Exon-intron organization, expression, and chromosomal localization of the human motilin gene

V o l u m e 249, n u m b e r 2, 2 4 8 - 2 5 2

F E B 07196

J u n e 1989

Exon-intron organization, expression, and chromosomal localization of the human motilin gene H. Yano, Y. Seino*, J. Fujita, Y. Yamada, N. Inagaki, J. Takeda*, G.I. Bell +, R.L. Eddy*, Y.-S. Fan t, M.G. Byers t, T.B. Shows t and H. Imura Second Division, Department of Internal Medicine and *Division of Metabolism and Clinical Nutrition, Kyoto University School of Medicine, Kyoto 606, Japan, +Howard Hughes Medical Institute and Departments of Biochemistry and Molecular Biology and of Medicine, The University of Chicago, Chicago, IL 60637 a n d t Department of Human Genetics, Roswell Park Memorial Institute, New York State Department of Health, Buffalo, N Y 14263, USA Received 20 M a r c h 1989 The human motilin gene has been isolated and characterized. The gene spans about 9 kilobase pairs (kb) and the 0.7 kb motilin mRNA is encoded by five exons. The 22-amino-acid motilin sequence is encoded by exons 2 and 3. The human m0tilin gene was mapped to the p21.2 ~p21.3 region of chromosome 6 by hybridization of the cloned cDN'A to DNAs from a panel of reduced human-mouse somatic cell hybrids and by in situ hybridization to human prometaphase chromosomes. RNA blotting using RNA prepared from various regions of the human gastrointestinal tract revealed high levels of motilin mRNA in duodenum and lower levels in the antrum of the stomach; motilin mRNA could not be detected by this procedure in the esophagus, cardia of the stomach, descending colon or gallbladder. Motilin gene; Chromosome 6; (Duodenum, Stomach, Human)

1. INTRODUCTION Motilin is a 22-amino-acid polypeptide originally isolated from porcine intestine by Brown et al. [1,2]. Physiological studies suggest that it plays an important role in the regulation of interdigestive gastrointestinal motility and indirectly causes rhythmic contraction of duodenal and colonic smooth muscle [3,4]. The isolation of cDNAs encoding human and porcine motilin indicates that both are derived by proteolytic processing of precursors consisting of 115 and 119 amino acids, respectively [5,6]. Interestingly, a search of both Correspondence address: H. Yano, Second Division, Department of Internal Medicine, Kyoto University School of Medicine, 54 Shogoin Kawahara-cho, Sakyo-ku, Kyoto 606, Japan Abbreviation: MLN, motilin gene The nucleotide sequence presented here has been submitted to the EMBL/GenBank database under accession no.Y07505

protein and nucleic acid sequence data bases showed that the sequences of motilin and its precursor are unrelated to any other polypeptide hormones. This is in contrast to most other gastrointestinal hormones which are members of gene families. As a first step in studying the regulation of motilin gene expression, we have isolated and characterized the gene encoding this unique gastrointestinal hormone. We also have determined the chromosomal localization of the human motilin (designated MLN) gene and the distribution of motilin transcripts in several regions of the human gastrointestinal tract.

2. MATERIALS AND METHODS 2.1. Isolation of the human motilin gene A human genomic library [7] was screened by hybridization with the human motilin cDNA clone phMot-1 [5] by procedures essentially as described by Maniatis et al. [8]. The exons were located using standard procedures and sequenced using the dideoxy chain-termination method [9].

Published by Elsevier Science Publishers B.V. (BiomedicalDivision)

248

00145793/89/$3.50 © 1989 Federation of European Biochemical Societies

V o l u m e 249, number 2

A

FEBS L E T T E R S

2hMot

4: I

~hMot

1 :

June 1989

I

I I

Exon 5'',

B

E

B

H

I

1

I

1

2

3

•

ml

•

45

I

I kb I

13'

mRNA poly (A+ )

peptide//~''~ 3'-UT~ Fig. 1. Structure of the human motilin gene. (A) Schematic representation of the extent of the inserts in AhMot-1 and -4. (B) Map of the motilin gene. The filled boxes indicate the positions of exons 1-5. The relationship of each exon to the mature mRNA is indicated. UT represents the untranslated region. The restriction sites are: E, EcoRI; H, HindII]; and B, BamHI.

S " .............. a c g t

caccaa

-30T t g -241

tcatatat

t taaggaacaaaaaaagaaaaggct

t tgt

taaaatgacctctgagatgcagc ~181

tgagttttcagtggacgggagaatgccatctgggtgggggctagcttccaccgaaccctg ~121

actgtcgctgttccttccaggaaagccctggaagcccatagcgtggctagccctgcctgg -61

agt

t tccacgagct

tcaagaatccaggctccccctctgagggcccccaaagctgtggtca -

1

aaggttaatgggctccaagggcagctcccagggttgggaggtatataagaacccgtcaga 1 30 TCAGCCGGACACCAGAAGACAAGCAGAGAGACTCCTCCAGACCCACTCAGACCACGTGCA T CGCCgt

aagt

agcc

............ I n t

ton1

(~2.7kb) ..................... c a t t g t

60

ccagCTCCAAGATGGTA MetVal

90 120 TCCCGTAAGQCTGTGGCTGCTCTGCTGGTGGTGCATGTAGCTGCCATGCTGGCCTCCCAG Se rArgLysAI aVa IAI aAI aLeuLeuVa IVa IHi sVa IAI aAI aMet LeuAI

150 180 ACGGAAGCCTTCGTCCCCATCTTCACCTATGQCQAACTCCAQAQGATGCAGgt ThrGI uAI aPheVa IPro 11 e P h e T h r T y r Q I yGI uLeuQI nArgMe c ............ I n t

ton2

( ~ l . T k b ) ..................... c t g c c c c

n

210 t agQAAAAGGAACGGAATAAAGGGCAAAA GI uLysGI uArgAsnLysGI yGI

gagcagac

n

aaagaac tGI

240 GAAATCCCTGAGTGTATGQCAGAGGTCTGGGGAGQAAGGTCCTGTAGACCCTGCQGAGCC sLysSerLeuSerVa ITr PGI nArgSerGI yGI uGI uGI yPr oVa IAspproAi 300 CATCAQQGAAGAAGAAAACGAAATQATCAAQgt o I I eArgGI uGI uGI uAsnQI uMet I I eLys

aSerGI

nLy

270 aGi

..................... I n t r o n 3

uPr

(~3.5kb)

330 ........... t a t t t c a c a g C T Q A C T G C T C C T C T G ~ A A A T T G G A A T G A G G A T G A A C T C C A G A C A G C LeuThrAI aProLeuQI u I I eGI yMetArgMetAsnSerArgGi 360 390 TGGAAAAGTACCCGGCCACCCTGGAAGGGCTGCTGAGTGAGATGCTTCCCCAGCATGgt euOI uLysTyrProAI aThr LeuGI uGI yLeuLeuSe rGI uMe t LeuProGi cggggag

............ I n t r o n 4

a nHi

480

510 ACAGAQCCTGCCAGCTGGQCTTGGAAQGAAAACACCTTTCCAAAGCAAATTCCCCTCCAG

540

570 CAAATAAAGCATGAAATATACAGaaat caggt

sA

420 (~0.7kb) ..................... t t t t c t c c a g C A G C C A A G T G A T G G C C A C G C I aAI aLys***

450 TGGGGAGAAGGTGGACAQATTTGGGAGGCCCCTCCTGCCCAAGTGAGGCCCTGGGAATTT

act

nL

630 cgcaagaaaaagggggggaaagt

gac

600 t c t t a t t t aa t a t t t t aa t t ccaaaggcaa aaagc

t cagagaaag

660 t t ggcca

t a

............

3"

Fig.2. Partial nucleotide sequence of the human motilin gene. Exon sequences ~ e shown in capital letters and intron and flanking sequences are in lower case letters. Nucleotides in the exons are numbered relative to the transcriptional start site. The approximate size of each intron is also indicated. A single base substitution relative to the cDNA sequence in the 5' -untranslated region is indicated. The motilin moiety, putative TATA motif and polyadenylation signal are noted. 249

Volume 249, number 2

FEBS LETTERS

2.2. Primer-extension to map the 5 '-end of motilin mRNA The transcriptional start site was determined by extension of the 32p-labeled 20-mer, 5'-GCGTGCACGTGGTCTGAGTG3', complementary to nucleotides 44-63 of the 5'-untranslated region of motilin mRNA, using duodenal RNA and reverse transcriptase as described previously [10]. A sequencing ladder obtained using the same primer and the appropriate gene template was run in adjacent lanes to indicate the size of the extended product and the sequence at which extension terminated. 2.3. Gene mapping The chromosomal localization of the human MLN gene was determined by hybridization of 32p-labeled phMot-1 to Southern blots of BamHl-digested DNA from 31 human-mouse somatic cell hybrid cell lines involving 13 unrelated human cell lines and 4 mouse cell lines [11]. The hybrids had been previously characterized by chromosome analysis and the presence of human enzyme and DNA markers. The regional localization of the MLN gene was determined by in situ hybridization [12] of 3H-labeled phMot-1 to normal human prometaphase lymphocyte chromosomes.

June 1989

sist o f 1 15 a n d 119 a m i n o acids, respectively. T h e n u c l e o t i d e sequences o f the regions e n c o d i n g these t w o p r o t e i n s differ b e c a u s e o f the a p p a r e n t delet i o n in the h u m a n p r e c u r s o r sequence (or conversely a n i n s e r t i o n in the p o r c i n e sequence) o f a 12 n u c l e o t i d e segment b e g i n n i n g 11 nucleotides u p s t r e a m o f the start o f i n t r o n 4. T h e c h a r a c t e r i z a t i o n o f m o t i l i n genes f r o m o t h e r species m i g h t p r o v i d e a clue as to its origin. T h e 5 ' - e n d o f m o t i l i n m R N A was i d e n t i f i e d b y p r i m e r extension (fig.3) a n d was l o c a t e d 16 bases u p s t r e a m f r o m the 5 ' -end o f the c D N A . Thus, the 5 ' - u n t r a n s l a t e d region o f h u m a n m o t i l i n m R N A is 72 bases. T h e r e is a T A T A m o t i f 19 nucleotides u p s t r e a m f r o m the p u t a t i v e t r a n s c r i p t i o n a l i n i t i a t i o n site; no o t h e r o b vious t r a n s c r i p t i o n a l c o n t r o l signals o c c u r in a b o u t

2.4. RNA blotting RNA was isolated from human tissues using the guanidine isothiocyanate/cesium chloride procedure [7]. 20/~g of total RNA was denatured with glyoxal, electrophoresed on a 1°70 agarose gel and then blotted onto a nylon filter. The filter was hybridized with 32p-labeled phMot-1. 3. R E S U L T S A N D D I S C U S S I O N 3.1. Isolation and characterization o f the h u m a n motilin gene F o u r o f 1 × 106 p h a g e o f the h u m a n g e n o m i c l i b r a r y h y b r i d i z e d with the h u m a n m o t i l i n c D N A p r o b e . R e s t r i c t i o n m a p p i n g suggested t h a t the inserts in t h r e e o f these (AhMot-1, -2 a n d -3) were i d e n t i c a l a n d o v e r l a p p e d with the insert in A h M o t - 4 (fig. 1). T h e inserts o f AhMot-1 a n d -4 were i s o l a t e d a n d p a r t i a l l y sequenced to o b t a i n the e x o n - i n t r o n o r g a n i z a t i o n o f the m o t i l i n gene. T h e five exons e n c o d i n g h u m a n m o t i l i n m R N A s p a n a b o u t 9 kb (figs 1 a n d 2). T h e n u c l e o t i d e sequences o f the p r o tein c o d i n g a n d 3 ' - u n t r a n s l a t e d regions o f the gene were identical to t h o s e o f the c D N A ; there is a single base d i f f e r e n c e in the 5' - u n t r a n s l a t e d region b e t w e e n these t w o sequences (fig.2). T h e first int r o n i n t e r r u p t s the gene r e g i o n e n c o d i n g the 5 ' - u n t r a n s l a t e d r e g i o n o f the m R N A . T h e s e c o n d i n t r o n i n t e r r u p t s the r e g i o n o f the gene e n c o d i n g the 2 2 - a m i n o - a c i d m o t i l i n sequence a n d the t h i r d a n d f o u r t h i n t r o n s are l o c a t e d in the r e g i o n o f the gene c o d i n g for the C - t e r m i n a l p e p t i d e o f u n k n o w n f u n c t i o n (fig.2). T h e h u m a n a n d p o r c i n e m o t i l i n p r e c u r s o r s con-

250

Fig.3. Primer extension analysis of the 5 '-end of human motilin mRNA. The 32p-labeled oligonucleotide was annealed to 3/zg of human duodenum poly(A)÷ RNA and then extended with reverse transcriptase. The right lane is the primer-extended cDNA. The sequence ladder obtained using the same oligonucleotide as a sequencing primer is indicated. The sequence around the end of the primer-extended cDNA is noted and is complementary to the mRNA sequence. The arrow indicates the putative transcription initiation site.

Volume 249, number 2

FEBS LETTERS

June 1989

Fig.4. Hybridization of the human motilin cDNA probe to

BamHI-digested human-mouse cell hybrid DNAs. Lanes 1 and 8 contain mouse DNA and lanes 2 and 9, human DNA; note the polymorphic 7.0 kb fragment. Lanes 4 and 5 are digests from hybrid cell lines lacking human chromosome 6 and lanes 3, 6 and 7 are from cell lines having human chromosome 6.

6 Fig.5. Ideogram of human chromosome 6 showing silver grain distribution after hybridization with the motilin cDNA. One hundred metaphase spreads were examined and 19.6070 (48/245) of the grains were on chromosome 6 and 52.1070 of these (25/48) were localized in the region p21.2 --~ p21.3. No other human chromosomes demonstrated a grain distribution above background.

300 b p o f the 5 ' - f l a n k i n g r e g i o n o f t h e m o t i l i n gene. T h e n u c l e o t i d e sequence o f the 3 ' - f l a n k i n g r e g i o n o f the m o t i l i n gene c o n t a i n s a T-rich segm e n t w h i c h c o u l d be i n v o l v e d in t r a n s c r i p t i o n term i n a t i o n / p o l y a d e n y l a t i o n [13]. 3.2. Chromosomal

localization

of

the human

motilin gene

7.0 kb in s o m e D N A samples w h i ch m o s t likely represents a restriction f r a g m e n t length p o l y m o r p h i s m (fig.4, lanes 3 a n d 9). T h e h u m a n c D N A p r o b e h y b r i d i z e d very p o o r l y to m o u s e D N A u n d e r t h e c o n d i t i o n s used. T h e h u m a n - s p e c i f i c D N A f r a g m e n t s co - seg r eg at ed with h u m a n c h r o m o s o m e 6 (table 1). In situ h y b r i d i z a t i o n t o h u m a n p r o m e t a p h a s e c h r o m o s o m e s c o n f i r m e d the assign-

T h e c h r o m o s o m a l a s s i g n m e n t o f the h u m a n M L N gene was d e t e r m i n e d f r o m analysis o f its s e g r e g a t i o n in a p an e l o f r e d u c e d h u m a n - m o u s e s o m a t i c cell hybrids. T h e m o t i l i n c D N A p r o b e h y b r i d i z e d to three h u m a n B a m H I f r a g m e n t s o f 10.9, 4.6 an d 2.1 kb (fig.4, lanes 2, 6 a n d 7); the p r o b e also h y b r i d i z e d to an a d d i t i o n a l f r a g m e n t o f

Table 1 Segregation of the MLN gene with human chromosomes in BamHI-digested human-mouse cell hybrid DNA Human chromosomes 1

Concordant no. of hybrids Discordant no. of hybrids MLN 070discordancy

2

3

4

5

6

7

8

9

10 11 12 13 14 15 16 17 18 19 20 21 22 X

15 23 17 21 17 31 17 16 12 18 22 13 16 16 20 13 15 21 23 18 17 17 20 13 7 11 10 14 0 13 15 16 12 8 18 15 15 11 18 14 10 8 13 14 13 7 46 23 39 32 45 0 43 48 57 40 27 58 48 48 35 58 48 32 26 42 45 43 26

The scores were tabulated by the presence or absence of human DNA fragments in the different somatic cell hybrids. Concordant hybrids have either retained or lost the gene together with a specific chromosome. Discordant hybrids either retained the gene but not a specific chromosome, or the reverse. Percent discordancy indicates the degree of discordant segregation for a marker and a chromosome. A 0°7o discordancy is the basis for chromosome assignment

251

Volume 249, number 2

FEBS LETTERS

m e n t o f the M L N gene to c h r o m o s o m e 6 a n d f u r t h e r localized it to the p21.2 ~ p21.3 region o f the s h o r t a r m o f this c h r o m o s o m e (fig.5). 3.3. Distribution o f motilin m R N A H y b r i d i z a t i o n o f the h u m a n m o t i l i n e D N A p r o be t o N o r t h e r n blots o f R N A p r e p a r e d f r o m v a r i o u s regions o f the h u m a n g a s t r o i n t e s t i n a l t r a c t r e v e a l e d an a b u n d a n t 0.7 k b m o t i l i n t r a n s c r i p t in d u o d e n u m (fig.6). L o w e r levels o f m o t i l i n m R N A were present in R N A p r e p a r e d f r o m the gastric ant r u m . T h e m o t i l i n m R N A levels in the e s o p h a g u s , c a r d i a o f the s t o m a c h , d e s c e n d i n g c o l o n a n d g a l l b l a d d e r were b e l o w the sensitivity o f o u r R N A b l o t t i n g assay. A s discussed b y B o n d et al. [6], c o n f l i c t i n g l o c a l i z a t i o n s o f m o t i l i n have been r e p o r t e d using i m m u n o h i s t o c y t o c h e m i c a l p r o c e d u r e s with s o m e d a t a suggesting w i d e s p r e a d d i s t r i b u t i o n o f this p e p t i d e in the g a s t r o i n t e s t i n a l t r a c t a n d central n e r v o u s system. These localizat i o n studies s h o u l d be r e p e a t e d using the t e c h n i q u e o f h y b r i d i z a t i o n h i s t o c h e m i s t r y to i d e n t i f y specific cells c o n t a i n i n g m o t i l i n m R N A since n u c l e o t i d e

28S '~ 18S,,*

0.7kb~

o~" o

E

.m

2 ~

m

(Human) Fig.6. Tissue distribution of motilin mRNA. The positions of 18 S and 28 S ribosomal RNAs are indicated. 252

June 1989

p r o b e s m a y be m o r e specific t h a n a n t i b o d i e s p r e p a r e d a g a i n s t the p e p t i d e o r f r a g m e n t s t h e r e o f . N o n e t h e l e s s , the R N A b l o t t i n g d a t a p r e s e n t e d here a n d in the r e p o r t o f B o n d et al. [6] s t r o n g l y suggest t h a t m o t i l i n e x p r e s s i o n is restricted to the u p p e r small intestine a n d gastric a n t r u m .

Acknowledgements: We are very grateful to Dr S. Ishii (Riken), Dr H. Fukumoto and Dr G. Koh (Kyoto University) for valuable advice in these studies. We also express our appreciation to T. Mitani (Sanwa Kagaku Kenkyusho) for preparation of the synthetic oligonucleotide used for primer extension analysis, and to Ms H. Tachikawa for her expert assistance in preparing this manuscript. This research was supported by Grants in Aid for Scientific Research 63440042 from the Ministry of Education, Science, and Culture, Japan (to H.I.), in part by Uehara Memorial Foundation and Grant-in-Aid from the Mochida Memorial Foundation for Medical and Pharmaceutical Research (to Y.S.), and by National Institutes of Health Grants GM-2054 and HD-05196 (to T.B.S.).

REFERENCES [1] Brown, J.C., Cook, M.A. and Dryburgh, J.R. (1972) Gastroenterology 62, 401-404. [2] Schubert, H. and Brown, J.C. (1974) Can. J. Biochem. 52, 7-8. [3] Itoh, Z., Honda, R., Hiwatashi, K., Takeuchi, S., Aizawa, I., Takayanagi, R. and Couch, E.F. (1976) Scand. J. Gastroenterol. 11 (suppl.39), 93-110. [4] Rennie, J.A., Christofides, N.D., Bloom, S.R. and Johnson, A.G. (1979) Gut 20, A912. [5] Seino, Y., Tanaka, K., Takeda, J., Takahashi, H., Mitani, T., Kurono, M., Kayano, T., Koh, G., Fukumoto, H., Yano, H., Fujita, J., Inagaki, N., Yamada, Y. and Imura, H. (1987) FEBS Lett. 223, 74-76. [6] Bond, C.T., Nilaver, G., Godfray, B., Zimmerman, E.A. and Adelman, J.P. (1988) Mol. Endocrinol. 2, 175-180. [7] Lawn, R.M., Fritsch, E.F., Parker, R.C., Blake, G. and Maniatis, T. (1978) Cell 15, 1157-1174. [8] Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. [9] Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. [10] Fukumoto, H., Seino, S., Imura, H., Seino, Y. and Bell, G.I. (1988) Diabetes 37, 657-661. [11] Shows, T., Eddy, R., Harley, L., Byers, M., Henry, M., Fujita, T., Matsui, H. and Taniguchi, T. (1984) Somatic Cell Mol. Genet. 10, 315-318. [12] Zabel, B.U., Naylor, S.L., Sakaguchi, A.Y., Bell, G.I. and Shows, T.B. (1983) Proc. Natl. Acad. Sci. USA 80, 6932-6936. [13] McDevitt, M.A., Hart, R.P., Wong, W.W. and Nevins, J.R. (1986) EMBO J. 5, 2907-2913.