data-dependent scanning. The GABA retention time was 12 min. The contents of GABA and Glu were calculated as the peak area of the standard curves.
2.11. Statistical analysis SPSS software (version 22.0) was used for the statistical analyses. All data were subjected to one-way analysis of variance (ANOVA), and values were presented as means ± standard deviation (SD). 4
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Fig. 4. Effects of 0.5 mM exogenous GABA on H2O2 contentration and activities of antioxidant enzymes in leaves from M. hupehensis under alkaline stress for 15 days. (A) H2O2 contentration. (B) Activities of antioxidant enzymes including superoxide dismutase (SOD), peroxidase (POD), catalase (CAT). CK, control; CK + GABA, 0.5 mM GABA under normal condition; AL, alkaline stress; GABA + AL, 0.5 mM GABA under alkaline stress. Data are means ± SD of 3 replicate samples. Values with different letters are significantly different (P < 0.05).
3. Results
forks were respectively 30.5%, 18.8%, 18.8%, 27.3%, 25.5%, and 26% in comparison to the control group. GABA treatment under alkali stress conditions increased the root architecture of total length, surface areas, average diameter, volume, tips, and forks by 25.1%, 23.2%, 26.2%, 30.8%, 29.1%, and 26%, respectively, compared with AL plants. The CK groups did not differ significantly compared with the GABA group (Fig. 2D).
3.1. Identifying the optimum GABA concentration To assess how GABA affected the tolerance of M. hupehensis seedlings to alkaline stress, a hydroponics system was used to study the phenotype of plants that were exposed to various GABA concentrations. Compared with the control, 0.2 mM, 0.5 mM, and 1 mM GABA could alleviate alkaline stress. More new roots were produced by the seedlings at 0.5 mM. The growth was severely inhibited, leaves wilted, and the root structures were poor at both 5 mM and 10 mM (Fig. 1A). The relative conductivity of roots and leaves of apple seedlings was also measured: 0.5 mM GABA was the most suitable concentration to alleviate alkaline stress in both roots and leaves (Fig. 1B). Therefore, 0.5 mM GABA was used for further experiments.
3.3. Effects of GABA on plant photosynthesis, Chl, Fv/Fm, and relative electrolyte leakage Alkaline stress significantly decreased the net photosynthetic rate of the AL group. After 15 days of observation, exogenous GABA treatment markedly alleviated the inhibitory effect of alkaline stress on the photosynthetic rate: the GABA + AL group maintained similar levels to CK and CK + GABA groups. This trend was also reflected in stomatal conductance (Gs) and intercellular CO2 concentration (Ci) (Fig. 3A). Alkaline stress hinders chlorophyll synthesis. After 15 days of alkaline stress, the Chl content of AL plants was 59.1% of that of CK plants, but GABA treatment noticeably increased the Chl content under alkaline stress (Fig. 3B). The photochemical efficiency of PSII (Fv/Fm) decreased under stress. However, thisdecrease could be markedly alleviated via GABA treatment (Fig. 2C). TheREL was increased in leaves and roots of seedlings after exposure to alkaline stress for 15days. GABA treatment significantly decreased the stress-induced increases of REL (Fig. 3D).
3.2. Effects of GABA on plant growth and root architecture To better understand the effect of GABA in apple seedlings during alkaline stress, 0.5 mM GABA was added to the hydroponic plastic basins. After 15 days of treatment, the growth of seedlings had significantly decreased, the leaves became yellow, and roots became smaller. Application of 0.5 mM GABA reversed these effects (Fig. 2A). Alkaline stress decreased the height as well as both fresh and dry weights by 27.6%, 47.1%, and 37.4% compared with control, respectively. GABA treatment alleviated the growth inhibition of alkali stress, and the total fresh and dry weights increased by 48.4% and 39.4%, respectively, versus the AL group. No prominent difference was found between the CK group and the GABA group except for fresh weight (Fig. 2B, C). Root architecture was examined to assess the effect of GABA supplementation. Alkaline stress impacted root growth. After alkali stress treatment, the decreased amplitude of total length, surface areas, average diameter, volume, number of root tips, and number of root
3.4. Effects of GABA on plant ROS accumulations and activities of antioxidant enzymes To determine whether exogenous GABA alleviated alkaline stress and scavenged ROS, hydrogen peroxide (H2O2) levels were measured in the leaves (Fig. 4A). When plants were expose to alkaline stress for 15days, the AL group H2O2 levels doubled compared with the CK group. 5
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Fig. 5. Effects of 0.5 mM exogenous GABA on endogenous GABA, Glu and organic acid content in leaves of M. hupehensis under alkaline stress for 15 days. (A) GABA concentration. (B) Glu concentration. (C) Organic acid content including malic acid, citric acid and succinic acid. CK, control; CK + GABA, 0.5 mM GABA under normal condition; AL, alkaline stress; AL + GABA, 0.5 mM GABA under alkaline stress. Data are means ± SD of 3 replicate samples. Values with different letters are significantly different (P < 0.05).
3.5. Effects of GABA on plant organic acids
In contrast, exogenous GABA was linked to a remarkable decrease in H2O2 production. Compared with AL plants, the AL + GABA group had lower H2O2 levels; no distinct difference was found among the CK, CK + GABA, and AL + GABA groups. Furthermore, the activities of antioxidant enzymes were investigated: alkaline stress markedly decreased CAT, SOD, and POD activities. Fig. 4B shows that the decrease in CAT activity was 0.77-fold for the AL group versus the CK group. In addition, no significant differences were found among CK, CK + GABA, and AL + GABA groups. A similar pattern was observed for SOD and POD activities. These results clearly demonstrated that GABA has the ability to remove excessive ROS from plant cells under alkaline stress by promoting the activity of antioxidant enzymes.
The concentrations of GABA and Glu were measured in the leaves of M. hupehensis seedlings. Under normal conditions, exogenous GABA treatment signally increased the level of endogenous GABA. The endogenous GABA level was lower in AL groups than in the AL + GABA group under alkaline stress (Fig. 5A). Glu is the precursor of GABA biosynthesis: Exogenous GABA markedly decreased the Glu content under normal conditions but did not lead to a significant difference in the AL group or the AL + GABA group. Compared with control, the GABA level in the treatment group was significantly lower than in the control group (Fig. 5B). To further study the effects of exogenous GABA on the organic acids of apple seedlings under alkaline stress, three main organic acids were assessed (malate, citric acid, and succinate; Fig. 5C). Malate was lower 6
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Fig. 6. Effects of 0.5 mM exogenous GABA on enzyme activities related to organic acid in leaves of M. hupehensis under alkaline stress for 15 days. (A) MDH activity. (B) CS activity. (C) ICD activity. (D) ACO activity. CK, control; CK + GABA, 0.5 mM GABA under normal condition; AL, alkaline stress; AL + GABA, 0.5 mM GABA under alkaline stress. Data are means ± SD of 3 replicate samples. Values with different letters are significantly different (P < 0.05).
4. Discussion
in the AL + GABA group than the AL group, while the AL group accumulated far more malate than control. No significant difference was found in the concentrations of malate between the CK group and the CK + GABA group. Similar trends were found for the levels of citric acid and succinate, which were not significantly different between the AL group, the CK group, andthe CK + GABA group.
4.1. The effects of alkaline stress and GABA application on plant growth and biomass allocation Alkaline conditions impede plant growth and leads to fewer new leaves and shorter roots and branches, which is often accompanied by a decrease in dry weight (Navarro et al., 2000; Hajiboland et al., 2005; Shi and Sheng, 2005; Yang et al., 2008). Seventeen genotypes of apple rootstock were evaluated and alkaline stress inhibited the growth of all apple seedlings (Zhang et al., 2016). The degree of inhibition varied with the rootstock, and alkaline stress most severely affected the root system (Zhang et al., 2016). This study showed that plant height, biomass (fresh weight and dry weight), and root architecture (length, surface area, average diameter, root volume, tips, and forks) of M. hupehensis seedlings decreased significantly under alkaline stress. In addition, the RELof roots and leaves increased significantly under alkaline stress. Application of 0.5 mM GABA alleviated these inhibitory effects and promoted both growth and development of plants under different alkaline stresses. The REL and fresh weight of maize seedlings could be increased by exogenous GABA under salt stress (Wang et al., 2017). Under cold stress, the REL of tomato seedlings treated with GABA decreased significantly and tomato growth was promoted (Malekzadeh et al., 2014). Pretreatment with GABA could alleviate leaf wilting, decrease bothREL and MDA content, and improved the membrane stability of leaves under drought stress (Yong et al., 2017). Exogenous GABA application significantly increased the growth parameters and alleviated the effects of alkaline stress in M. hupehensis.
3.6. Effects of GABA on the plant enzymatic activity To further evaluate the response characteristics of organic acids in M. hupehensis seedlings under alkali stress, the activities of related enzyme were studied including MDH, CS, ICD, and ACO. Under control conditions, exogenous GABA treatment increased MDH activity (Fig. 6A). Under alkaline conditions, exogenous GABA increased MDH activity. The same trend was also found for CS, ICD, and ACO (Fig. 5B–D). 3.7. Effects of exogenous GABA on the expression pattern of genes related to the GABA pathway To identify the regulatory mechanism of exogenous GABA, the genes related to the GABA pathway (including glutamic acid dehydrogenases (GAD1, GAD2, and GAD3), GABA transferases (GABA-T), and succinate semi-aldehyde dehydrogenases (SSADH1 and SSADH2)) were analyzed. Three different expression patterns were found for the GAD gene: Under alkaline stress, exogenous GABA application increased the expression of GAD1 compared with the AL group. The expression patterns of GAD2 were similar in all four groups. However, the expression of GAD3 decreased significantly in response to exogenous treatment. Alkaline stress inhibited the expression of GABA-T while exogenous GABA increased the expression of GABA-T. Furthermore, the transcription levels of the CK + GABA group and the AL + GABA group could enhance the level of exogenous GABA in SSADH2. Compared with control, alkaline stress increased the transcription level of SSADH1. In addition, the transcription levels of AL group and AL + GABA group were similar in SSADH1 (Fig. 7).
4.2. Effects of alkaline stress and GABA on gas exchange parameters, chlorophyll concentrations, and Fv/Fm The photosynthetic capacity is an important index to assess the stress resistance of plants. The results showed that the photosynthetic capacity could be improved by using exogenous substances under 7
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Fig. 7. Effects of 0.5 mM exogenous GABA on the expression pattern of genes involve in GABA pathway. CK, control; CK + GABA, 0.5 mM GABA under normal condition; AL, alkaline stress; AL + GABA, 0.5 mM GABA under alkaline stress. Data are means ± SD of 3 replicate samples. Values with different letters are significantly different (P < 0.05).
and osmotic regulator to decrease the damage of mesophyll cells under alkaline stress (Xiang et al., 2016). In addition, the mitigation effect of GABA might promote the operation of the tricarboxylic acid metabolism (TCA) cycle via the GABA shunt, which would ensure the operation of the photosynthetic electron transport chain.
stress. Exogenous dopamine and melatonin have been reported to increase the photosynthetic rate under drought conditions in Malus (Wang et al., 2013; Li et al., 2015a; Liang et al., 2018). Exogenous dopamine application helped to maintain the photosynthetic capacity under nutrient deficiency-induced stress (Liang et al., 2017). The results of the present study show that the net photosynthetic rate and stomatal conductance of plants significantly decreased with time, while the intercellular CO2 concentration increased significantly under alkaline stress. After 15 days of treatment, the total chlorophyll content and the maximal photochemical efficiency of photosystem II (Fv/Fm) had decreased significantly. Decreases in photosynthesis rates due to alkaline stress directly affect the photosynthetic machinery, i.e., by decreasing both the total chlorophyll content and Fv/Fm (Willson et al., 2017). Application of exogenous GABA helped to reverse this negative influence of alkaline stress. GABA can promote the synthesis of photosynthetic pigments, which aids the photosynthetic mechanism (Li et al., 2016). Plants can use exogenous GABA as a temporary nitrogen source
4.3. Effects of alkaline stress and GABA on H2O2 and antioxidant enzymes ROS are signaling molecules and play an important role in the response of plants to biological and abiotic stimuli (Baxter et al., 2014). When plants encounter stress (e.g., heat stress, drought stress, salt stress, cold stress, and pathogen infection), ROS will accumulate (Simon et al., 2010; Li et al., 2015a,b; Ohama et al., 2017; Xie et al., 2018). The results of this study show that the accumulation of H2O2 in M. hupehensis was induced by alkaline stress. Exogenous GABA application can decrease the level of H2O2 in the leaves of seedlings. The activities of CAT, POD, and SOD were inhibited under alkaline stress, but GABA treatment restored these activities to almost the level of the control. 8
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Author contributions
These results are consistent with previous studies. For instance, supplementing plants with exogenous GABA decreased H2O2 accumulation and the lipid peroxidation of tomato and cucumber plants under cold stress (Malekzadeh et al., 2014, 2017). Similar results were reported for Lactuca sativa under salt stress (Kalhor et al., 2018).
C. Li, Y. Li, and B. Liu conceived and designed the experiments; Y. Li performed the experiments with assistance from Y. Peng, C. Liu, X. Zhang, Z. Zhang and W. Liang; Y. Li, and B. Liu analyzed the data; Y. Li wrote the paper; C. Li provided financial support and helped perform the analysis with constructive discussions; F. Ma provided materials and laboratory apparatus.
4.4. Effects of alkaline stress and GABA on endogenous GABA, Glu, organic acids, and enzymatic activity
Declaration of Competing Interest
The GABA content in plants increased significantly in response to stress. NADH and succinic acid reaction substrates were supplied for the TCA via a GABA shunt. This inhibited the accumulation of ROS and thus alleviated stress. Many studies have shown that GABA is involved in the plant metabolism where it functions as a signaling molecule. Exogenous GABA can induce the accumulation of endogenous GABA (Shi et al., 2010; Ramesh et al., 2015, 2018). Organic acid accumulation also plays a role in the improvement of plant tolerance to stress (Lin et al., 2016). The results of this study showed that exogenous GABA treatment significantly increased the accumulation of endogenous GABA, malic acid, citric acid, and succinic acid. This could provide an explanation why exogenous GABA promoted the GABA shunt pathway and improved the TCA metabolism by increasing endogenous GABA. The TCA cycle is the main pathway to synthesizing organic acids (Etienne et al., 2013). MDH activity has been reported to be essential for all growth processes (Salisbury and Ross, 1986). CS is directly involved in the regulation of citric acid synthesis (Lin et al., 2016). High levels of MDH activity increase the function of the TCA cycle: the resulting OAA reacts with another acetyl CoA molecule to begin the next TCA cycle (Das et al., 2019).The present study showed that exogenous GABA application significantly enhanced the activities of MDH, CS, ICD, and ACO. This may also be the reason for the increase of organic acids in M. hupehensis leaves after exogenous GABA treatment under alkaline stress.
The authors declare that there are no conflicts of interest. Acknowledgements This work was supported by the Natural Science Foundation of China (31601715), the Science and Technology Co-ordination Innovation Project of Shaanxi (2016KTZDNY01-01). References Aaron, F., Hillel, F., Dirk, W., Gad, G., Alisdair, R.F., 2008. Highway or byway: the metabolic role of the GABA shunt in plants. Trends Plant Sci. 13, 14–19. https://doi.org/ 10.1016/j.tpl ants.2007.10.005. Awapara, J., Landua, A.J., Fuerst, R., 1950. Free γ-aminobutyric acid in brain. Biol. Chem. 187, 35–39. Bai, T.H., Li, C.Y., Li, C., Liang, D., Ma, F.W., 2013. Contrasting hypoxia tolerance and adaptation in Malus species is linked to differences in stomatal behavior and photosynthesis. Physiol. Plantarum 147, 514–523. https://doi.org/10.1111/j.1399-3054. 2012.01683.x. Barajas-Lopez, J.D., Moreno, J.R., Gamez-Arjona, F.M., Pardo, J.M., Punkkinen, M., Zhu, J.K., Quintero, F.J., Fujii, H., 2018. Upstream kinases of plant SnRKs are involved in salt stress tolerance. Plant J. 93, 107–118. https://doi.org/10.1111/tpj.13761. Baxter, A., Mittler, R., Suzuki, N., 2014. ROS as key players in plant stress signalling. J. Exp. Bot. 65, 1229–1240. https://doi.org/10.1093/jxb/ert375. Beltrán, F., Pérezlópez, A.J., Lópeznicolás, J.M., Carbonellbarrachina, A.A., 2009. Color and vitamin C content in Mandarin orange juice as affected by packaging material and storage temperature. Food Process Preserv. 33, 27–40. https://doi.org/10.1111/ j.1745-4549.2008.00247.x. Bouché, N., Fromm, H., 2004. GABA in plants: just a metabolite? Trend in Plant Sci 3, 110–115. https://doi.org/10.1016/j.tplants.2004.01.006. Carillo, P., 2018. GABA shunt in durum Wheat. Front. Plant Sci. 2, 100. https://doi.org/ 10.3389/fpls.2018.00100. Chen, W.C., Cui, P.J., Sun, H.Y., Guo, W.Q., Yang, C.W., Jin, H., Fang, B., Shi, D.C., 2009. Comparative effects of salt and alkali stresses on organic acid accumulation and ionic balance of seabuckthorn (Hippophae rhamnoides L.). Ind. Crops Prod. 3, 151–358. https://doi.org/10.1016/j.indcrop.2009.06.007. Das, P., Manna, I., Sil, P., Bandyopadhyay, M., Biswas, A.K., 2019. Exogenous silicon alters organic acid production and enzymatic activity of TCA cycle in two NaCl stressed indica rice cultivars. Plant Physiol. Biochem. 136, 76–91. https://doi.org/10. 1016/j.plaphy.2018.12.026. Dent, C.E., Stepka, W., Steward, F.C., 1947. Detection of the free amino-acids of plant cells by partition chromatography. Nature 160, 682–683. Dionisio-Sese, M.L., Tobita, S., 1998. Antioxidant responses of rice seedlings to salinity stress. Plant Sci. 135, 1–9. Etienne, A., Génard, M., Lobit, P., Mbeguié-A-Mbéguié, D., Bugaud, C., 2013. What controls fleshy fruit acidity? A review of malate and citrate accumulation in fruit cells. J. Exp. Bot. 64, 1451–1459. https://doi.org/10.1093/jxb/ert035. Fougère, F., Le, R.D., Streeter, J.G., 1991. Effects of salt stress on amino acid, organic acid, and carbohydrate composition of roots, bacteroids, and cytosol of Alfalfa (Medicago sativa L.). Plant Physiol. 4, 1228–1236. https://doi.org/10.1104/pp.96.4. 1228. Fu, H., Yu, H., Li, T., Wu, Y., 2019. Effect of cadmium stress on inorganic and organic components in xylem sap of high cadmium accumulating rice line (Oryza sativa L.). Ecotoxicol. Environ. Saf. 168, 330–337. https://doi.org/10.1016/j.ecoenv.2018.10. 023. Gillespie, A.R., Pope, P.E., 1990. Rhizosphere acidification increases phosphorus recovery of black locust: II. Model preductions and measured recovery. Soil Sci. Soc. Am. J. 2, 538–541. Gong, X.Q., Shi, S.T., Dou, F.F., Song, Y., Ma, F.W., 2017. Exogenous melatonin alleviates alkaline stress in Malus hupehensis Rehd. by regulating the biosynthesis of polyamines. Molecules 22 (9), 1542. https://doi.org/10.3390/molecules22091542. Guo, R., Shi, L.X., Yang, Y.F., 2009. Germination, growth, osmotic adjustment and ionic balance of wheat in response to saline and alkaline stresses. Soil Sci. Plant Nutr. 55, 667–679. https://doi.org/10.1111/j.1747-0765.2009.00406.x. Hajiboland, R., Yang, X.E., Römheld, V., Neumann, G., 2005. Effect of bicarbonate on elongation and distribution of organic acids in root and root zone of Zn-efficient and Zn-inefficient rice (Oryza sativa L.) genotypes. Environ. Exp. Bot. 54, 163–173. https://doi.org/10.1016/j.envexpbot.2004.07.001.
4.5. The impact of alkaline stress and GABA on the GABA pathway gene expression The GABA shunt involves three main enzymes in the GABA pathway of plants (Carillo, 2018). First, glutamic acid decarboxylase (GAD) catalyzes glutamic acid to produce GABA. Second, GABA enters mitochondria, where it is decomposed into succinaldehyde (SSA) by GABA transaminase (GABA-T). Finally, SSA is oxidized by mitochondrial SSA dehydrogenase (SSADH) to succinic acid. The transcription levels of GAD, GABA-T, and SSADH were studied. Under alkaline stress, exogenous GABA treatment resulted in a high expression of MdGAD1 and a low expression of MdGAD3; however, no differences were found in MdGAD2 expression. The transcription levels of MdGABA-T and MdSSADH2 treated with exogenous GABA under alkaline stress were higher than those of the AL group. These results explain why exogenous GABA application promoted GABA shunting under alkaline stress. 5. Conclusion The obtained results showed that exogenous GABA treatment (0.5 mM) could effectively alleviate alkaline stress, increase plant biomass, and positively affect the root architecture. Exogenous GABA treatment improved the alkali tolerance of apple seedlings, regulated antioxidant and photosynthetic systems, and decreased the resistance to oxidative stress. Exogenous GABA not only promoted the activity of the GABA shunt by up-regulating MdGABA-T and MdSSADH, but also promoted the activity of enzymes related with the TCA cycle to increase the accumulations of GABA, malate, citric acid, and succinate. These positive effects of GABA on alkaline tolerance indicate a new GABA application in agriculture. Exogenous GABA treatment not only helps to improve the nutritional value of plants but also improves the tolerance of plants to alkaline conditions. 9
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
acid. Biol. Chem. 187, 55–63. Salisbury, F.B., Ross, C.W., 1986. Lipids and other natural products. Plant Physiol. 268–287. Shi, D.C., Sheng, Y.M., 2005. Effect of various salt–alkaline mixed stress conditions on sunflower seedlings and analysis of their stress factors. Environ. Exp. Bot. 54, 8–21. https://doi.org/10.1016/j.envexpbot.2004.05.003. Shi, D.C., Wang, D.L., 2005. Effects of various salt-alkaline mixed stresses on Aneurolepidium Chinense (Trin.) Kitag. Plant Soil 271, 15–26. https://doi.org/10. 1007/s11104-004-1307-z. Shi, S.Q., Shi, Z., Jiang, Z.P., Qi, L.W., Sun, X.M., Li, C.X., 2010. Effects of exogenous GABA on gene expression of Caragana intermedia roots under NaCl stress: regulatory roles for H2O2 and ethylene production. Plant Cell Environ. 33, 149–162. https://doi. org/10.1111/j.1365-3040.2009.02065.x. Simon, C., Langlois-Meurinne, M., Bellvert, F., Garmier, M., Didierlaurent, L., Massoud, K., Chaouch, S., Marie, A., Bodo, B., Kauffmann, S., Noctor, G., Saindrenan, P., 2010. The differential spatial distribution of secondary metabolites in Arabidopsis leaves reacting hypersensitively to Pseudomonas syringae pv. tomato is dependent on the oxidative burst. J. Exp. Bot. 61, 3355–3370. https://doi.org/10.1093/jxb/erq157. Sun, X., Huo, L.Q., Jia, X., Che, R.M., Gong, X.Q., Wang, P., Ma, F.W., 2018. Overexpression of MdATG18a improves resistance to Diplocarpon mali infection by improving antioxidant system activity and SA level in apple. Hortic. Res. 5, 57. https://doi.org/10.1038/s41438-018-0059-5. Udenfriend, S., 1950. Identification of γ-aminobutyric acid in brain by the isotope derivative method. Biol. Chem. 87, 65–69. Wang, Y., Gu, W., Meng, Y., Xie, T., Li, L., Li, J., Wei, S., 2017. γ-Aminobutyric Acid imparts partial protection from salt stress injury to maize seedlings by improving photosynthesis and upregulating osmoprotectants and antioxidants. Sci. Rep. 7, 43609. https://doi.org/10.1038/srep43609. Wang, P., Sun, X., Li, C., Wei, Z., Liang, D., Ma, F., 2013. Long-term exogenous application of melatonin delays drought-induced leaf senescence in apple. J. Pineal Res. 54, 292–302. https://doi.org/10.1111/jpi.12017. Wen, T., Dong, L.J., Wang, L., Ma, F.W., Zou, Y.J., Li, C.Y., 2017. Changes in root architecture and endogenous hormone levels in two Malus rootstocks under alkali stress. Sci. Hortic. 235, 198–204. https://doi.org/10.1016/j.scienta.2017.09.015. Willson, K.G., Perantoni, A.N., Berry, Z.C., Eicholtz, M.I., Tamukong, Y.B., Yarood, S.A., Baldwin, A.H., 2017. Influences of reduced iron and magnesium on growth and photosynthetic performance of Phragmites australis subsp.aMericanus (North American common reed). Aquat. Bot. 137, 30–38. Xiang, L., Hu, L., Xu, W.N., Zhen, A., Zhang, L., Hu, X.H., 2016. Exogenous γAminobutyric acid improves the structure and function of photosystem II in Muskmelon seedlings exposed to salinity-alkalinity stress. PLoS One 11, e0164847. https://doi.org/10.1371/journal.pone.0164847. Xie, Y.P., Chen, P.X., Yan, Y., Bao, C.N., Li, X.W., Wang, L.P., Shen, X.X., Li, H.Y., Liu, X.F., Niu, C.D., Zhu, C., Fang, N., Shao, Y., Zhao, T., Yu, J.T., Zhu, J.H., Xu, L.F., Nocker, S.V., Ma, F.W., 2018. An atypical R2R3 MYB transcription factor increases cold hardiness by CBF-dependent and CBF-independent pathways in apple. New Phytol. 218, 201–218. https://doi.org/10.1111/nph.14952. Yang, C., Shi, D., Wang, D., 2008. Comparative effects of salt and alkali stresses on growth, osmotic adjustment and ionic balance of an alkali-resistant halophyte Suaeda glauca (Bge.). Plant Growth Regul. 56, 179–190. https://doi.org/10.1007/s10725008-9299-y. Yang, J.L., Zheng, S.J., He, Y.F., You, J.F., Zhang, L., Yu, X.H., 2016. Comparative studies on the effect of a protein-synthesis inhibitor on aluminium-induced secretion of organic acids from Fagopyrum esculentum Moench and Cassia tora L. Roots. Plant Cell Environ. 29 (2), 240–246. https://doi.org/10.1111/j.1365-3040.2005.01416.x. Yong, B., Xie, H., Li, Z., Li, Y.P., Zhang, Y., Nie, G., Zhang, X.G., Ma, X., Huang, L.K., Yan, Y.H., Peng, Y., 2017. Exogenous application of GABA improves PEG-Induced drought tolerance positively associated with GABA-shunt, polyamines, and proline metabolism in White Clover. Front. Physiol. 8, 1107. https://doi.org/10.3389/fphys.2017. 01107. Yu, G.H., Zou, J., Feng, J., Peng, X.B., Wu, J.Y., Wu, Y.L., Palanivelu, R., Sun, M.X., 2014. Exogenous γ-aminobutyric acid (GABA) affects pollen tube growth via modulating putative Ca2+-permeable membrane channels and is coupled to negative regulation on glutamate. J. Exp. Bot. 65, 3235–3248. https://doi.org/10.1093/jxb/eru171. Zhang, K.X., Wen, T., Dong, J., Ma, F.W., Bai, T.H., Wang, K., Li, C.Y., 2016. Comprehensive evaluation of 17 genotypes of apple rootstocks to alkali stress. J. Integr. Agric. 7, 1499–1509. https://doi.org/10.1016/S2095-3119(15)61325-9. Zhao, C.Z., Zayed, O., Yu, Z.P., Jiang, W., Zhu, P.P., Hsu, C.C., Zhang, L., Tao, W., Lozano, D.R., Zhu, J.K., 2018. Leucine-rich repeat extensin proteins regulate plant salt tolerance in Arabidopsis. PNAS 115, 13123–13128. https://doi.org/10.1073/pnas. 1816991115. Zhou, S.S., Li, M.J., Guan, Q.M., Liu, F.L., Zhang, S., Chen, W., Yin, L.H., Qin, Y., Ma, F.W., 2015. Physiological and proteome analysis suggest critical roles for the photosynthetic system for high water-use efficiency under drought stress in Malus. Plant Sci. 236, 44–60. https://doi.org/10.1016/j.plantsci.2015.03.017. Zhu, J.K., 2000. Genetic analysis of plant salt tolerance using Arabidopsis. Plant Physiol. 3, 941–948. https://doi.org/10.1104/pp.124.3.941.
Hoagland, D.R., Arnon, D.I., 1950. The water-culture method for growing plants without soil. Circ. Calif. Agric. Exp. Stat. 347, 357–359. Jin, X.Q., Liu, T., Xu, J.J., Gao, Z.X., Hu, X.H., 2019. Exogenous GABA enhances muskmelon tolerance to salinity-alkalinity stress by regulating redox balance and chlorophyll biosynthesis. BMC Plant Biol. 1, 19. https://doi.org/10.1186/s12870-0191660-y. Kalhor, M.S., Aliniaeifard, S., Seif, M., Asayesh, E.J., Bernard, F., Hassani, B., Li, T., 2018. Enhanced salt tolerance and photosynthetic performance: Implication of ɤ-amino butyric acid application in salt-exposed lettuce (Lactuca sativa L.) plants. Plant Physiol. Biochem. 130, 157–172. https://doi.org/10.1016/j.plaphy.2018.07.003. Li, Z., Yu, J., Peng, Y., Huang, B., 2017. Metabolic pathways regulated by abscisic acid, salicylic acid and γ-aminobutyric acid in association with improved drought tolerance in creeping bentgrass (Agrostis stolonifera). Physiol. Plant. 1, 42–58. https:// doi.org/10.1111/ppl.12483. Li, C., Sun, X.K., Chang, C., Jia, D.F., Wei, Z.W., Li, C.Y., Ma, F.W., 2015b. Dopamine alleviates salt-induced stress in Malus hupehensis. Physiol. Plant. 153, 584–602. https://doi.org/10.1111/ppl.12264. Li, C., Tan, D.X., Liang, D., Chang, C., Jia, D.F., Ma, F.W., 2015a. Melatonin mediates the regulation of ABA metabolism, free-radical scavenging, and stomatal behaviour in two Malus species under drought stress. J. Exp. Bot. 66, 669–680. https://doi.org/10. 1093/jxb/eru476. Li, W., Liu, J.H., Ashraf, U., Li, G.K., Li, Y.L., Lu, W.J., Gao, L., Han, F.G., Hu, J.G., 2016. Exogenous γ-aminobutyric acid (GABA) application improved early growth, net photosynthesis, and associated physio-biochemical events in Maize. Front. Plant Sci. 7, 919. https://doi.org/10.3389/fpls.2016.00919. Liang, B.W., Gao, T.T., Zhao, Q., Ma, C.Q., Chen, Q., Wei, Z.W., Li, C.Y., Li, C., Ma, F.W., 2018. Effects of exogenous dopamine on the uptake, transport, and resorption of apple ionome under moderate drought. Front. Plant Sci. 9, 755. https://doi.org/10. 3389/fpls.2018.00755. Liang, B.W., Li, C.Y., Ma, C.Q., Wei, Z.W., Wang, Q., Huang, D., Chen, Q., Li, C., Ma, F.W., 2017. Dopamine alleviates nutrient deficiency-induced stress in Malus hupehensis. Plant Physiol. Biochem. 119, 346–359. https://doi.org/10.1016/j.plaphy.2017.09. 012. Lichtenthaler, H.K., Wellburn, A.R., 1983. Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents. Biochem. Soc. Trans. 11, 591–592. Lin, Q., Qian, J., Zhao, C.N., Wang, D.L., Liu, C.R., Wang, Z.D., Sun, C.D., Chen, K.S., 2016. Low temperature induced changes in citrate metabolism in ponkan (Citrus reticulata Blanco cv. Ponkan) fruit during maturation. PLoS One 11 (6), e0156703. https://doi.org/10.1371/journal.pone.0156703. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. https://doi.org/10.1006/meth.2001.1262. Ma, B.Q., Chen, J., Zheng, H.Y., Fang, T., Ogutu, C., Li, S.H., Han, Y.P., Wu, B.H., 2015. Comparative assessment of sugar and malic acid composition in cultivated and wild apples. Food Chem. 172, 86–91. https://doi.org/10.1016/j.foodchem.2014.09.032. MacGregor, K.B., Shelp, B.J., Peiris, S., Bown, A.W., 2003. Overexpression of glutamate decarboxylase in transgenic tobacco plants deters feeding by phytophagous insect larvae. J. Chem. Ecol. 29, 2177–2182. Malekzadeh, P., Khara, J., Heydari, R., 2014. Alleviating effects of exogenous Gammaaminobutiric acid on tomato seedling under chilling stress. Physiol. Mol. Biol. Plants 20, 133–137. https://doi.org/10.1007/s12298-013-0203-5. Malekzadeh, P., Khosravi-Nejad, F., Hatamnia, A.A., Sheikhakbari, M.R., 2017. Impact of postharvest exogenous γ-aminobutyric acid treatment on cucumber fruit in response to chilling tolerance. Physiol. Mol. Biol. Plants 23, 827–836. https://doi.org/10. 1007/s12298-017-0475-2. Navarro, J.M., Martínez, V.V., Carvajal, M., 2000. Ammonium, bicarbonate and calcium effects on tomato plants grown under saline conditions. Plant Sci. 157, 89–96. https://doi.org/10.1016/S0168-9452(00)00272-7. Ohama, N., Sato, H., Shinozaki, K., Yamaguchi-Shinozaki, K., 2017. Transcriptional regulatory network of plant heat stress response. Trends Plant Sci. 22, 53–65. https:// doi.org/10.1016/j.tplants.2016.08.015. Ramesh, S.A., Kamran, M., Sullivan, W., Chirkova, L., Okamoto, M., Degryse, F., McLaughlin, M., Gilliham, M., Tyerman, S.D., 2018. Aluminum-activated malate transporters can facilitate GABA transport. Plant Cell 30, 1147–1164. https://doi. org/10.1105/tpc.17.00864. Ramesh, S.A., Tyerman, S.D., Xu, B., Bose, J., Kaur, S., Conn, V., Domingos, P., Ullah, S., Wege, S., Shabala, S., Feijó, J.A., Ryan, P.R., Gilliham, M., 2015. GABA signalling modulates plant growth by directly regulating the activity of plant-specific anion transporters. Nat. Commun. 28, 8293. https://doi.org/10.1038/ncomms9293. Renault, H., El-Amrani, A., Berger, A., Mouille, G., Soubigou-Taconnat, L., Bouchereau, A., Deleu, C., 2013. γ-Aminobutyric acid transaminase deficiency impairs central carbon metabolism and leads to cell wall defects during salt stress in Arabidopsis roots. Plant Cell Environ. 36, 1009–1018. https://doi.org/10.1111/pce.12033. Rincon, M., Gonzales, R., 1992. Aluminum partitioning in intact roots of aluminum-tolerant and aluminum-sensitive wheat (Triticum aestivum L.) cultivars. Plant Physiol. 99, 1021–1028. https://doi.org/10.1104/pp.99.3.1021. Roberts, E., Frankel, S., 1950. γ-aminobutyric acid in brain: its formation from glutamic
10
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Exogenous GABA alleviates alkaline stress in Malus hupehensis by regulating the accumulation of organic acids Yuxing Li1, Boyang Liu1, Yuxiao Peng, Chenlu Liu, Xiuzhi Zhang, Zhijun Zhang, Wei Liang, Fengwang Ma, Cuiying Li* State Key Laboratory of Crop Stress Biology for Arid Areas/Shaanxi Key Laboratory of Apple, College of Horticulture, Northwest A&F University, Yangling, Shaanxi, 712100, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Exogenous GABA Antioxidant enzymes Organic acid Alkaline stress
Alkaline stress affects the apple production in northwestern China. Here, Malus hupehensis was used as a material to study the influence of exogenous γ-aminobutyric acid (GABA) application on seedlings under alkaline stress in hydroponics. 0.5 mM GABA was identified as the most suitable concentration to alleviate alkaline stress. Compared with the control, exogenous GABA significantly increased biomass, root growth, and scavenging activities of reactive oxygen species in apple seedlings under alkaline stress. In addition, the photosynthetic characteristics and total chlorophyll concentration increased remarkably in response to GABA application. Exogenous GABA also significantly increased the contents of malate, citric acid, and succinate by promoting the GABA shunt. Furthermore, the activities of malate dehydrogenase, citrate synthase, isocitrate dehydrogenase, and aconitase increased in response to GABA application. These results are important to indicate the use of exogenous substances to improve the resistance of apples to alkaline stress.
1. Introduction
(MDA) increased, and the seedling biomass and chlorophyll concentration decreased markedly. Other studies reported that the scavenging abilities of reactive oxygen species (ROS) decreased in response to ROS accumulation in apple seedlings under alkaline stress (Zhang et al., 2016; Gong et al., 2017). These studies indicated that alkaline stress affected both the growth and the development of apples. Organic acids are compounds with low molecular weight that have carboxyl groups and exert buffering effects. There are many types of organic acids in plants such as malic acid, citric acid, succinic acid, oxalic acid, and malonic acid (Ma et al., 2015). Different plants use a diversity of species and contents of organic acids. Organic acids are also important intermediate products for the material and energy metabolism in plants. They play a significant role during plant adaptation to various stresses. Organic acids regulate and adapt to different stresses in plants such as drought, saline-alkali, and metal ion stresses (Fougère et al., 1991; Chen et al., 2009; Li et al., 2017; Fu et al., 2019). For example, Elaeagnus angustifolia accumulates organic acids to improve alkaline resistance (Guo et al., 2009). In response to aluminum damage, the roots of Fagopyrum esculentum and Cassia tora also accumulate or
Soil greatly contributes to plant growth and yield. However, soil salinization and alkalization are key soil problems. The stress factors of salt-alkaline soils on plants include osmotic stress, ion toxicity, high pH, and a decrease in mineral availability (Gillespie and Pope, 1990; Rincon and Gonzales, 1992). Salt stress and alkaline stress have differentcauses. While the former is caused by NaCl and Na2SO4, the latter is caused by NaHCO3 and Na2CO3. To date, many studies examined the role of salt stress in plants and numerous plants with salt resistance have been developed (Zhu, 2000; Shi and Sheng, 2005; Shi and Wang, 2005; Zhao et al., 2018; Barajas-Lopez et al., 2018). However, comparatively few studies investigate plant responses to alkaline stress. The largest and the most desirable apple-producing area of China is the Loess Plateau (Zhou et al., 2015). Whereas, the soil alkalization of this area is not conducive to the growth of apples (Wen et al., 2017). Our previous study reported that alkaline stress damages the root system of apple trees (Zhang et al., 2016). After 15 days of stress, both the relative electrolyte leakage (REL) and malondialdehyde content
Abbreviations: GABA, γ-aminobutyric acid; ROS, reactive oxygen species; MDH, malate dehydrogenase; CS, citrate synthase; ICD, isocitrate dehydrogenase; ACO, aconitase; REL, relative electrolyte leakage; Chl, Chlorophyll; Fv/Fm, The maximal quantum yield of PSⅡ; SOD, superoxide dismutase; CAT, catalase; POD, peroxidase; Glu, Pn, photosynthetic rate, glutamate; Gs, stomatal conductance; Ci, intercellular CO2 concentration; TCA, tricarboxylic acid metabolism ⁎ Corresponding author. E-mail address: [email protected] (C. Li). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.scienta.2019.108982 Received 7 July 2019; Received in revised form 18 September 2019; Accepted 25 October 2019 0304-4238/ © 2019 Published by Elsevier B.V.
Please cite this article as: Yuxing Li, et al., Scientia Horticulturae, https://doi.org/10.1016/j.scienta.2019.108982
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
secrete organic acids to resist stress (Yang et al., 2016). γ-aminobutyric acid (GABA) exists in all living beings and is comprised of a four-carbon non-protein amino acid. GABA was first identified in potato tubers (Dent et al., 1947), and later in the brain (Awapara et al., 1950; Roberts and Frankel, 1950; Udenfriend, 1950). GABA is a neurotransmitterof animal and human brains (Bower et al., 2004). In plants, GABA has a particularly wide range of features. It participates in the Ca2+ signaling response, dimensional C/N balance, insect defense, and pollen tube development (MacGregor et al., 2003; Aaron et al., 2008; Beltrán et al., 2009; Yu et al., 2014). In addition, GABA functions as a signaling molecule under stress conditions (Bouché and Fromm, 2004). For instance, exogenous GABA improved PEG-induced drought tolerance in Trifolium repens (Yong et al., 2017). GABA-T deficiency incurs root defects and alters cell wall composition in response to salt stress (Renault et al., 2013). However, no report has been published about the effects of exogenous GABA application under alkaline stress in apple seedlings. The present study investigated whether GABA supplementation could alleviate the growth inhibition caused by alkaline stress. Our hypothesis is that exogenous GABA will improve the plant tolerance to alkaline stress. To test this hypothesis, (i) the photosynthetic responses; (ii) antioxidant activity; and (iii) organic acid accumulation were evaluated.
Table 1 Gene information and primers used for real-time quantitative PCR. Primers name
sequences
RT-GAD1-F RT-GAD1-R RT-GAD2-F RT-GAD2-R RT-GAD3-F RT-GAD3-R RT-GABA-T-F RT-GABA-T-R RT-SSADH1-F RT-SSADH1-R RT-SSADH2-F RT-SSADH2-R RT-EF-1α-F RT-EF-1α-R
CAGCCAATGCGGAACATGTA CCGGCTGAAATCCTCCCTAA AGTAGTTGATGCCGGCTGCTA CATACTCAGGAGCCCCTTTT CGGTGGGACAGACACAGAGA CACTCCGACTAGTAGCATTTTGCA GAGCATTGCCCCAAGATTTC TCCCCTATGATTGGACTGTCACA CAGTGGCACCCCTTTTGC GCAGCTAACCCTGCATTGGT TCATACTTTGATACCTCATCCTCCAT GAGCAGCAGGATAGAAATTTGAATG ATTCAAGTATGCCTGGGTGC CAGTCAGCCTGTGATGTTCC
group: Hoagland's nutrient solution adding 0.5 mM GABA; 3) AL group: Hoagland's nutrient solution plus 1 M NaHCO3 and 1 M Na2CO3 (1:1) and the pH was adjusted to 9.0 ± 0.1; and 4) AL + GABA group: pH to 9.0 ± 0.1 with Hoagland's nutrient (1 M NaHCO3 and 1 M Na2CO3 (1:1) solution), supplemented with 0.5 mM GABA. 2.4. Measurements of gas exchange parameters
2. Materials and methods
Photosynthetic indexes were measured with a portable photosynthesis system LI-6400 (LICOR, Huntington Beach, CA, USA) according to Sun et al. (2018). Measurements were performed between 09:00 and 12:00 on the third to fifth mature leaves from the top of selected plant stems. All photosynthetic measurements were taken at 1000 μmol m−2 s-1 and at constant airflow rate of 500 μmol s-1. The CO2 concentration in toe cuvette was set at 400 μmol mol-1 air.
2.1. Plant materials and experimental design Apomictic Malus hupehensis seedlings were used in this study. After stratification in sand at 0 °C to 4 °C for 50 days, seeds with the same germination state were selected for sowing (50-hole tray) and one seed per hole was selected via seedling substrate. Seedlings were grown outdoors under normal management. M. hupehensis seedlings of similar size were transplanted into a hydroponic system at the 5–6 true leaf stage. Hydroponic culturing techniques were conducted according to Bai et al. (2013), and each of the hydroponic plastic basins (52 cm × 37 cm × 15 cm) contained 15 L 1/2 Hoagland nutrient solution (Hoagland and Arnon, 1950), which was refreshed every 5 days. Plants grew under uniform conditions with LED light illumination (16 h/8 h; day/night) at 18 °C to 24 °C. All experiments were performed at the Northwest A&F University, Yangling (N34°20, E108°24), China, from March of 2018 to March of 2019.
2.5. Biomass measurements The seedlings were selected after 15 days treatment. The plants were washed with distilled water and dried with absorbent paper. Each plant was divided into above ground (shoots and leaves) and belowground parts (roots) and the fresh weights of both were measured. Finally, tissues were deactivated with enzymes at 105 °C for 30 min and then oven-dried at 65 °C to constant weight for dry-weight measurement.
2.2. Screening for optimum GABA concentrations 2.6. Investigation of chlorophyll, Fv/Fm, relative electrolyte leakage, and root architecture
After seedlings had adapted to the new environment for 10 days, seedlings with consistent growth were randomly divided into seven groups, which either received 0 (as the control group, pH = 6.0 ± 0.1), 0, 0.2, 0.5, 1, 5, or 10 (as the alkaline treatment groups, pH = 9.0 ± 0.1) mM GABA as part of the normal nutrient solution. 1 M NaHCO3 and 1 M Na2CO3 (1:1) were applied to adjust the solution pH to 9.0 ± 0.1 as alkaline treatment for the seedlings. Furthermore, the pH of the control treatment was adjusted to 6.0 ± 0.1 by adding concentrated sulfuric acid (H2SO4). Alkaline stress conditions were induced for plants in six groups (0, 0.2, 0.5, 1, 5, or 10 mM GABA) and one group served as control (0 mM GABA). GABA was refreshed every 5 days along with the nutrient solution, and the pH of each group was adjusted every day asdescribed above. The physiological indexes of plants were calculated after 15 days of treatment.
Chlorophyll (Chl) was extracted with 80% acetone and the concentrations were determined spectrophotometrically based on the method of Lichtenthaler and Wellburn (1983). The maximal quantum yield of PSⅡ (Fv/Fm) was measured using an Open Fluor Cam FC 800-O multispectral fluorescence imager (Photon Systems Instruments, Brno, Czech Republic). REL was measured according to Dionisio-Sese and Tobita (1998). Root architecture was analyzed with WinRHIZO (Epson Perfection V700, Canada, Regent Instruments). 2.7. Determination of ROS accumulation and antioxidant enzyme activities H2O2 contents, activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) were measured with specific detection kits according to the manufacturer’s instructions (Suzhou Comin Biotechnology Co., Ltd., Suzhou, China). Briefly, 100 mg of fresh leaves were weighed for each biological repetition. Extraction and color reactions of H2O2, SOD, CAT, and POD were conducted with the specific reagents in the kits. The absorption was measured by SHIMADZU UV2600 spectrophotometer (Kyoto, Japan). The H2O2 contents and
2.3. Hydroponics study According to the results of the screening study, 0.5 mM GABA was selected as suitable dose for farther experiment. After 10 days of preculture, the transplanted seedlings were divided into four groups: 1) CK: Hoagland's nutrient solution (pH = 6.0 ± 0.1); 2) CK + GABA 2
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Fig. 1. Effects of the different concentrations of exogenous GABA on the growth and relative electrolytic leakage (REL) of Malus hupehensis seedlings under alkaline stress for 15 days. (A) The phenotype of the seedings. (B) The relative electrolytic leakage of the leaves and roots. CK, control; AL, alkaline stress; 0.2 mM: AL + 0.2 mM GABA; 0.5 mM: AL + 0.5 mM GABA; 1 mM: AL + 1 mM GABA; 5 mM: AL + 5 mM GABA; 10 mM: AL + 10 mM GABA. Data are means ± SD of 3 replicate samples. Values with the different letters are significantly different (P < 0.05).
Fig. 2. Effects of 0.5 mM exogenous GABA on the growth and root architecture of M. hupehensis under alkaline stress for 15days. (A) The phenotype of M. hupehensis seeding grown for 15days. (B) Plant height. (C) Total fresh weight and total dry weight. (D) Root architecture including length, volume, surface area, average diameter, tips and forks. CK, control; CK + GABA, 0.5 mM GABA under normal condition; AL, alkaline stress; GABA + AL, 0.5 mM GABA under alkaline stress. Data are means ± SD of 4 replicate samples. Values with different letters are significantly different (P < 0.05).
0.22-μm water syringe filter for measurement. The samples were analyzed with an Agilent 1200 liquid chromatograph with a diode array detector(DAD, Agilent Technology, Palo Alto, CA, U S A). For separation, an Inertsil ODS-3 column (5.0 μm particle size, 4.6 × 250 mm; GL Sciences Inc., Tokyo, Japan) was used. KH2PO4 (20 mM, pH of 2.4) was used as mobile phase at a flow rate of 0.8 mL min−1.The DAD was set to 210 nm to detect organic acids. The standard curves were linear from 0.025 − 2.5 mg mL−1. All organic acid standards were obtained from Sigma-Aldrich (St. Louis, MO, USA). The organic acid content was calculated using the standard curve and peak areas. The activities of malate dehydrogenase (MDH), citric acid synthase
enzyme activities (SOD, CAT, and POD) were calculated according to the formula in the instructions. Three biological repeats were measured for each sample. 2.8. Extraction and determination of organic acids and enzyme activities Organic acids were extracted and measured according to Ma et al. (2015) with modifications. Here, 100 mg of fresh leaves were homogenized with 1 mL double distilled water (ddH2O), the mixture was ultrasonically extracted for 30 min at 25 °C, and centrifuged for 10 min at 6000 r/min. The supernatant was absorbed and filtered through a 3
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Fig. 3. Effects of 0.5 mM exogenous GABA on photosynthetic indices, chlorophyll content and oxidative damage of M. hupehensis seedlings under alkaline stress for 15 days. (A) Photosynthetic indices including photosynthetic rate, stomatal conductance and intercellular CO2 concentration. (B) Total chlorophyll content. (C) Fv/ Fm. (D) Relative electrolytic leakage. CK, control; CK + GABA, 0.5 mM GABA under normal condition; AL, alkaline stress; GABA + AL, 0.5 mM GABA under alkaline stress. Data are means ± SD of 4 replicate samples. Values with different letters are significantly different (P < 0.05).
2.10. qRT-PCR analysis
(CS), isocitrate dehydrogenase (ICD), and aconitase (ACO) were measured and the compounds were purified via ELISA detection kits according to the manufacturer's instructions (ELISA Biotechnology Co., Shanghai, China). Here, 100 mg of fresh leaves were homogenized in 0.9 mL of ice-cold 0.01 mol L−1 phosphate buffer (pH of 7.4). Samples were then transferred to a 2-mL tubeand centrifuged at 6000 r/min for 10 min at 4 °C, and the supernatant was collected.
The total RNAs of all samples were extracted with a TIANGEN RNAprep pure plant kit (TIANGEN Biotech Co., Ltd., Beijing, China) according to the manufacturer's instructions. Quantitative real-time PCR (qRT-PCR) was performed on an ABI StepOnePlus real-time PCR system (Applied Biosystems, Singapore) using a SYBR Premix Ex TaqII (Takara, Kyoto, Japan). All primers are listed in Table 1. Transcripts of the Malus elongation factor 1 alpha gene (EF-1a; DQ341381) were used to reference genes (Sun et al., 2018). The relative expression level of genes was calculated by the 2−ΔΔCT method (Livak and Schmittgen, 2001). Three independent biological replications were performed per sample.
2.9. Extraction and determination of GABA and glutamate contents GABA and glutamate (Glu) contents were extracted and measured as described by Jin et al. (2019). The samples were analyzed by liquid chromatography-mass spectrometry (LC–MS, LC:AC, ExionLC; MS:Qtrap5500, AB Sciex). Mobile phase A was methanol, mobile phase B was 0.1% methanoic acid, the flow rate was 0.3 mL min−1, and 10 μL was used as sample injection volume. In addition, amino acids were broken and scanned by data-dependent scanning. The GABA retention time was 12 min. The contents of GABA and Glu were calculated as the peak area of the standard curves.
2.11. Statistical analysis SPSS software (version 22.0) was used for the statistical analyses. All data were subjected to one-way analysis of variance (ANOVA), and values were presented as means ± standard deviation (SD). 4
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Fig. 4. Effects of 0.5 mM exogenous GABA on H2O2 contentration and activities of antioxidant enzymes in leaves from M. hupehensis under alkaline stress for 15 days. (A) H2O2 contentration. (B) Activities of antioxidant enzymes including superoxide dismutase (SOD), peroxidase (POD), catalase (CAT). CK, control; CK + GABA, 0.5 mM GABA under normal condition; AL, alkaline stress; GABA + AL, 0.5 mM GABA under alkaline stress. Data are means ± SD of 3 replicate samples. Values with different letters are significantly different (P < 0.05).
3. Results
forks were respectively 30.5%, 18.8%, 18.8%, 27.3%, 25.5%, and 26% in comparison to the control group. GABA treatment under alkali stress conditions increased the root architecture of total length, surface areas, average diameter, volume, tips, and forks by 25.1%, 23.2%, 26.2%, 30.8%, 29.1%, and 26%, respectively, compared with AL plants. The CK groups did not differ significantly compared with the GABA group (Fig. 2D).
3.1. Identifying the optimum GABA concentration To assess how GABA affected the tolerance of M. hupehensis seedlings to alkaline stress, a hydroponics system was used to study the phenotype of plants that were exposed to various GABA concentrations. Compared with the control, 0.2 mM, 0.5 mM, and 1 mM GABA could alleviate alkaline stress. More new roots were produced by the seedlings at 0.5 mM. The growth was severely inhibited, leaves wilted, and the root structures were poor at both 5 mM and 10 mM (Fig. 1A). The relative conductivity of roots and leaves of apple seedlings was also measured: 0.5 mM GABA was the most suitable concentration to alleviate alkaline stress in both roots and leaves (Fig. 1B). Therefore, 0.5 mM GABA was used for further experiments.
3.3. Effects of GABA on plant photosynthesis, Chl, Fv/Fm, and relative electrolyte leakage Alkaline stress significantly decreased the net photosynthetic rate of the AL group. After 15 days of observation, exogenous GABA treatment markedly alleviated the inhibitory effect of alkaline stress on the photosynthetic rate: the GABA + AL group maintained similar levels to CK and CK + GABA groups. This trend was also reflected in stomatal conductance (Gs) and intercellular CO2 concentration (Ci) (Fig. 3A). Alkaline stress hinders chlorophyll synthesis. After 15 days of alkaline stress, the Chl content of AL plants was 59.1% of that of CK plants, but GABA treatment noticeably increased the Chl content under alkaline stress (Fig. 3B). The photochemical efficiency of PSII (Fv/Fm) decreased under stress. However, thisdecrease could be markedly alleviated via GABA treatment (Fig. 2C). TheREL was increased in leaves and roots of seedlings after exposure to alkaline stress for 15days. GABA treatment significantly decreased the stress-induced increases of REL (Fig. 3D).
3.2. Effects of GABA on plant growth and root architecture To better understand the effect of GABA in apple seedlings during alkaline stress, 0.5 mM GABA was added to the hydroponic plastic basins. After 15 days of treatment, the growth of seedlings had significantly decreased, the leaves became yellow, and roots became smaller. Application of 0.5 mM GABA reversed these effects (Fig. 2A). Alkaline stress decreased the height as well as both fresh and dry weights by 27.6%, 47.1%, and 37.4% compared with control, respectively. GABA treatment alleviated the growth inhibition of alkali stress, and the total fresh and dry weights increased by 48.4% and 39.4%, respectively, versus the AL group. No prominent difference was found between the CK group and the GABA group except for fresh weight (Fig. 2B, C). Root architecture was examined to assess the effect of GABA supplementation. Alkaline stress impacted root growth. After alkali stress treatment, the decreased amplitude of total length, surface areas, average diameter, volume, number of root tips, and number of root
3.4. Effects of GABA on plant ROS accumulations and activities of antioxidant enzymes To determine whether exogenous GABA alleviated alkaline stress and scavenged ROS, hydrogen peroxide (H2O2) levels were measured in the leaves (Fig. 4A). When plants were expose to alkaline stress for 15days, the AL group H2O2 levels doubled compared with the CK group. 5
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Fig. 5. Effects of 0.5 mM exogenous GABA on endogenous GABA, Glu and organic acid content in leaves of M. hupehensis under alkaline stress for 15 days. (A) GABA concentration. (B) Glu concentration. (C) Organic acid content including malic acid, citric acid and succinic acid. CK, control; CK + GABA, 0.5 mM GABA under normal condition; AL, alkaline stress; AL + GABA, 0.5 mM GABA under alkaline stress. Data are means ± SD of 3 replicate samples. Values with different letters are significantly different (P < 0.05).
3.5. Effects of GABA on plant organic acids
In contrast, exogenous GABA was linked to a remarkable decrease in H2O2 production. Compared with AL plants, the AL + GABA group had lower H2O2 levels; no distinct difference was found among the CK, CK + GABA, and AL + GABA groups. Furthermore, the activities of antioxidant enzymes were investigated: alkaline stress markedly decreased CAT, SOD, and POD activities. Fig. 4B shows that the decrease in CAT activity was 0.77-fold for the AL group versus the CK group. In addition, no significant differences were found among CK, CK + GABA, and AL + GABA groups. A similar pattern was observed for SOD and POD activities. These results clearly demonstrated that GABA has the ability to remove excessive ROS from plant cells under alkaline stress by promoting the activity of antioxidant enzymes.
The concentrations of GABA and Glu were measured in the leaves of M. hupehensis seedlings. Under normal conditions, exogenous GABA treatment signally increased the level of endogenous GABA. The endogenous GABA level was lower in AL groups than in the AL + GABA group under alkaline stress (Fig. 5A). Glu is the precursor of GABA biosynthesis: Exogenous GABA markedly decreased the Glu content under normal conditions but did not lead to a significant difference in the AL group or the AL + GABA group. Compared with control, the GABA level in the treatment group was significantly lower than in the control group (Fig. 5B). To further study the effects of exogenous GABA on the organic acids of apple seedlings under alkaline stress, three main organic acids were assessed (malate, citric acid, and succinate; Fig. 5C). Malate was lower 6
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Fig. 6. Effects of 0.5 mM exogenous GABA on enzyme activities related to organic acid in leaves of M. hupehensis under alkaline stress for 15 days. (A) MDH activity. (B) CS activity. (C) ICD activity. (D) ACO activity. CK, control; CK + GABA, 0.5 mM GABA under normal condition; AL, alkaline stress; AL + GABA, 0.5 mM GABA under alkaline stress. Data are means ± SD of 3 replicate samples. Values with different letters are significantly different (P < 0.05).
4. Discussion
in the AL + GABA group than the AL group, while the AL group accumulated far more malate than control. No significant difference was found in the concentrations of malate between the CK group and the CK + GABA group. Similar trends were found for the levels of citric acid and succinate, which were not significantly different between the AL group, the CK group, andthe CK + GABA group.
4.1. The effects of alkaline stress and GABA application on plant growth and biomass allocation Alkaline conditions impede plant growth and leads to fewer new leaves and shorter roots and branches, which is often accompanied by a decrease in dry weight (Navarro et al., 2000; Hajiboland et al., 2005; Shi and Sheng, 2005; Yang et al., 2008). Seventeen genotypes of apple rootstock were evaluated and alkaline stress inhibited the growth of all apple seedlings (Zhang et al., 2016). The degree of inhibition varied with the rootstock, and alkaline stress most severely affected the root system (Zhang et al., 2016). This study showed that plant height, biomass (fresh weight and dry weight), and root architecture (length, surface area, average diameter, root volume, tips, and forks) of M. hupehensis seedlings decreased significantly under alkaline stress. In addition, the RELof roots and leaves increased significantly under alkaline stress. Application of 0.5 mM GABA alleviated these inhibitory effects and promoted both growth and development of plants under different alkaline stresses. The REL and fresh weight of maize seedlings could be increased by exogenous GABA under salt stress (Wang et al., 2017). Under cold stress, the REL of tomato seedlings treated with GABA decreased significantly and tomato growth was promoted (Malekzadeh et al., 2014). Pretreatment with GABA could alleviate leaf wilting, decrease bothREL and MDA content, and improved the membrane stability of leaves under drought stress (Yong et al., 2017). Exogenous GABA application significantly increased the growth parameters and alleviated the effects of alkaline stress in M. hupehensis.
3.6. Effects of GABA on the plant enzymatic activity To further evaluate the response characteristics of organic acids in M. hupehensis seedlings under alkali stress, the activities of related enzyme were studied including MDH, CS, ICD, and ACO. Under control conditions, exogenous GABA treatment increased MDH activity (Fig. 6A). Under alkaline conditions, exogenous GABA increased MDH activity. The same trend was also found for CS, ICD, and ACO (Fig. 5B–D). 3.7. Effects of exogenous GABA on the expression pattern of genes related to the GABA pathway To identify the regulatory mechanism of exogenous GABA, the genes related to the GABA pathway (including glutamic acid dehydrogenases (GAD1, GAD2, and GAD3), GABA transferases (GABA-T), and succinate semi-aldehyde dehydrogenases (SSADH1 and SSADH2)) were analyzed. Three different expression patterns were found for the GAD gene: Under alkaline stress, exogenous GABA application increased the expression of GAD1 compared with the AL group. The expression patterns of GAD2 were similar in all four groups. However, the expression of GAD3 decreased significantly in response to exogenous treatment. Alkaline stress inhibited the expression of GABA-T while exogenous GABA increased the expression of GABA-T. Furthermore, the transcription levels of the CK + GABA group and the AL + GABA group could enhance the level of exogenous GABA in SSADH2. Compared with control, alkaline stress increased the transcription level of SSADH1. In addition, the transcription levels of AL group and AL + GABA group were similar in SSADH1 (Fig. 7).
4.2. Effects of alkaline stress and GABA on gas exchange parameters, chlorophyll concentrations, and Fv/Fm The photosynthetic capacity is an important index to assess the stress resistance of plants. The results showed that the photosynthetic capacity could be improved by using exogenous substances under 7
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Fig. 7. Effects of 0.5 mM exogenous GABA on the expression pattern of genes involve in GABA pathway. CK, control; CK + GABA, 0.5 mM GABA under normal condition; AL, alkaline stress; AL + GABA, 0.5 mM GABA under alkaline stress. Data are means ± SD of 3 replicate samples. Values with different letters are significantly different (P < 0.05).
and osmotic regulator to decrease the damage of mesophyll cells under alkaline stress (Xiang et al., 2016). In addition, the mitigation effect of GABA might promote the operation of the tricarboxylic acid metabolism (TCA) cycle via the GABA shunt, which would ensure the operation of the photosynthetic electron transport chain.
stress. Exogenous dopamine and melatonin have been reported to increase the photosynthetic rate under drought conditions in Malus (Wang et al., 2013; Li et al., 2015a; Liang et al., 2018). Exogenous dopamine application helped to maintain the photosynthetic capacity under nutrient deficiency-induced stress (Liang et al., 2017). The results of the present study show that the net photosynthetic rate and stomatal conductance of plants significantly decreased with time, while the intercellular CO2 concentration increased significantly under alkaline stress. After 15 days of treatment, the total chlorophyll content and the maximal photochemical efficiency of photosystem II (Fv/Fm) had decreased significantly. Decreases in photosynthesis rates due to alkaline stress directly affect the photosynthetic machinery, i.e., by decreasing both the total chlorophyll content and Fv/Fm (Willson et al., 2017). Application of exogenous GABA helped to reverse this negative influence of alkaline stress. GABA can promote the synthesis of photosynthetic pigments, which aids the photosynthetic mechanism (Li et al., 2016). Plants can use exogenous GABA as a temporary nitrogen source
4.3. Effects of alkaline stress and GABA on H2O2 and antioxidant enzymes ROS are signaling molecules and play an important role in the response of plants to biological and abiotic stimuli (Baxter et al., 2014). When plants encounter stress (e.g., heat stress, drought stress, salt stress, cold stress, and pathogen infection), ROS will accumulate (Simon et al., 2010; Li et al., 2015a,b; Ohama et al., 2017; Xie et al., 2018). The results of this study show that the accumulation of H2O2 in M. hupehensis was induced by alkaline stress. Exogenous GABA application can decrease the level of H2O2 in the leaves of seedlings. The activities of CAT, POD, and SOD were inhibited under alkaline stress, but GABA treatment restored these activities to almost the level of the control. 8
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
Author contributions
These results are consistent with previous studies. For instance, supplementing plants with exogenous GABA decreased H2O2 accumulation and the lipid peroxidation of tomato and cucumber plants under cold stress (Malekzadeh et al., 2014, 2017). Similar results were reported for Lactuca sativa under salt stress (Kalhor et al., 2018).
C. Li, Y. Li, and B. Liu conceived and designed the experiments; Y. Li performed the experiments with assistance from Y. Peng, C. Liu, X. Zhang, Z. Zhang and W. Liang; Y. Li, and B. Liu analyzed the data; Y. Li wrote the paper; C. Li provided financial support and helped perform the analysis with constructive discussions; F. Ma provided materials and laboratory apparatus.
4.4. Effects of alkaline stress and GABA on endogenous GABA, Glu, organic acids, and enzymatic activity
Declaration of Competing Interest
The GABA content in plants increased significantly in response to stress. NADH and succinic acid reaction substrates were supplied for the TCA via a GABA shunt. This inhibited the accumulation of ROS and thus alleviated stress. Many studies have shown that GABA is involved in the plant metabolism where it functions as a signaling molecule. Exogenous GABA can induce the accumulation of endogenous GABA (Shi et al., 2010; Ramesh et al., 2015, 2018). Organic acid accumulation also plays a role in the improvement of plant tolerance to stress (Lin et al., 2016). The results of this study showed that exogenous GABA treatment significantly increased the accumulation of endogenous GABA, malic acid, citric acid, and succinic acid. This could provide an explanation why exogenous GABA promoted the GABA shunt pathway and improved the TCA metabolism by increasing endogenous GABA. The TCA cycle is the main pathway to synthesizing organic acids (Etienne et al., 2013). MDH activity has been reported to be essential for all growth processes (Salisbury and Ross, 1986). CS is directly involved in the regulation of citric acid synthesis (Lin et al., 2016). High levels of MDH activity increase the function of the TCA cycle: the resulting OAA reacts with another acetyl CoA molecule to begin the next TCA cycle (Das et al., 2019).The present study showed that exogenous GABA application significantly enhanced the activities of MDH, CS, ICD, and ACO. This may also be the reason for the increase of organic acids in M. hupehensis leaves after exogenous GABA treatment under alkaline stress.
The authors declare that there are no conflicts of interest. Acknowledgements This work was supported by the Natural Science Foundation of China (31601715), the Science and Technology Co-ordination Innovation Project of Shaanxi (2016KTZDNY01-01). References Aaron, F., Hillel, F., Dirk, W., Gad, G., Alisdair, R.F., 2008. Highway or byway: the metabolic role of the GABA shunt in plants. Trends Plant Sci. 13, 14–19. https://doi.org/ 10.1016/j.tpl ants.2007.10.005. Awapara, J., Landua, A.J., Fuerst, R., 1950. Free γ-aminobutyric acid in brain. Biol. Chem. 187, 35–39. Bai, T.H., Li, C.Y., Li, C., Liang, D., Ma, F.W., 2013. Contrasting hypoxia tolerance and adaptation in Malus species is linked to differences in stomatal behavior and photosynthesis. Physiol. Plantarum 147, 514–523. https://doi.org/10.1111/j.1399-3054. 2012.01683.x. Barajas-Lopez, J.D., Moreno, J.R., Gamez-Arjona, F.M., Pardo, J.M., Punkkinen, M., Zhu, J.K., Quintero, F.J., Fujii, H., 2018. Upstream kinases of plant SnRKs are involved in salt stress tolerance. Plant J. 93, 107–118. https://doi.org/10.1111/tpj.13761. Baxter, A., Mittler, R., Suzuki, N., 2014. ROS as key players in plant stress signalling. J. Exp. Bot. 65, 1229–1240. https://doi.org/10.1093/jxb/ert375. Beltrán, F., Pérezlópez, A.J., Lópeznicolás, J.M., Carbonellbarrachina, A.A., 2009. Color and vitamin C content in Mandarin orange juice as affected by packaging material and storage temperature. Food Process Preserv. 33, 27–40. https://doi.org/10.1111/ j.1745-4549.2008.00247.x. Bouché, N., Fromm, H., 2004. GABA in plants: just a metabolite? Trend in Plant Sci 3, 110–115. https://doi.org/10.1016/j.tplants.2004.01.006. Carillo, P., 2018. GABA shunt in durum Wheat. Front. Plant Sci. 2, 100. https://doi.org/ 10.3389/fpls.2018.00100. Chen, W.C., Cui, P.J., Sun, H.Y., Guo, W.Q., Yang, C.W., Jin, H., Fang, B., Shi, D.C., 2009. Comparative effects of salt and alkali stresses on organic acid accumulation and ionic balance of seabuckthorn (Hippophae rhamnoides L.). Ind. Crops Prod. 3, 151–358. https://doi.org/10.1016/j.indcrop.2009.06.007. Das, P., Manna, I., Sil, P., Bandyopadhyay, M., Biswas, A.K., 2019. Exogenous silicon alters organic acid production and enzymatic activity of TCA cycle in two NaCl stressed indica rice cultivars. Plant Physiol. Biochem. 136, 76–91. https://doi.org/10. 1016/j.plaphy.2018.12.026. Dent, C.E., Stepka, W., Steward, F.C., 1947. Detection of the free amino-acids of plant cells by partition chromatography. Nature 160, 682–683. Dionisio-Sese, M.L., Tobita, S., 1998. Antioxidant responses of rice seedlings to salinity stress. Plant Sci. 135, 1–9. Etienne, A., Génard, M., Lobit, P., Mbeguié-A-Mbéguié, D., Bugaud, C., 2013. What controls fleshy fruit acidity? A review of malate and citrate accumulation in fruit cells. J. Exp. Bot. 64, 1451–1459. https://doi.org/10.1093/jxb/ert035. Fougère, F., Le, R.D., Streeter, J.G., 1991. Effects of salt stress on amino acid, organic acid, and carbohydrate composition of roots, bacteroids, and cytosol of Alfalfa (Medicago sativa L.). Plant Physiol. 4, 1228–1236. https://doi.org/10.1104/pp.96.4. 1228. Fu, H., Yu, H., Li, T., Wu, Y., 2019. Effect of cadmium stress on inorganic and organic components in xylem sap of high cadmium accumulating rice line (Oryza sativa L.). Ecotoxicol. Environ. Saf. 168, 330–337. https://doi.org/10.1016/j.ecoenv.2018.10. 023. Gillespie, A.R., Pope, P.E., 1990. Rhizosphere acidification increases phosphorus recovery of black locust: II. Model preductions and measured recovery. Soil Sci. Soc. Am. J. 2, 538–541. Gong, X.Q., Shi, S.T., Dou, F.F., Song, Y., Ma, F.W., 2017. Exogenous melatonin alleviates alkaline stress in Malus hupehensis Rehd. by regulating the biosynthesis of polyamines. Molecules 22 (9), 1542. https://doi.org/10.3390/molecules22091542. Guo, R., Shi, L.X., Yang, Y.F., 2009. Germination, growth, osmotic adjustment and ionic balance of wheat in response to saline and alkaline stresses. Soil Sci. Plant Nutr. 55, 667–679. https://doi.org/10.1111/j.1747-0765.2009.00406.x. Hajiboland, R., Yang, X.E., Römheld, V., Neumann, G., 2005. Effect of bicarbonate on elongation and distribution of organic acids in root and root zone of Zn-efficient and Zn-inefficient rice (Oryza sativa L.) genotypes. Environ. Exp. Bot. 54, 163–173. https://doi.org/10.1016/j.envexpbot.2004.07.001.
4.5. The impact of alkaline stress and GABA on the GABA pathway gene expression The GABA shunt involves three main enzymes in the GABA pathway of plants (Carillo, 2018). First, glutamic acid decarboxylase (GAD) catalyzes glutamic acid to produce GABA. Second, GABA enters mitochondria, where it is decomposed into succinaldehyde (SSA) by GABA transaminase (GABA-T). Finally, SSA is oxidized by mitochondrial SSA dehydrogenase (SSADH) to succinic acid. The transcription levels of GAD, GABA-T, and SSADH were studied. Under alkaline stress, exogenous GABA treatment resulted in a high expression of MdGAD1 and a low expression of MdGAD3; however, no differences were found in MdGAD2 expression. The transcription levels of MdGABA-T and MdSSADH2 treated with exogenous GABA under alkaline stress were higher than those of the AL group. These results explain why exogenous GABA application promoted GABA shunting under alkaline stress. 5. Conclusion The obtained results showed that exogenous GABA treatment (0.5 mM) could effectively alleviate alkaline stress, increase plant biomass, and positively affect the root architecture. Exogenous GABA treatment improved the alkali tolerance of apple seedlings, regulated antioxidant and photosynthetic systems, and decreased the resistance to oxidative stress. Exogenous GABA not only promoted the activity of the GABA shunt by up-regulating MdGABA-T and MdSSADH, but also promoted the activity of enzymes related with the TCA cycle to increase the accumulations of GABA, malate, citric acid, and succinate. These positive effects of GABA on alkaline tolerance indicate a new GABA application in agriculture. Exogenous GABA treatment not only helps to improve the nutritional value of plants but also improves the tolerance of plants to alkaline conditions. 9
Scientia Horticulturae xxx (xxxx) xxxx
Y. Li, et al.
acid. Biol. Chem. 187, 55–63. Salisbury, F.B., Ross, C.W., 1986. Lipids and other natural products. Plant Physiol. 268–287. Shi, D.C., Sheng, Y.M., 2005. Effect of various salt–alkaline mixed stress conditions on sunflower seedlings and analysis of their stress factors. Environ. Exp. Bot. 54, 8–21. https://doi.org/10.1016/j.envexpbot.2004.05.003. Shi, D.C., Wang, D.L., 2005. Effects of various salt-alkaline mixed stresses on Aneurolepidium Chinense (Trin.) Kitag. Plant Soil 271, 15–26. https://doi.org/10. 1007/s11104-004-1307-z. Shi, S.Q., Shi, Z., Jiang, Z.P., Qi, L.W., Sun, X.M., Li, C.X., 2010. Effects of exogenous GABA on gene expression of Caragana intermedia roots under NaCl stress: regulatory roles for H2O2 and ethylene production. Plant Cell Environ. 33, 149–162. https://doi. org/10.1111/j.1365-3040.2009.02065.x. Simon, C., Langlois-Meurinne, M., Bellvert, F., Garmier, M., Didierlaurent, L., Massoud, K., Chaouch, S., Marie, A., Bodo, B., Kauffmann, S., Noctor, G., Saindrenan, P., 2010. The differential spatial distribution of secondary metabolites in Arabidopsis leaves reacting hypersensitively to Pseudomonas syringae pv. tomato is dependent on the oxidative burst. J. Exp. Bot. 61, 3355–3370. https://doi.org/10.1093/jxb/erq157. Sun, X., Huo, L.Q., Jia, X., Che, R.M., Gong, X.Q., Wang, P., Ma, F.W., 2018. Overexpression of MdATG18a improves resistance to Diplocarpon mali infection by improving antioxidant system activity and SA level in apple. Hortic. Res. 5, 57. https://doi.org/10.1038/s41438-018-0059-5. Udenfriend, S., 1950. Identification of γ-aminobutyric acid in brain by the isotope derivative method. Biol. Chem. 87, 65–69. Wang, Y., Gu, W., Meng, Y., Xie, T., Li, L., Li, J., Wei, S., 2017. γ-Aminobutyric Acid imparts partial protection from salt stress injury to maize seedlings by improving photosynthesis and upregulating osmoprotectants and antioxidants. Sci. Rep. 7, 43609. https://doi.org/10.1038/srep43609. Wang, P., Sun, X., Li, C., Wei, Z., Liang, D., Ma, F., 2013. Long-term exogenous application of melatonin delays drought-induced leaf senescence in apple. J. Pineal Res. 54, 292–302. https://doi.org/10.1111/jpi.12017. Wen, T., Dong, L.J., Wang, L., Ma, F.W., Zou, Y.J., Li, C.Y., 2017. Changes in root architecture and endogenous hormone levels in two Malus rootstocks under alkali stress. Sci. Hortic. 235, 198–204. https://doi.org/10.1016/j.scienta.2017.09.015. Willson, K.G., Perantoni, A.N., Berry, Z.C., Eicholtz, M.I., Tamukong, Y.B., Yarood, S.A., Baldwin, A.H., 2017. Influences of reduced iron and magnesium on growth and photosynthetic performance of Phragmites australis subsp.aMericanus (North American common reed). Aquat. Bot. 137, 30–38. Xiang, L., Hu, L., Xu, W.N., Zhen, A., Zhang, L., Hu, X.H., 2016. Exogenous γAminobutyric acid improves the structure and function of photosystem II in Muskmelon seedlings exposed to salinity-alkalinity stress. PLoS One 11, e0164847. https://doi.org/10.1371/journal.pone.0164847. Xie, Y.P., Chen, P.X., Yan, Y., Bao, C.N., Li, X.W., Wang, L.P., Shen, X.X., Li, H.Y., Liu, X.F., Niu, C.D., Zhu, C., Fang, N., Shao, Y., Zhao, T., Yu, J.T., Zhu, J.H., Xu, L.F., Nocker, S.V., Ma, F.W., 2018. An atypical R2R3 MYB transcription factor increases cold hardiness by CBF-dependent and CBF-independent pathways in apple. New Phytol. 218, 201–218. https://doi.org/10.1111/nph.14952. Yang, C., Shi, D., Wang, D., 2008. Comparative effects of salt and alkali stresses on growth, osmotic adjustment and ionic balance of an alkali-resistant halophyte Suaeda glauca (Bge.). Plant Growth Regul. 56, 179–190. https://doi.org/10.1007/s10725008-9299-y. Yang, J.L., Zheng, S.J., He, Y.F., You, J.F., Zhang, L., Yu, X.H., 2016. Comparative studies on the effect of a protein-synthesis inhibitor on aluminium-induced secretion of organic acids from Fagopyrum esculentum Moench and Cassia tora L. Roots. Plant Cell Environ. 29 (2), 240–246. https://doi.org/10.1111/j.1365-3040.2005.01416.x. Yong, B., Xie, H., Li, Z., Li, Y.P., Zhang, Y., Nie, G., Zhang, X.G., Ma, X., Huang, L.K., Yan, Y.H., Peng, Y., 2017. Exogenous application of GABA improves PEG-Induced drought tolerance positively associated with GABA-shunt, polyamines, and proline metabolism in White Clover. Front. Physiol. 8, 1107. https://doi.org/10.3389/fphys.2017. 01107. Yu, G.H., Zou, J., Feng, J., Peng, X.B., Wu, J.Y., Wu, Y.L., Palanivelu, R., Sun, M.X., 2014. Exogenous γ-aminobutyric acid (GABA) affects pollen tube growth via modulating putative Ca2+-permeable membrane channels and is coupled to negative regulation on glutamate. J. Exp. Bot. 65, 3235–3248. https://doi.org/10.1093/jxb/eru171. Zhang, K.X., Wen, T., Dong, J., Ma, F.W., Bai, T.H., Wang, K., Li, C.Y., 2016. Comprehensive evaluation of 17 genotypes of apple rootstocks to alkali stress. J. Integr. Agric. 7, 1499–1509. https://doi.org/10.1016/S2095-3119(15)61325-9. Zhao, C.Z., Zayed, O., Yu, Z.P., Jiang, W., Zhu, P.P., Hsu, C.C., Zhang, L., Tao, W., Lozano, D.R., Zhu, J.K., 2018. Leucine-rich repeat extensin proteins regulate plant salt tolerance in Arabidopsis. PNAS 115, 13123–13128. https://doi.org/10.1073/pnas. 1816991115. Zhou, S.S., Li, M.J., Guan, Q.M., Liu, F.L., Zhang, S., Chen, W., Yin, L.H., Qin, Y., Ma, F.W., 2015. Physiological and proteome analysis suggest critical roles for the photosynthetic system for high water-use efficiency under drought stress in Malus. Plant Sci. 236, 44–60. https://doi.org/10.1016/j.plantsci.2015.03.017. Zhu, J.K., 2000. Genetic analysis of plant salt tolerance using Arabidopsis. Plant Physiol. 3, 941–948. https://doi.org/10.1104/pp.124.3.941.
Hoagland, D.R., Arnon, D.I., 1950. The water-culture method for growing plants without soil. Circ. Calif. Agric. Exp. Stat. 347, 357–359. Jin, X.Q., Liu, T., Xu, J.J., Gao, Z.X., Hu, X.H., 2019. Exogenous GABA enhances muskmelon tolerance to salinity-alkalinity stress by regulating redox balance and chlorophyll biosynthesis. BMC Plant Biol. 1, 19. https://doi.org/10.1186/s12870-0191660-y. Kalhor, M.S., Aliniaeifard, S., Seif, M., Asayesh, E.J., Bernard, F., Hassani, B., Li, T., 2018. Enhanced salt tolerance and photosynthetic performance: Implication of ɤ-amino butyric acid application in salt-exposed lettuce (Lactuca sativa L.) plants. Plant Physiol. Biochem. 130, 157–172. https://doi.org/10.1016/j.plaphy.2018.07.003. Li, Z., Yu, J., Peng, Y., Huang, B., 2017. Metabolic pathways regulated by abscisic acid, salicylic acid and γ-aminobutyric acid in association with improved drought tolerance in creeping bentgrass (Agrostis stolonifera). Physiol. Plant. 1, 42–58. https:// doi.org/10.1111/ppl.12483. Li, C., Sun, X.K., Chang, C., Jia, D.F., Wei, Z.W., Li, C.Y., Ma, F.W., 2015b. Dopamine alleviates salt-induced stress in Malus hupehensis. Physiol. Plant. 153, 584–602. https://doi.org/10.1111/ppl.12264. Li, C., Tan, D.X., Liang, D., Chang, C., Jia, D.F., Ma, F.W., 2015a. Melatonin mediates the regulation of ABA metabolism, free-radical scavenging, and stomatal behaviour in two Malus species under drought stress. J. Exp. Bot. 66, 669–680. https://doi.org/10. 1093/jxb/eru476. Li, W., Liu, J.H., Ashraf, U., Li, G.K., Li, Y.L., Lu, W.J., Gao, L., Han, F.G., Hu, J.G., 2016. Exogenous γ-aminobutyric acid (GABA) application improved early growth, net photosynthesis, and associated physio-biochemical events in Maize. Front. Plant Sci. 7, 919. https://doi.org/10.3389/fpls.2016.00919. Liang, B.W., Gao, T.T., Zhao, Q., Ma, C.Q., Chen, Q., Wei, Z.W., Li, C.Y., Li, C., Ma, F.W., 2018. Effects of exogenous dopamine on the uptake, transport, and resorption of apple ionome under moderate drought. Front. Plant Sci. 9, 755. https://doi.org/10. 3389/fpls.2018.00755. Liang, B.W., Li, C.Y., Ma, C.Q., Wei, Z.W., Wang, Q., Huang, D., Chen, Q., Li, C., Ma, F.W., 2017. Dopamine alleviates nutrient deficiency-induced stress in Malus hupehensis. Plant Physiol. Biochem. 119, 346–359. https://doi.org/10.1016/j.plaphy.2017.09. 012. Lichtenthaler, H.K., Wellburn, A.R., 1983. Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents. Biochem. Soc. Trans. 11, 591–592. Lin, Q., Qian, J., Zhao, C.N., Wang, D.L., Liu, C.R., Wang, Z.D., Sun, C.D., Chen, K.S., 2016. Low temperature induced changes in citrate metabolism in ponkan (Citrus reticulata Blanco cv. Ponkan) fruit during maturation. PLoS One 11 (6), e0156703. https://doi.org/10.1371/journal.pone.0156703. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. https://doi.org/10.1006/meth.2001.1262. Ma, B.Q., Chen, J., Zheng, H.Y., Fang, T., Ogutu, C., Li, S.H., Han, Y.P., Wu, B.H., 2015. Comparative assessment of sugar and malic acid composition in cultivated and wild apples. Food Chem. 172, 86–91. https://doi.org/10.1016/j.foodchem.2014.09.032. MacGregor, K.B., Shelp, B.J., Peiris, S., Bown, A.W., 2003. Overexpression of glutamate decarboxylase in transgenic tobacco plants deters feeding by phytophagous insect larvae. J. Chem. Ecol. 29, 2177–2182. Malekzadeh, P., Khara, J., Heydari, R., 2014. Alleviating effects of exogenous Gammaaminobutiric acid on tomato seedling under chilling stress. Physiol. Mol. Biol. Plants 20, 133–137. https://doi.org/10.1007/s12298-013-0203-5. Malekzadeh, P., Khosravi-Nejad, F., Hatamnia, A.A., Sheikhakbari, M.R., 2017. Impact of postharvest exogenous γ-aminobutyric acid treatment on cucumber fruit in response to chilling tolerance. Physiol. Mol. Biol. Plants 23, 827–836. https://doi.org/10. 1007/s12298-017-0475-2. Navarro, J.M., Martínez, V.V., Carvajal, M., 2000. Ammonium, bicarbonate and calcium effects on tomato plants grown under saline conditions. Plant Sci. 157, 89–96. https://doi.org/10.1016/S0168-9452(00)00272-7. Ohama, N., Sato, H., Shinozaki, K., Yamaguchi-Shinozaki, K., 2017. Transcriptional regulatory network of plant heat stress response. Trends Plant Sci. 22, 53–65. https:// doi.org/10.1016/j.tplants.2016.08.015. Ramesh, S.A., Kamran, M., Sullivan, W., Chirkova, L., Okamoto, M., Degryse, F., McLaughlin, M., Gilliham, M., Tyerman, S.D., 2018. Aluminum-activated malate transporters can facilitate GABA transport. Plant Cell 30, 1147–1164. https://doi. org/10.1105/tpc.17.00864. Ramesh, S.A., Tyerman, S.D., Xu, B., Bose, J., Kaur, S., Conn, V., Domingos, P., Ullah, S., Wege, S., Shabala, S., Feijó, J.A., Ryan, P.R., Gilliham, M., 2015. GABA signalling modulates plant growth by directly regulating the activity of plant-specific anion transporters. Nat. Commun. 28, 8293. https://doi.org/10.1038/ncomms9293. Renault, H., El-Amrani, A., Berger, A., Mouille, G., Soubigou-Taconnat, L., Bouchereau, A., Deleu, C., 2013. γ-Aminobutyric acid transaminase deficiency impairs central carbon metabolism and leads to cell wall defects during salt stress in Arabidopsis roots. Plant Cell Environ. 36, 1009–1018. https://doi.org/10.1111/pce.12033. Rincon, M., Gonzales, R., 1992. Aluminum partitioning in intact roots of aluminum-tolerant and aluminum-sensitive wheat (Triticum aestivum L.) cultivars. Plant Physiol. 99, 1021–1028. https://doi.org/10.1104/pp.99.3.1021. Roberts, E., Frankel, S., 1950. γ-aminobutyric acid in brain: its formation from glutamic
10