Exogenous potassium phosphite application improved PR-protein expression and associated physio-biochemical events in cucumber challenged by Pseudoperonospora cubensis

Scientia Horticulturae 234 (2018) 335–343

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Exogenous potassium phosphite application improved PR-protein expression and associated physio-biochemical events in cucumber challenged by Pseudoperonospora cubensis Moazzameh Ramezania, Fatemeh Ramezanib, Fatemeh Rahmania, Ali Dehestanic,

T

⁎

a

Department of Biology, Urmia University, Urmia, Iran Physiology Research Center, Iran University of Medical Sciences, Tehran, Iran c Genetics and Agricultural Biotechnology Institute of Tabarestan, Sari Agricultural Sciences and Natural Resources University, Sari, Iran b

A R T I C L E I N F O

A B S T R A C T

Keywords: Cucumis sativus Laccase Lignin Potassium phosphite PR genes Pseudoperonospora cubensis

In the present study, the effect of potassium phosphite on Pseudoperonospora cubensis-inoculated cucumber plants was investigated. Different defense-related enzymes including laccase, polyphenoloxidase and glucanase as well as total protein and lignin contents were analyzed. Anatomical alterations in plant tissues were analyzed using a light microscope. Expression changes in major pathogenesis-related genes were studied at different time courses. The highest expression of glucanase was observed in pre-inoculated plants (97% higher than control) at 24 h with 97% increase compared to the control plants, while Chitinase transcripts were accumulated at a maximum level in potassium phosphite-treated plants 96 h after inoculation with 93% increase over control plants. Analysis of polygalacturonase inhibitor proteins gene expression revealed a transcription peak (96% increase over control plants) 48 h after inoculation. The potassium phosphite-treated plants exhibited an increase in β-1,3-glucanase (82%) enzymatic activity as well as total protein (53%), polyphenoloxidase (21%), laccase (11%) and lignin contents (15%) in comparison to the control. The results of the anatomical assay showed an increase in the vascular bundle diameter in potassium phosphite-treated plants (174 μm) and a decrease in pathogen-treated leaves (66 μm) compared with the control (100 μm). It can be suggested that potassium phosphite treatment induced higher expression of plant defense genes and increased laccase and polyphenoloxidase activities which in turn enhanced lignin deposition in plant tissues. The findings of the present study would be implemented for designing a controlling program to decrease the adverse effect of Pseudoperonospora cubensis on cucumber plants.

1. Introduction Cucumber (Cucumis sativus L.) is one of the most widely cultivated vegetables in the world. Downy mildew caused by Pseudoperonospora cubensis is a major disease causing huge losses and posing a great threat to cucumber culture in humid regions of the world. Repeated use of the chemical fungicides, not only increase production costs but also is a real threat to public health and environment (Mofidnakhaei et al., 2016). Induction of plant immune system befor pathogen attack is an environmentfriendly disease control measure which has gained much attention in recent years. Activation of plant immune system by various chemical and bio-based elicitors should be an alternative method for improving plant tolerance to biotic stresses (Lim et al., 2013). It has been reported that several bio-based and chemical compounds can trigger plant defense responses without a real pathogen attack.

⁎

These compounds are known as resistance inducers or plant strengtheners and are extensively used in modern agriculture (Silva et al., 2011). Phosphites, the alkali salts of phosphorous acid, and phosphonates, esters of phosphonic acid, are generally known to control plant diseases through enhancin plant defense responses (Guest and Grant, 1991). Potassium phosphite (KPhi) exhibits a complex mode of action, including direct effects on the pathogen and indirect effects that stimulate host defense responses to ultimately inhibit pathogen growth (Guest and Grant, 1991). KPhi has been previously used for induction of resistance against various Oomycete pathogens such as Phytophthora spp. (King et al., 2010), and Pseudoperonospora spp. (Silva et al., 2011). It has been exhibited that KPhi may interfere with natural metabolism of the Oomycetes limiting their growth as well as stimulating plant defense mechanisms by increasing the synthesis and transport of secondary metabolites, such as phytoalexins (Oostendorp et al., 2001).

Corresponding author. E-mail address: [email protected] (A. Dehestani).

https://doi.org/10.1016/j.scienta.2018.02.042 Received 28 August 2017; Received in revised form 11 February 2018; Accepted 15 February 2018 0304-4238/ © 2018 Elsevier B.V. All rights reserved.

Scientia Horticulturae 234 (2018) 335–343

M. Ramezani et al.

Sari, Iran. The Isfahan native Cucumis sativus L. cultivar was used throuout the study. The seeds were purchased from Pakan Bazr Co., Isfahan, Iran and were planted on the surface of sterile soil mix (equal volumes of peat, perlite and coco peat) in 5-cm free-draining polyurethane pots. The plants were grown under controlled condition in a growth cabinet (16/8 h light/darkness photoperiod, 100 μ mol m−2 s−1 light intensity, 21 ± 1 °C and 70% humidity). For KPhi stock preparation (40 mL KOH and 20 mL phosphorus acid), phosphorous acid (AppliChem, Darmstadt, Germany) was partially neutralized with potassium hydroxide, and the pH was adjusted to 6.3. After second true leaf development, KPhi was applied to the plants as a foliar spray at a concentration of 2 gL−1 and was repeated three times with 3 h intervals (Mofidnakhaei et al., 2016).

Eshraghi et al. (2011) and Machinandiarena et al. (2012) reported that KPhi triggers disease resistance via tenhanced production of hydrogen peroxide, expression of PR1 and an increased accumulation of soluble proteins in Arabidopsis and potato plants (Silva et al., 2011; Farouk et al., 2017). It has been also suggested that KPhi improves plant general growth and triggers signaling cascades which lead to the overproduction of pathogenesis-related proteins (PR) and defensive metabolites after plants were infected with pathogen (Varadarajan et al., 2002). KPhi can induce resistance in plants by initiating the hypersensitivity response, which results in programmed death of the infected cells and increased enzymatic activity of the phenylpropanoid and systemic acquired resistance pathways for higher protection against pathogens (Eshraghi et al., 2011). The Plants response to pathogens is a complicated process and involves expression of a set of genes encoding different proteins that ultimately induce biochemical and physiological modifications in plants. These processes finally lead to increased production and accumulation of phenolic compounds, phytoalexins and pathogenesis-related (PR) proteins, which subsequently limit the pathogen development (Guzzo, 2003; Van Loon and Van Strien, 1999). PR proteins are pivotal factors during plant interaction with pathogens and each group of PR proteins might be part of the first line of defense against pathogens (Kadota et al., 2014). Among these PR proteins, β-1,3-glucanase, chitinase and polygalacturonase inhibitor proteins (PGIPs) which were investigated in the present study are among the major players in plant resistance against fungal pathogens (Adams, 2004). Plant β-1,3-glucanases play an important role in plant defense responses to pathogen infection by catalyzing cleavage of the cell walls of many pathogenic fungi (Adams, 2004), while chitinases hydrolyze the chitin in the fungal cell walls (Dehestani et al., 2009). The expression of chitinase has been shown to be correlated with systemic acquired resistance, which protects plants from different biotic stresses. PGIPs are extracellular proteins and are specific receptors for fungi and act by inhibiting fungal endopolygalacturonases (PGs) inhibiting their growth (De Lorenzo et al., 2001). Laccase enzymes, as major oxygen oxidoreductases, act on a broad range of oxidizable substrates localized in secondary cell walls throughout the protoxylem (Yamaguchi et al., 2010). The laccase gene family is also activated during lignification of metaxylem vessels (Berthet et al., 2011). Both laccase and polyphenol oxidize (PPO) enzyes contribute to lignin polymerisation pathway through oxidizing a wide range of phenolic substrates (Barzegargolchini et al., 2017). A deeper insight into the mechanisms by which KPhi activates the plant defence responses could be helpful for designing a practical strategy for controlling downy mildew in cucumber plants. In this study, we investigated the molecular, biochemical and anatomical responses of KPhi-treated cucumber plants inoculated with Pseudoperonospora cubensis to elucidate the exact physiological mechanisms by which potassium phosphite exerts its eff ;ects.

2.2. P. cubensis culture and plant inoculation Pseudoperonospora cubensis sporangia were obtained from leaves of infected cucumber plants in Sari Agricultural Sciences and Natural Resources University. The sporangia were collected by washing the infected leaves with distilled water and then collected in an 250 ml flask for plant inoculation. The concentration of the suspension was calculated using a haemocytometer and adjusted to 1 × 105 spores mL−1, which was used as inoculum for plant infection. For pathogen inoculation, plants with first fully expanded true leaf, were transferred to an inoculation room with a suitable temperature and relative humidity and were treated as follows: solely treated with 2 g L−1 KPhi (KPhi-treated plants), solely infected by P. cubensis (pathogen-treated plants), plants were inoculated with P. cubensis four days after treatment with 2 g L−1 KPhi (Pre-inoculation), eight days after P. cubensis inoculation plants were sprayed with 2 g L−1 KPhi (Post-inoculation) and control plants which were sprayed with distilled water. The plants were then transferred to a growth cabinet with 16/8 h light/dark photoperiod at 27 °C to allow lesions to develop. All experiments were performed in triplicate (biological replication). The samples were collected in aluminum foils and stored at −80 °C for molecular and biochemical assessments at different time points (24, 48, 72 and 96 h). 2.3. Molecular assays 2.3.1. RNA exctraction and first strand cDNA synthesis The fresh leaves (100 mg fresh weight) were ground in liquid nitrogen with mortar and pestle and total RNA was extracted from 100 mg of leave using the TRIzol protocol (Invitrogen,Carlsbad, CA,USA) according to the manufacturer’s instructions. Refering to manufacturers instructions fresh plant were exposed to trizol, chloroform, isoprppyl alchol, and 75% ethanol in RNase free water. Approximately 2 μg of total RNA was further treated with DNaseI and used for first-strand cDNA synthesis using oligo (dT) primers, 10 mM dNTPs, and reverse transcriptase according to the manufacturer’s instructions (Thermo Scientific, germany). The RNA concentration was determined by measuring the absorbance at 260 nm and its intensity was visualized in 1% agarose gels.

2. Materials and methods 2.1. Plant material and KPhi stock solution preparation

2.3.2. Real-time PCR analysis Aliquots of the cDNA were used as template for real-time PCR analysis. Primers were picked using Primer3 online software and were

This study was conducted in research greenhouse and laboratories of the Geneticsand Agricultural Biotechnology Institute of Tabarestan,

Table 1 Sequences of the gene-specific primer pairs used for real time analysis of potassium phosphite-treated andPsedoperonospora cubensis-inoculated cucumber plants. gene

Accession number

5’-Forward primer-3’

5’-Reverse primer-3’

glucanase chitinase pgip actin

JQ219048 M24365 JQ219049.1 XM_004135239.2

AGTTTCCACTGCGTTCCACACT GCGGTTTTGGATGGCGTTGAT TCCAATCTCGATGTTCTCGACCT GATTCTGGTGATGGTGTGAGTC

TAAGGGTACAAGTTGAGGAGCA GTCTAGGTGAGCGTCTGGTA GGTAGAGATAAGGGACTTTTCC TCGGCAGTGGTGGTGAACAT

336

Scientia Horticulturae 234 (2018) 335–343

M. Ramezani et al.

2.5. Anatomical studies

checked again using OLIGO5 analyzer software (Table 1). PCR was carried out using the one step SYBR® Green RT-qPCR with hot-start Taq DNA polymerase (Thermo Scientific) in a BIO-RAD real-time PCR machine (CFX96™ Touch Real-Time PCR Detection System) according to manufacturer's recommendations. The following program was used for the reactions: 3 min at 95 °C, denaturation at 95 °C for 25 s, annealing at 60 °C for 20 s and extension at 72 °C for 25 s for 40 cycles. A housekeeping gene (Actin) was used as reference gene for normalization, and comparative gene expression method (2−ΔΔcT) was used for data analysis. Relative quantification of gene expression was determined by amplifying the target genes as well as actin as reference gene. The specificity of the PCR reactions was confirmed by melting curve analysis of the products, as well as by size verification of the amplicons on 2% agarose gel.

Fresh handmade cross-sections of leaves were cleared with sodium hypochlorite then stained by carmine-vest for 5 min (1% w/v in 50% ethanol) and then immersed in methyl green for 10 s (1% w/v, aqueous). The reaction was stopped with distilled water and kept on gelatin. All stained sections were visualized using bright-field light microscopy under Olympus BH2 microscope and micrographs were recorded using a Nikon Coolpix 5400 digital camera. All the measurements and observations were performed 3 times on different slides by digimizer software (v4.1.1.0) with 3 repeats at each treatment. 2.6. Statistical analysis The experiments were arranged in a completely randomized design (CRD) with three biological replicates for each treatment. The least significant difference (LSD) was calculated for data that were significant at the 0.01 level. Analysis of variance and significant differences among means were analyzed by two-way ANOVA and the LSD for mean values using SPSS (version 23, SPSS, Chicago, IL); means were compared with SAS software (SAS Institute, Cary, NC), and graphs were generated in Microsoft Office Excel 2010.

2.4. Biochemical assays 2.4.1. Glucanase activity assay β-1,3 Glucanase activity was determined using 250 μL of a laminarin solution (1%) (Sigma) as the substrate that was dissolved in 50 m M Na-acetate buffer (pH 5.5), and 125 μL of enzyme solution (homogenate of 0.5 g leaf tissue and 4 mL of 0.05 M potassium acetate buffer (pH 5). The reaction mixture was kept at 37 °C for 1.5 h and stopped by addition of 1.5 mL of 3, 5-dinitrosalicylic acid reagent. Glucan catalysis was determined spectrophotometrically at 550 nm according to the method of Somogyi (1952). One unit of activity was defined as the amount of the enzyme that was required to catalyse the formation of 1 μmol of glucose in 1 min under standard conditions.

3. Results 3.1. Gene expression analysis Differential transcription levels of β-1,3-glucanase were clearly evident among the treatments (Fig. 1A). Following KPhi treatment, an increase in the transcript levels of β-1, 3-glucanase was noticed at 72 h (97%) and in pre-inoculated and post-inoculated plants at 48 h (98%, 98%), respectively, compared with the control. There was no difference in the highest level of transcription in either pre or post-inoculated plants. Chitinase transcription was induced in KPhi-treated, pre and postinoculated plants (Fig. 1B). Among all treatments, the KPhi-treated plants exhibited the highest accumulation of chitinase transcripts (93%) at 96 h compared with the control. In contrast, both control and pathogen-inoculated plants did not show any changes in expression throughout the experimental period. Pre-inoculated plants accumulated more transcripts (96%) than post-inoculated plants (48%) in comparison to the control. Transcript analysis of pgip revealed an increase in mRNA levels in response to KPhi treatment, pre and post-inoculation (Fig. 1C). In preinoculated plants, an 96% enhancement of the pgip transcript level was observed at 48 h. Under KPhi treatment (91%), the transcript level was consistently reduced at various time points compared with pre-inoculated plants. Post-inoculated plants showed a peak of pgip transcription at 96 h (85%) compared with the control at the same time point. Neither control nor fungus-infected plants showed any changes in transcription throughout the experiment and had the lowest levels of transcription.

2.4.2. Determination of polyphenoloxidase activity PPO activity was determined according to the method of Siriphanich and Kader (1985). The 1 mL reaction mixture contained 20 μL of enzyme extract (homogenate of 0.5 g leaf tissue and 4 mL of 0.05 M potassium acetate buffer (pH 5)) and 10 mM phosphate buffer (pH 7.0). Each sample was aerated for 2 min in a small test tube followed by the addition of catechol as the substrate at a final concentration of 20 mM. 2.4.3. Determination of laccase activity Laccase activity we measured using 2,2-azino-bis (3-ethyl-benzthiazoline-6-sulfonate), (ABTS) substrate. For this purpose, frozen plant samples were homogenized in 100 mM sodium acetate buffer at 4 °C. After centrifugation, the supernatant was mixed with ABTS. The reaction mixture was incubated for 5 min and absorbance was measured spectrophotometrically at 436 nm (Hoopes and Dean, 2001). 2.4.4. Determination of total protein content Total protein concentration in tplants from different treatments was assayed by Bradford method (1976). Bovine serum albumin (BSA) was used as the standard protein and the total protein concentration was measured by spectrophotometer at 550 nm. 2.4.5. Lignin measurement Lignin content was determined according to modified methods of Fukushima and Hatfield (2001). Briefly, the leaves were ground in 95% ethanol, and the reaction mixture was centrifuged at 3000 g at 4 °C for 10 min. The pellets were washed with 95% ethanol and hexane (1:2), and then dried. The dry powder was dissolved in 0.5 mL acetyl bromide (25%) and acetic acid for 30 min and was kept at 65 °C. Reaction mixture was cooled, then 0.9 mL of 2M NaOH was added to stop the reactionand then 0.1 mL of 7.5 M hydroxylamine-HCl and 5 mL acetic acid were added. About 0.1 mL of reaction mixture was diluted in 3 mL acetic acid. Finally, reaction mixture was centrifuged at 3000 g at 4 °C for 10 min and the absorbance was recorded spectrophotometrically at 280 nm.

3.2. Biochemical assays The KPhi-treated plants showed the highest glucanase activity (1.08 mg−1 proteins) at 96 ht that was again noticed in pre-inoculation plants at 96 h (Fig. 2A). The lowest enzyme activity (0.1 mg−1 proteins) was seen in control and post-inoculated plants at 24 h. The pre-inoculatation treatment was more effective (82%) than post-inoculated plants (68%) at 96 h compared to control. The peak of enzyme activity was exhibited at 96 h under all treatments except pathogen-inoculated plants which did not show any changes during experimental period. The result of protein assay indicated that, pre-inoculated plants exhibited highest protein content (96.98 mg g−1 FW) at 96 h (Fig. 2B) while controls showed lowest protein content (31.19 mg g−1 FW) at 337

Scientia Horticulturae 234 (2018) 335–343

M. Ramezani et al.

Fig. 1. A comparison of relative transcription level: (A) glucanase (B) chitinase (C) pgip in control, KPhi (leaves only treated by KPhi), pre-inoculation plant (leaves inoculated by P. cubensis after four day treatment by KPhi), post-inoculation plant (leaves treated by KPhi eight day after inoculated by P. cubensis), P. cubensis inoculated plant (leaves only inoculated by P. cubensis), at 24 h, 48 h, 72 h and 96 h after treatments in growing systems; data represent mean ± SD, n = 3; LSD: least significant difference; level of significance: P < 0.05.

Fig. 2. A comparison of biochemical content: (A) Glucanase activity (B) Protein content, in control, KPhi (leaves only treated by KPhi), pre-inoculation plant (leaves inoculated by P. cubensis after four day treatment by KPhi), post-inoculation plant (leaves treated by KPhi eight day after inoculated by P. cubensis), P. cubensis inoculated plant (leaves only inoculated by P. cubensis), at 24 h, 48 h, 72 h and 96 h hour after treatments in growing systems; data represent mean ± SD, n = 3; LSD: least significant difference; level of significance: P < 0.05.

338

Scientia Horticulturae 234 (2018) 335–343

M. Ramezani et al.

Fig. 3. A comparison of biochemical content: (A) PPO, (B) Laccase, (C) Lignin, in control, KPhi (leaves only treated by KPhi), pre-inoculation plant (leaves inoculated by P. cubensis four day after treatment by KPhi), post-inoculation plant (leaves treated by KPhi eight day after inoculated by P. cubensis), P. cubensis inoculated plant (leaves only inoculated by P. cubensis), at 24 h, 48 h, 72 h and 96 h after treatments in growing systems; data represent mean ± SD, n = 3; LSD: least significant difference; level of significance: P < 0.05.

Fig. 4. Correlation coefficient of lignin and Laccase enzyme activity (Significant at 5% probability).

activity. A steady state of increased laccase enzyme activity was detected during the experiment (Fig. 3B). The highest laccase activity (0.4 mg−1 protein) was observed at 96 h i KPhi-treated plants (11% more than the control), while the control exhibited the lowest enzymatic activity (0.34 mg−1 protein) at 24 h. Overall, the pre-inoculated plants showed a more effective induction of laccase activity, with a 4% higher increase rate than the post-inoculated plants, as compared with the control at 96 h. The lignin deposition analysis showed the highest lignin

24 h. Protein content slightly increased in KPhi-treated plants (69.2 mg g−1 FW) at 72 and 96 h. However, the pre-inoculated treatment induced protein content more effectively (53%) than post-inoculated (28%) at 96 h compared to control. Maximum PPO activity (5.95 g−1 FW) was detected in KPhi-treated plants at 96 h (Fig. 3A). The lowest activity was found in the control plants (2.9 g−1 FW) 24 h after inoculation. Pathogen-inoculated plants exhibited a 25% increase in PPO activity compared with control plants at 72 h. A comparison of the pre and post-inoculation results indicated that pre-inoculation was more effective (64%) than post-inoculation (41%) in terms of PPO 339

Scientia Horticulturae 234 (2018) 335–343

M. Ramezani et al.

Fig. 5. Transect of anatomic structures (μ) in cucumber leaf inoculated by P. cubensis and under KPhi treatment.

with KPhi displayed epidermis thickening, whereas reduced leaf epidermis thickness was observed in leaves infected with P. cubensis. As shown in Fig. 5, KPhi and pre-inoculated leaves showed an increase in xylem thickness (28% and 17%) and phloem thickness (34% and 22%) compared with the control, but the pathogen-inoculated leaves showed a decrease in xylem (15%) and phloem (57%) thickness compared with the control. Additionally, an increase in leaf thickness was detected in KPhi and pre-inoculated and a decrease in pathogen -inoculated plants compared with the control. Compared with the control (Fig. 5A), pre-inoculated plants showed a significant increase in lignin accumulation in epidermal cell walls.

accumulation in both KPhi and pre-inoculated plants at 72 and 96 h (18.9%) (Fig. 3C). Interestingly, P. cubensis-inoculated plants showed minimum lignin accumulation compared with other treatments (11.9%) at 96 h. In contrast to other treatments, pathogen-inoculated plants showed a decrease in lignin deposition over time. Lignin deposition in pre-inoculated plants was 3% higher than the post-inoculation treatment at this time point. The correlation coefficient between lignin synthesis and Laccase activity is shown in Fig. 4. This result suggested that KPhi treatment could significantly increase Laccase activity, suggesting a positive corelation between lignin depositions, laccase activity and enhancing the ability of plant resistance against pathogen.

4. Discussion 3.3. Anatomic changes in lignin deposition in P. cubensis-inoculated Cucumis sativus

Plants respond to pathogen attack or elicitor treatments by activating a wide variety of protective mechanisms to prevent disease development (Malolepsza and Rózalaska, 2005; Farouk et al., 2017). These defense mechanisms include reactive oxygen species production (De Gara et al., 2003), cell wall constitution alterations, phytoalexins and anti-fungal secondary metabolism accumulation (Agrios, 2005), and the activation of defense-related protein (Castro and Fontes, 2005).

According to the results of leaf transect analyses (Fig. 5), the epidermis thickness, leaf thickness, xylem thickness, phloem thickness and vascular bundles showed significant differences (P ≤ 0.05) compared with the control (Table 2), whereas there were no significant differences in cuticle thickness (data not shown). The sections of leaf treated

Table 2 Means comparison of leaf transect analysis in control, KPhi, Pre-inoculated and P. cubensis inoculated plants in cucumis sativus. Treatments Parameter Epidermis Thickness (μ) leave thickness (μ) Xylem thickness (μ) Phloem thickness (μ)

Control

KPhi d

72 ± 1.15 203 ± 0.57 d 46 ± 0.86 d 45.4 ± 0.86 d

Pre-inoculated leaf c

95.5 ± 0.86 270 ± 0.57 c 64 ± 0.57 c 69 ± 0.57 c

b

80.2 ± 0.52 220 ± 0.57 b 56 ± 0.57 b 58 ± 0.57 b

Fungal inoculation leaf 67 ± 0.33 a 160 ± 0.57 a 39.8 ± 0.57 a 19 ± 0.57 a

The data represent mean ± SD, n = 3; LSD: least significance difference; Different lower case letters mean significant differences according to LSD (P < .05).

340

Scientia Horticulturae 234 (2018) 335–343

M. Ramezani et al.

and penetration into the cell, leading to lignin decomposition. However, in post-inoculated plants, KPhi directly inhibited pathogen growth before association with the host, and therefore alterations in host defense mechanisms occurred at a slower rate than in the pre-inoculated plants. This result indicates that KPhi signals could be transduced in plants and trigger SAR in cucumber leaves (Hoopes and Dean, 2001). In the present study, the deposition of lignin and related enzymes were simultaneously analyzed. Lignin metabolism depends on various enzymes, like laccases and PPO that both of them are considered to be oxidizing enzymes in the accumulation of lignin (Berthet et al., 2011). Lignin was initially observed in the corner of the cell, followed by pervasion into the intercellular space. Lignification, as a physical barrier, has been reported to be advantageous to arrest invasion by fungi, bacteria and viruses (Dean and Kuc, 1987). The alterations of enzymatic activities (laccase and PPO) and lignin accumulation further support this result (Fig. 4A– C). The changes in these three factors showed a similar trend and could reflect each other such that laccase activity increased in response to KPhi, pre and post-inoculation, in comparison to the control, with the highest activity detected in KPhi and pre-inoculated plants at 96 h (Fig. 3B). Berthet et al. (2011) demonstrated that specific LACs are involved in monolignol polymerization in planta by characterizing Arabidopsis lac4lac17 double mutants. The role of laccase during lignification is supported by transcription profiles related to the co-regulation of laccase and lignin monomer biosynthesis genes, laccases as secondary cell wall-forming genes (Brown et al., 2005) and the expression of laccase in lignifying tissues in Arabidopsis (Berthet et al., 2011). Additionally, enzymatic activity assays revealed the high activity of laccase during xylem lignification in several species (Caparrós-Ruiz et al., 2006). In addition, PPO activity increased in the tissues of KPhi, pre-inoculated (highest activity) and post-inoculated plants following inoculation by P. cubensis in comparison to controls. This finding potentially suggests that the induction of PPO activity in KPhi-treated plants could serve as a late-stage (at 96 h) defense response against P. cubensis (Fig. 3A). During the defense response, PPO is associated with thickening of the plant cell wall, which could form a stronger physical barrier against pathogen invasion. The changes in three factors, laccase activity, PPO activity and lignin accumulation, displayed the same trend and could effect each other. The results showed that laccase has a positive correlation with lignin synthesis (Fig. 4). These results also support a role for KPhi as a signal involved in triggering a defensive response in the plant. A number of studies have correlated the induction of PPO with the resistance response (Ramezani et al., 2017). Histochemical staining also indicated that KPhi treatment and P. cubensis pathogen caused changes in metabolically active tissues (phloem and xylem) of cucumber leaf. In the case of lignin, increased lignification was detected in protective tissues (epidermis) in pre-inoculated plants, which could prevent the spread of the microbes throughout the plant. The accumulation of lignin could also limit the diffusion of microbial enzymes and toxins, as well as the uptake of water and nutrients by the microorganisms (Dean and Kuc, 1987). Thus, lignification represents an important structural defense mechanism that is used by plants against microorganisms. An anatomical analysis of transected cucumber leaves from plants treated with KPhi and inoculated with P. cubensis showed an increase in the xylem and phloem thickness in KPhi-treated and a decrease in pathogen-inoculated leaves compared with the control. Leaf infection by P. cubensis in the xylem causes drastic metabolic changes in xylem parenchyma cells. An increase in the thickness of protective tissues could prevent the spread of pathogen throughout the plant cell wall. Since P. cubensis can infect their host by invading the vascular tissue, there is ultimately some alternations in chemical compounds and deformation of anatomical structures in the vascular tissue of leaves (Silva et al., 2011; Farouk et al., 2017).

In this study, some defense genes expression, biochemical production and enzymes activation was occours after KPhi treatment and pathogen inoculation in cucumber plant. The defense reactions against P. cubensis was induced 24 h after KPhi treatment, and resistance was sustained even at 96 h after treatment (Fig. 1A–C). Real-time PCR analysis demonstrated that the effect of KPhi treatment includes activation of genes associated with cell wall degredation processes such as glucanase, chitinase and pgip. ß-1, 3-glucanase, chitinase and pgip act as hydrolytic enzymes and directly contribute to pathogen cell wall degradation and membrane integrity disruption. The results of this study showed significantly higher transcription levels of these hydrolytic enzymes in KPhi, pre-inoculated and post-inoculated plants compared to control and pathogen-inoculated plants. This result suggests that the pre-activation of these genes in KPhi-treated plants before inoculation facilitates rapid defense responses and contributes to increased levels of disease resistance of the host plant. Glucanase demonstrated a much more pronounced effect of KPhi at 48 h in KPhi, pre and post-inoculated plants, revealing the cell wall modification process (Fig. 1A). ß-1, 3-glucanase hydrolyzes ß-1, 3glucan, which is the main component of the plant cell wall. Similar to our results, plants inoculated with Pycnoporus. sanguineous display a sharp increase in ß-1, 3-glucanase activity that results in degradation of the fungal cell wall (Gerhard and Frederick, 1999). The enhanced induction of β-1, 3-glucanase in KPhi-treated plants indicates that the β-1, 3-glucanase activity of PR-2 might weaken the fungal cell wall and prevent hyphal colonization (Menu-Bouaouiche et al., 2003). Reuveni et al. (1995) reported that PPO and β-1, 3-glucanase contribute to the crosslinking of cell wall components, polymerization of lignin and resistance to pathogen in several host plant-pathogen interactions. The results of the chitinase transcript analysis revealed induction of mRNA levels in response to KPhi and pre-inoculation conditions at 96 h, clearly indicating the occurrence of cell wall modifications (Fig. 1B). This result likely supports the efficient antifungal activity of KPhi, as mentioned by Deliopoulos et al. (2010). Similar to our results, increased peroxidase, polyphenol oxidase, and chitinase activities were detected in cucumber leaves in the vicinity of lesions caused by pathogens or phosphate application (Avdiushko, 1993). Pgip transcript analysis showed mRNA enhancement at 24 h after KPhi and pre-inoculation, with a much greater increase in transcription in pre-inoculated plants (Fig. 1C). The pgip is a cell-wall associated protein and plays important roles in plant defense. KPhi induced pgip overexpression can alter the properties of the cell wall prior to pathogen inoculation (Alexandersson et al., 2011). However, in the present work, the increased transcript level of glucanase in fungus-inoculated plants appeared to act as an indicator of the general host response rather than as a defense mechanism, as reported for other host plants (Lattanzio, 2003). The transcription of chitinase and pgip in pathogen-inoculated plants also did not show any change in gene expression compared with the control (Fig. 1B and C). The Real-time PCR analysis of glucanase transcription provided results that were consistent with its enzymatic activity, revealing higher activity of the enzyme in response to KPhi, pre and postinoculated treatments (Fig. 1A). This result demonstrated a relationship between glucanase gene expression and its enzymatic activity and the positive effect of KPhi on increasing of them. Lim et al. (2013) identified significant changes in abundance of numerous proteins after KPhi treatment in potato. Additionally, the increase in protein content could be due to the energy requirements for plant defense mechanisms (Larcher, 2000). After induction by KPhi, the lignin content in the cell walls consistently changed, as shown in Fig. 3C. The highest amount of lignification in leaf tissue was observed in KPhi and pre-inoculated plants at 96 h, which could prevent pathogen development throughout the plant (Fig. 3C). Regarding the speed of lignification, the application of KPhi was very effective because the lignin content increased in KPhi and pre-inoculated leaves. The decrease in lignin accumulation in pathogen-inoculated plants was due to fungal attachment to the cell wall 341

Scientia Horticulturae 234 (2018) 335–343

M. Ramezani et al.

authors also wish to thank the laboratory staff of GABIT for their technical assistance.

Chemical compounds that accumulate in xylem sap after infection modulate the morphology of the xylem tissue. In contrast, physical defense responses mainly prevent the spread of pathogens in the xylem vessels (Hilaire et al., 2001). In the present study, we observed a positive relationship between lignin content and the results of the anatomical transection. These metabolic changes lead to an accumulation of different proteins and secondary metabolites in the xylem sap. Some of the proteins and secondary metabolites that accumulate in the xylem sap during xylem colonization include PR-proteins, peroxidases, phenols, proteases, phytoalexins, and lignin (Hilaire et al., 2001; Basha et al., 2010; Gayoso et al., 2010). These compounds are known to contribute directly or indirectly to plant defense (Passardi et al., 2005). The differential expression of defense genes in pre and post-inoculated plants demonstrates their alterations as a physiological response of the host to the elicitor treatment. In this study, pre-inoculation was more effective than post-inoculation in terms of the transcript levels of chitinase and pgip. The induction of plant defense systems by biotic and abiotic stresses such as KPhi prior to pathogen attack may be useful for effective control of plant protection. Dharani et al. (2014) reported alterations in the expression of four defense related proteins in Phytophtora leaves that had been pre-inoculated with KPhi, as compared with pathogen-inoculated and control plants. Based on this observation, they proposed that KPhi induced defense mechanisms prior to pathogen inoculation. The induction by KPhi results from rapid downward systemic activity and has been shown to be most effective when KPhi is applied prior to inoculation (pre-inoculated plants). After KPhi application, the plants were clearly sensitized to pathogen infection and could promptly trigger a defense response against pathogens.

References Adams, D.J., 2004. Fungal cell wall chitinases and glucanases. Microbiology 150, 2029–2035. Alexandersson, E., Becker, J.V., Jacobson, D., Nguema-Ona, E., Steyn, C., Denby, K.J., Vivier, M.A., 2011. Constitutive expression of a grapevine polygalacturonase inhibiting protein affects gene expression and cell wall properties in uninfected tobacco. BMC Res. Notes 4, 488–493. Agrios, G.N., 2005. Plant Pathology, 5th ed. Academic Press, San Diego, USA. Avdiushko, S.A., 1993. Detection of several enzymatic activities in leaf prints of cucumber plants. Physiol. Mol. Plant Pathol. 42, 441–454. Barzegargolchini, B., Movafeghi, A., Dehestani, A., Mehrabanjoubani, P., 2017. Increased cell wall thickness of endodermis and protoxylem in Aeluropus littoralis roots under salinity: the role of LAC4 and PER64 genes. J. Plant Physiol. 218, 127–134. Basha, S., Mazhar, H., Vasanthaiah, H., 2010. Proteomics approach to identify unique xylem sap proteins in Pierce’s disease-tolerant Vitis species. Appl. Biochem. Biotechnol. 160, 932–944. Berthet, S., Demont, Caulet., Pollet, N.B., Bidzinski, P., Cezard, L., Le Bris, P., Borrega, N., Herve, J., Blondet, E., Balzergue, S., Lapierre, C., Jouanin, L., 2011. Disruption of LACCASE4 and 17 results in tissue specific alterations to lignification of Arabidopsis thaliana stems. Plant Cell. 23, 1124–1137. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 341–374. Brown, D.M., Leo, A.H.Z., Ellis, J., Goodacre, R., Turner, S.R., 2005. Identification of novel genes in Arabidopsis involved in secondary cell wall formation using expression profiling and reverse genetics. Plant Cell 17, 2281–2295. Caparrós-Ruiz, D., Fornale, S., Civardi, L., Puigdomenech, P., Rigau, J., 2006. Isolation and characterisation of a family of laccases in maize. Plant Sci. 171, 217–225. Castro, M.S., Fontes, W., 2005. Plant defense and antimicrobial peptides. Pept. Lett. 12, 11–16. Dehestani, A., Kazemitabar, K., Ahmadian, G., Babaeian, N., Salmanian, A.H., Seyedi, M., Rahimian, H., Ghasemi, S., 2009. Chitinolytic and antifungal activity of a Bacillus pumilus chitinase expressed in Arabidopsis. Biotechnol. Lett. 32, 539–546. Dean, R., Kuc, J., 1987. Rapid lignification in response to wounding and infection as a mechansim for induced system protection in cucumber. Physiol. Mol. Plant Pathol. 31, 69–81. De Lorenzo, G., D Ovidio, R., Cervone, F., 2001. The role of polygalacturonase-inhibiting proteins (PGIPs) in defense against pathogenic fungi. Annu. Rev. Phytopathol. 39, 313–335. De Gara, L., de Pinto, M.C., Tommasi, F., 2003. The antioxidant systems vis-a-vis reactive oxygen species during plant pathogen interaction. Plant Physiol. Biochem. 41, 863–870. Deliopoulos, T., Kettlewell, P.S., Hare, M.C., 2010. Fungal disease suppression by inorganic salts: a review. Crop Prot. 29, 1059–1075. Dharani, D.B., Berkowitz, O., Hedley, P.E., Morris, J., 2014. Phosphite-induced changes of the transcriptome and secretome in Solanum tuberosum leading to resistance against Phytophthora infestans. BMC Plant Biol. 14, 254–268. Eshraghi, L., Anderson, J., Aryamanesh, N., Shearer, B., McComb, J., Hardy, G.E., O’Brien, P.A., 2011. Phosphite primed defense responses and enhanced expression of defense genes in Arabidopsis thaliana infected with Phytophthora cinnamomi. Plant Pathol. 60, 1086–1095. Farouk, S., Belal, B.E.A., EL-Sharkawy, H.H.A., 2017. The role of some elicitors on the management of Roumy Ahmar grapevines downy mildew disease and its related to inducing growth and yield characters. Sci. Hortic. 225, 646–658. Fukushima, R.S., Hatfield, R.D., 2001. Extraction and isolation of lignin for utilization as a standard to determine lignin concentration using the Acetyl bromide spectrophotometric method. Agric. Food Chem. 49, 31–33. Gayoso, C., Pomar, F., Novo-Uzal, E., Merino, F., Martinez de Ilarduya, O., 2010. The Vemediated resistance response of the tomato to Verticillium dahliae involves H2O2, peroxidase and lignins and drives PAL gene expression. BMC Plant Biol. 10, 232. Gerhard, L.M., Frederick, M.J., 1999. Functions and Regulation of Plant ß-1, 3-Glucanases (PR-2). pp. 49–75. Guest, D.I., Grant, B.R., 1991. The complex action of phosphonates as antifungal agents. Biol. Rev. 66, 159–187. Guzzo, S.D., 2003. Pathogen related proteins. Revisao Anual de Patologias de Plantas 11, 283–332. Hilaire, E., Young, S.A., Willard, L.H., McGee, J.D., Sweat, T., Chittoor, J.M., 2001. Vascular defense responses in rice: peroxidase accumulation in xylem parenchyma cells and xylem wall thickening. Mol. Plant Microbe Interact. 14, 1411–1419. Hoopes, J.T., Dean, J.F.D., 2001. Staining electrophoretic gels for Laccase and Peroxidase activity using 1, 8-Diaminonaphthalene. Anal. Biochem. 293, 96–101. Kadota, Y., Sklenar, J., Derbyshire, P., Stransfeld, L., Asai, S., Ntoukakis, V., 2014. Direct regulation of the NADPH oxidase RBOHD by the PRR-associated kinase BIK1 during plant immunity. Mol. Cell 54, 1–13. King, M., Reeve, W., Vander, A., 2010. Defining the phosphite-regulated transcriptome of the plant pathogen Phytophthora cinnamomi. Mol. Genet. Genom. 284, 425–435. Larcher, W., 2000. Expression of ascorbic acid oxidase in zucchini squash (cucurbita pepoL). Plant Physiol. 96, 159–165. Lattanzio, V., 2003. In: Imperato, F. (Ed.), Advances in Phytochemistry, pp. 271–281 ISBN. 81.

5. Conclusion In conclusion, it seems physiological, molecular and anatomical defense pathways are involved in defense that lead to enhanced resistance after pathogen inoculation. The primary metabolism and cell wall associated metabolic processes are influenced by KPhi. The detailed investigation of these processes, e.g. cell wall composition and structure, will clarify and confirm our knowledge of KPhi induced resistance. It can be concluded that the KPhi is an inducer of defensive system against P. cubensis by increasing transcription level of genes related to cell wall including ß-1, 3-glucanase, chitinases, pgip and activity of defense enzymes like laccase and ultimately lignin synthesis. Additionally, increase in the content of protein was due to energy synthesis required for plant defense mechanism to provide more energy to promote plant growth and resist debilitation reduce the disease. These genes, enzymes and proteins might work cooperatively to enhance resistance to pathogen attack. This research enriched our understanding about choose best time of induction (pre and post inoculation) to promotes protection from pathogen infection. Author contribution statement MR conducted the research and analyzed the data; MR and FR wrote the paper; AD designed the research, wrote the paper and had primary responsibility for the final content. All authors have read and approved the final manuscript. Conflict ofinterest The authors declare that they have no conflict of interest. Acknowledgments This study was conducted using funds provided by Genetics and Agricultural Biotechnology Institute of Tabarestan (GABIT) at Sari Agricultural Sciences and Natural resources University, Sari, Iran. The 342

Scientia Horticulturae 234 (2018) 335–343

M. Ramezani et al.

elicited by potassium phosphite in downy mildew-infected cucumber plants. Arch. Phytopathol. Plant Prot. 1–15. Reuveni, M., Agapov, G., Reuveni, R., 1995. Suppression of cucumber powdery mildew (Sphaerotheca fuliginea) by foliar sprays of phosphate and potassium salts. Plant Pathol. 44, 31–39. Siriphanich, J., Kader, A.A., 1985. Effects of CO2 on cinnamic acid 4-hydroxylase in relation to phenolic metabolism in lettuce tissue. J. Am. Soc. Hortic. Sci. 110, 333–335. Somogyi, M., 1952. Notes on sugar determination. J. Biol. Chem. 195, 19–23. Silva, O.C., Santos, H.A.A., Dalla Pria, L.L., 2011. Potassium phosphite for control of downy mildew of soybean. Crop Prot. 30, 598–604. Van Loon, L.C., Van Strien, E.A., 1999. The families of pathogenesis related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol. Mol. Plant Pathol. 55, 85–97. Varadarajan, D.K., Karthikeyan, A.S., Matilda, P.D., Raghothama, K.G., 2002. Phosphite, an analog of phosphate, suppresses the coordinated expression of genes under phosphate starvation. Plant Physiol. 129, 1232–1240. Yamaguchi, M., Goue, N., Igarashi, H., Ohtani, M., Nakano, Y., Mortimer, J.C., Nishikubo, N., Kubo, M., Katayama, Y., Kakegawa, K., Dupree, P., Demura, T., 2010. Vascularrelated NAC-DOMAIN6 and vascular-related NAC-DOMAIN7 effectively induce trans differentiation into xylem vessel elements under control of an induction system. Plant Physiol. 153, 906–914.

Lim, S., Borza, T., Peters, R.D., Coffin, R.H., Al-Mughrabi, K.I., Pinto, D.M., Wang-Pruski, G., 2013. Proteomics analysis suggests broad functional changes in potato leaves triggered by phosphites and a complex indirect mode of action against Phytophthora infestans. Proteomic 93, 207–223. Machinandiarena, M.F., Lobato, M.C., Feldman, M.L., Daleo, G.R., Andreu, A.B., 2012. Potassium phosphite primes defense responses in potato against Phytophthora infestans. Plant Physiol. 169, 1417–1424. Malolepsza, U., Rózalaska, S., 2005. Nitric oxide and hydrogen peroxide in tomato resistance. Nitric oxide modulates hydrogen peroxide level in O. hydroxyethylorutininduced resistance to Botrytis cinerea in tomato. Plant Physiol. Biochem. 43, 623–635. Menu-Bouaouiche, L., Vriet, C., Peumans, W.J., Barre, A., Van Damme, E.J.M., Rouge, P., 2003. A molecular basis for the endo-β1, 3-glucanase activity of the thaumatin-like proteins from edible fruits. Biochimie 85, 123–131. Mofidnakhaei, M., Abdossi, V., Dehestani, A., Pirdashti, H., Babaeizad, V., 2016. Potassium phosphite affects growth, antioxidant enzymes activity and alleviates disease damage in cucumber plants inoculated with Pythium ultimum. Arch. Phytopathol. Plant Prot. 49, 207–221. Oostendorp, M., Kunz, B., Dietrich, K., Staub, T., 2001. Induced resistance in plants by chemicals. Plant Pathol. 107, 19–28. Passardi, F., Cosio, C., Penel, C., Dunand, C., 2005. Peroxidases have more functions than a Swiss army knife. Plant Cell Rep. 24, 255–265. Ramezani, M., Rahmani, F., Dehestani, A., 2017. Study of physio-biochemical responses

343