- Email: [email protected]
Exosomal miR-499a-5p promotes cell proliferation, migration and EMT via mTOR signaling pathway in lung adenocarcinoma
Experimental Cell Research 379 (2019) 203–213
Contents lists available at ScienceDirect
Experimental Cell Research journal homepage: www.elsevier.com/locate/yexcr
Research article
Exosomal miR-499a-5p promotes cell proliferation, migration and EMT via mTOR signaling pathway in lung adenocarcinoma
T
Shan Hea,b, Ziming Lia, Yongfeng Yua, Qingyu Zengb, Yirui Chengb, Wenxiang Jia, Weiliang Xiab,∗∗, Shun Lua,∗ a b
Shanghai Lung Cancer Center, Shanghai Chest Hospital, Shanghai Jiao Tong University, West Huaihai Road 241, Shanghai, 200030, China School of Biomedical Engineering and Med-X Research Institute, Shanghai Jiao Tong University, Huashan Road 1954, Shanghai, 200030, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Exosome miR499a mTOR pathway Lung cancer
Tumor-derived exosomes contain informative microRNAs involved in carcinogenesis, cell migration, invasion and epithelial–mesenchymal transition (EMT), eventually contributing to metastasis of cancers. This study aims to clarify which and how exosomal miRNA affects tumor carcinogenesis and metastasis. Among them, miR-499a5p was upregulated in both highly metastatic lung cancer cell line and their exosomes. MiR-499a-5p overexpression promoted cell proliferation, migration and EMT, while miR-499a-5p knockdown suppressed these processes in vitro. Inhibition of miR-499a-5p by antagomirs administration restrained tumor growth in vivo. Consequently, miR499a-sufficient exosomes, derived from highly metastatic cell line, enhanced cell proliferation, migration and EMT via mTOR pathway, and the effect could be inhibited by miR-499a-5p inhibitor. The study reveals the potential diagnostic and therapeutic value of cancer-derived exosomal miR-499a-5p, and sheds a new insight on a novel molecular mechanism which modulates metastasis.
1. Introduction Worldwide, lung cancer remains the most commonly diagnosed cancer with the incidence rate of 11.6% and the leading cause of cancer death, accounting for 18.4% of the total deaths [1]. Due to late detection, the tumor is frequently diagnosed in advanced stage or even metastasized, leading to limited treatment [2]. Epithelial–mesenchymal transition (EMT) is a transition process by which cells alter their characteristics from epithelial to mesenchymal [3]. During EMT, tumor cells lose epithelial polarity and cell–cell adhesion contacts, contributing to increased migration, invasion and metastasis [4]. Therefore, research of potential molecular mechanisms during metastasis has great prospects and might offer novel insights for promising new therapies. Exosomes are 30–150 nm sized extracellular vesicles with lipid-bilayer membranes, which protects them from enzymatic degradation [5]. Exosomes contain lipids, transmembrane proteins, messenger RNAs (mRNA) and micro-RNAs (miRNAs) [6], and can be isolated in most of biological fluids, including blood, urine, saliva [7], pleural effusion and ascites [8]. Their function is related to various biological processes, including antigen presentation, apoptosis, angiogenesis, inflammation,
∗
and coagulation [6]. They are regarded as extracellular messengers by exchange of proteins, miRNAs and mRNA, thus contributing to cell-tocell communication. Over the past few years, evidence has indicated that cancer-derived exosomes could remodel tumor microenvironment [9], promote cancer development [10], enhance angiogenesis [11] and pre-metastatic niche formation [12]. MicroRNAs (miRNAs), identified as short non-coding RNAs, play an essential role in negative regulation of gene expression by interacting with the 3′-untranslated regions of protein-coding mRNA, thereby contributing to mRNA degradation and the inhibition of mRNA translation [13,14]. Accumulating evidence demonstrates that miRNAs are often implicated in the carcinogenesis, invasion and metastasis of a variety of cancers, especially in non-small cell lung cancer (NSCLC) [15–18]. Several research reveal that miR499a probably exhibited a poor prognosis in diverse diseases, such as myocardial infarction, colorectal cancer, blood tumor and NSCLC [19–22]. Li et al. indicated that miR499a promoted proliferation and inhibited apoptosis during latestage cardiac differentiation [23]. Xiang et al. observed that miR499a increased proliferation and migration of HBV-related HCC cells [24]. In previous studies, a highly metastatic cell line, SPC-A-1BM, was
Corresponding author. Corresponding author. E-mail addresses: [email protected] (W. Xia), [email protected] (S. Lu).
∗∗
https://doi.org/10.1016/j.yexcr.2019.03.035 Received 7 February 2019; Received in revised form 18 March 2019; Accepted 27 March 2019 Available online 10 April 2019 0014-4827/ © 2019 Published by Elsevier Inc.
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
established from a weakly metastatic cell (SPC-A-1) through in vivo selection in BALB/c mouse models [25,26]. Because the two cell lines have a parallel genetic background, exosomes derived from them can be applied to a high-throughput sequencing to screen candidate metastasis-associated miRNAs. The result reveals that miR499a was upregulated in SPC-A-1BM derived exosomes. However, whether and how the exosomal miR499a influences the carcinogenesis and metastasis of NSCLC cells remain elusive. In this study, we have investigated the potential function of exosome transfer uptake and found that miR-499a5p could be delivered via exosomes to recipient cancer cells, facilitating tumor development and metastasis. In addition, we determined the influence of miR-499a-5p on NSCLC cells and further investigated underlying molecular mechanism.
μg/mL ) suspended with fresh medium were added to the culture medium. After 3h or 6 h of co-cultivation, cells were washed with PBS twice. The coverslips were moved out and fixed in 4% paraformaldehyde for 10 min at room temperature. The coverslips were washed three times and incubated with 0.5% DAPI (Sigma) for 5 min in the dark. After washing, the slides were fixed and added with anti-fluorescence quencher for stomage. The stained cells and exosomes were photographed under a laser-scanning confocal microscope. 2.4. Nanoparticle tracking analysis (NTA) Exosomes were analyzed by nanoparticle tracking, using the ZetaView instrument (Particle Metrix, Germany). The exosomes were diluted in PBS at proper ratios then injected into the cell. Samples were administered and recorded under controlled flsow, using the NanoSight syringe pump and script control system, giving the concentration and median size by the software (ZetaView 8.03.04.01).
2. Materials and methods 2.1. Cell culture Human lung cancer cells A549, human bronchial epithelial cells BEAS-2B were obtained from the American Type Culture Collection (Manassas, VA, USA). Human lung cancer cells SPCA1 were from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China). The SPC-A-1-BM human lung adenocarcinoma cell line was a generous gift from Dr. Shun Lu (Shanghai Chest Hospital). SPC-A-1-BM is a human lung adenocarcinoma cell line with high bone metastatic ability compared to its parental cell line SPC-A-125. A549, BEAS-2B, SPCA1 cells were maintained in Dulbecco's Modified Eagle's Medium (DEME; Hyclone, Thermo Fisher Scientific, Waltham, MA, USA) containing 10% FBS (Lonza, Walkersville, MD, USA) or exosomefree FBS and 1% Penicillin-streptomycin (Hyclone) under 5% CO2 at 37 °C in a humidified incubator (Thermo, Forma Series II). SPCA1-BM cells were cultured in RPMI 1640 (Hyclone) supplemented with 10% FBS or exosome-free FBS and 1% penicillin-streptomycin. To obtain exosome-free FBS, the serum was ultra-centrifuged at 120,000 g for 16 h at 4 °C, then filtered through 0.22 μm filter (Millipore, CA, USA) prior to use.
2.5. Western blots Proteins were extracted from cells and exosomes with a mixture of RIPA buffer (Millipore), protease and phosphatase inhibitor cocktail (1:100) plus PMSF (Beyotime) and quantified using a BCA Protein Assay Kit (Thermo Fisher Scientific, Rockford, IL, USA). Protein samples were separated by 10% SDS-polyacrylamide gels and transferred to 0.45 μm nitrocellulose membranes (Millipore) using a semi-dry electrotransfer method. After blocking in tris-buffered saline and Tween-20 (TBST) containing 5% non-fat milk, the membranes were incubated overnight at 4 °C with the following primary antibodies: TSG101 (Abcam, Cambridge, UK), CD9 (Cell Signaling Technology, Danvers, MA, USA), ALIX (CST), E-cadherin (CST), N-cadherin (CST), Vimentin (CST), β− catenin (CST), p70 S6 kinase (CST), phospho-p70 S6 kinase (CST), 4EBP1 (CST), phopho-4EBP1 (CST), β− Actin (Santa Cruz Biotechnology, Dallas, TX, USA). Subsequent visualization was detected with enhanced chemiluminescence (ECL; Thermo Fisher Scientific) using ECL imaging system (Tanon, 5200, China).
2.2. Exosome isolation and labeling
2.6. RNA isolation and real-time PCR
The exosome-free culture medium was collected and centrifuged at 300 × g for 10 min, followed by 2000 × g for 20 min and 10,000 g for 30min. After discarding the pellets, the obtained medium was centrifuged at 110,000 g for 70 min at 4 °C to pellet exosomes. The pellet was diluted with PBS and centrifuged at 110,000 g for 70 min again, and finally resuspended in PBS. Purified exosomes were labeled with PKH26 red fluorescent labeling kit (Sigma, St. Louis, MO) as described by the manufacturer. Briefly, exosomes and 1 μl PKH26 were respectively diluted in 1 ml Dilution C. The obtained solutions were mixed and incubated for 1 min. Then the reaction was ended with 2 ml added exosome-free FBS. The mixture were centrifuged at 110,000 g for 70 min at 4 °C to pellet stained exosomes, which were used for uptake assay.
Total RNA from the cells and exosomes was isolated using RNAiso Plus (TaKaRa, Shiga, Japan) and QIAzol Lysis Reagent (Qiagen, Valencia, CA), respectively. The Mir-X miRNA First Strand Synthesis Kit (Clontech, Mountain View, CA, USA) was used in reverse transcription of miRNAs. mRNA levels were quantified using real-time analysis with SYBR Green (Clontech) on ABI 7900 H T according to the following protocol: 95 °C for 10 s, 40 cycles consisting of 95 °C for 5 s and 60 °C for 20 s, 95 °C for 60 s, 55 °C for 30 s, and 95 °C for 30 s. The intracellular miRNA expression level was normalized to U6 while the exosomal miRNA expression was normalized to cel-miR-39 (Exiqon, Vedbaek, Denmark) as a spike-in control. The primers were listed as follows: miR499a (forward 5′ − TTAAGACTTGCAGTGATGTTT − 3′); U6 (forward 5′ − CGCTTCGGCAGCACATATACTAAAATTGGAAC − 3′; reverse 5′ − GCTTCACGAATTTGCGTGTCATCCTTGC − 3′); cel-miR-39-F (forward 5′ − ACACTCCAGCTGGGTCACCGGGTGTAAATC − 3′; reverse 5′ − TGGTGTCGTGGAGTCG − 3′).
2.3. Transmission electron microscopy (TEM) and fluorescent imaging of exosome uptake The samples were prepared based on Thery's method (Thery et al., 2006). Briefly, an aliquot of exosome (5 μl) was dripped onto a copper grid. After sedimentation for 1 min, the droplet was sopped up using the air-laid paper. Then 5 μl of 2% uranyl acetate solution (Merck, 1.01005.9025) was loaded onto the same copper grid for negativestaining for 1 min. Then the staining solution was socked-out by air-laid paper. Finally, the samples on the copper grid were imaged on a Tecnai G2 spirit Biotwin TEM. For fluorescent imaging, the lung cancer cells A549 were seeded on coverslips in 24-well plates and the PHK26 labeled exosomes (20
2.7. miRNA mimics and inhibitors transfection Cells was transfected at 80% confluency with miR-499a-5p mimics and inhibitors or scrambled control (RiBoBio, Guangzhou, China) using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocols. 2.8. Cell proliferation assay 10,00 cells per well were seeded in a 96 well plate. 24 h after the 204
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
Fig. 1. Characterization of exosomes derived from lung adenocarcinoma cells. a Electron microscopy assay of exosomes derived from lung cancer cells. Scale bar = 100 nm b Western Blot analysis for exosomes marker in exosomes and cell lysates. c The amount of proteins in exosomes from the same number of SPC-A-1 and SPC-A-1-BM cells was quantified by BCA assay. SPC-A-1-BM (highly metastatic cell line) secreted more exosomes compared to SPC-A-1 cells. d The particle size of exosomes was measured by nanoparticle tracking analysis (NTA). e Cellular uptake of exosomes (1 μg/ mL) labeled with PKH26 by A549 cells. Image was captured 3 h and 6 h after addition of exosomes to the culture medium. Scale bar = 50 μm. Con, control; Exo, exosome. **p < 0.01. The error bars in all graphs represented SD.
treatment, Cell Counting Kit-8 solution (Yeasen, Shanghai, China) was added to each well at the dilution of 1:10, followed by incubation at 37 °C for 1–3 h. Absorbance at 450 nm was measured by microplate reader (Synergy 2; BioTek, Winooski, VT, USA).
monolayer was scraped with a sterile pipette tip. Then the cells were incubated with FBS-free medium and different reagents. Cell migration images were photographed using inverted microscope at 0 h and 24 h after scratch. The non-closed gap area demonstrated the ability of migration. The assays were performed three independent times.
2.9. Wound healing assay 2.10. Transwell assay 500,000 cells were seeded into 6-well plates per well and after growing to approximately 90% confluency, the confluent cell
The migration and invasion ability of cancer cells were assessed 205
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
Fig. 2. Upregulation of miR-499a-5p in both highly metastatic cell lines and their exosomes. SPC-A-1-BM had higher migration and invasion ability compared to SPCA-1 cell line. a Scratch assays were used to assess cell migration. Scale bar = 400 μm.b, c Transwell assays were used to assess cell migration and invasion. Scale bar = 100 μm.d, e Detection of differential expression of intracellular and exosomal miR-499a-5p among BEAS-2B, SPC-A-1, A549 and SPC-A-1-BM cell, as determined by qPCR. U6 and cel-miR-39-F were used as an internal control. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. The error bars in all graphs represented SD.
and stained with 0.1% crystal violet for 20 min. Then the cells attached to the lower surface of the membrane were imaged and counted by using microscope in three randomly selected areas per well.
using 8-mm pore size chamber inserts (Corning, New York, NY, USA). 2 × 104 cells stably expressing miR499a mimics, inhibitors and negative controls, suspended in 100 μl FBS-free medium, were added into the upper chamber per well (coated with or without matrigel) and the lower chamber was filled with 600 μl medium supplemented with 10% FBS as a chemoattractant. 24 h later, non-migrating or non-invading cells were removed from the upper surface of the membrane gently by cotton swab. The membrane was fixed with 100% methanol for 20 min
2.11. In vivo subcutaneous lung cancer model Cell suspension of A549 (5 × 106 cells) in a volume of 100 μl were injected subcutaneously into the right flanks of BALB/c male nude 206
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
Fig. 3. MiR-499a-5p promoted cell proliferation, migration and EMT in vitro. A549 and SPC-A-1-BM cells were transfected with miR-499a-5p mimics or inhibitors and negative controls. a, b Cell proliferation was measured by CCK8 assay. c The expressions of miR499a-5p after transfection were measured by qPCR. d, e Wound healing assay was performed on A549 and SPC-A-1-BM cells after transfection. Scale bar = 400 μm. f, g Transwell migration assays for A549 and SPC-A-1BM cells were determined. Scale bar = 100 μm.h Expressions of EMT markers E-cadherin, N-cadherin, β -catenin and Vimentin were detected by Western blot. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. The error bars in all graphs represented SD.
207
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
S2). Next, we verified the intracellular expression levels of miR-499a-5p in different lung cancer cells and human bronchial epithelial cells (BEAS-2B) and exosomal expression levels in different cells-derived exosomes by real-time PCR. The results demonstrated that the expressions of miR-499a-5p were upregulated both at endogenous and exosomal level in highly-metastatic SPC-A-1-BM cells (Fig. 2d and e). Thus, we focused on miR-499a-5p in the following experiments to study which role it played in tumor proliferation and metastasis.
mice. 2 weeks after implantation, miR-499a-5p mimics (5 nmol/ mouse), inhibitors (10 nmol/mouse) and negative controls (RiBoBio, Guangzhou, China) were respectively injected subcutaneously at a 3day interval. Tumor volumes were examined by caliper every 3 days, and calculated as formula 0.5 × length × width2. The sequence of the mimics and inhibitors were as follows: Negative Control mimics (sense 5′- UUUGUACUACACAAAAGUACUG-3′, antisense 5′-CAGUACUUUUG UGUAGUACAAA-3′); Negative Control Inhibitors (sense 5′- CAGUACU UUUGUGUAGUACAAA-3′); hsa-miR-499a-5p mimics sense (sense 5′-UUAAGACUUGCAGUGAUGUUU-3′, antisense AAACAUCACUGCAA GUCUUAA); hsa-miR-499a-5p inhibitors (sense 5′-AAACAUCACUGCA AGUCUUAA-3′).
3.3. MiR-499a-5p promotes cell proliferation, migration and EMT in vitro In order to investigate the impact miR-499a-5p had on NSCLC cell proliferation and migration, Loss- and gain-of-function experiments of miR-499a-5p were conducted adopting a transient transfection method with miR-499a-5p mimics or inhibitors. CCK assay demonstrated that in A549 and SPC-A-1-BM cells, miR-499a-5p overexpression promoted cell proliferation (Fig. 3a); on the contrary, miR-499a-5p inhibition restrained cell proliferation (Fig. 3b). Overexpression and knockdown effect of miR-499a-5p mimics and inhibitors were confirmed by qPCR, compared to negative controls (Fig. 3c). Scratch and transwell assays showed that overexpression of miR-499a-5p enhanced the migration capability (Fig. 3d, f), while miR-499a-5p knockdown exhibited suppressed migration capability (Fig. 3e, g). Furthermore, we measured the expressions of the epithelial and mesenchymal markers by Western blot analysis and found that E-cadherin was downregulated, and N-cadherin, β-catenin and Vimentin were upregulated in line with miR-499a5p overexpression. In contrast, the protein level of E-cadherin decreased, while N-cadherin, β-catenin and Vimentin levels increased in miR-499a-5p-inhibitor-treated cells. These illustrated that miR-499a-5p is a positive regulator of NSCLC proliferation, migration and EMT, thus contributing to metastasis.
2.12. Statistical analysis All data were expressed as mean ± standard and plotted using GraphPad Prism 7 software (GraphPad Software, Inc. La Jolla, CA). T test was used for analyzing the differences between two groups. Comparisons among several groups were analyzed by oneway ANOVAs with Tukey's post-hoc tests. p < 0.05 was considered statistically significant. All experiments were performed in triplicate and repeated at least three times. 3. Results 3.1. Isolation and characterization of exosomes derived from lung adenocarcinoma cells We incubated three lung adenocarcinoma cell lines, i.e., SPC-A-1, SPC-A-1-BM and A549, in medium containing exosome-free FBS. Exosomes purified from these three cell lines by serial ultra-centrifugation were identified by transmission electron microscopy (TEM) to be small (30–100 nm) spherical vesicles with bilayer membranes (Fig. 1a) [27]. The presence of common exosome markers, including ALIX, TSG101 and CD9, were observed by Western Blots (Fig. 1b). Total protein concentration of exosomes secreted by the same number of different cells was quantified by BCA assay and it revealed that SPC-A1-BM (highly metastatic cell line) secreted more exosomes compared to SPC-A-1 (Fig. 1c). NanoSight tracking analysis (NTA) was used to examine the diameter of isolated vesicles [28]. Nanoparticles derived from all three cell lines were mostly in a range of 30–150 nm in diameter (Fig. 1d). As we could see, the diameter range size of isolated vesicles analyzed in NTA and TEM basically coincided. Furthermore, we studied whether these exosomes could be taken up by cancer cells. Exosomes labeled with red dye PKH26(1 μg/mL were added into the culture medium of A549 cell, and then fluorescent imaging proved the presence of red fluorescence in the vicinity of the stained nucleus, which indicated that the recipient cells had shown direct uptake of exosomes in a time-dependent manner (Fig. 1e). And in Supplementary figure 1, when merged with bright field, we could see the cellular internalization of exosomes.
3.4. MiR-499a-5p accelerates tumor growth in vivo Aimed to further verify how miR-499a-5p influences tumor growth in vivo, subcutaneous xenograft models were established on BALB/c nude mice. Two weeks after implantation, miR-499a-5p mimics (5 nmol/mouse), inhibitors (10 nmol/mouse), and negative controls were injected subcutaneously into tumor nodules at a 3-day interval. Tumor volumes were examined by caliper every 3 days. Mice that received miR-499a-5p mimics treatment developed larger tumor nodules compared to those received negative controls treatment. The subcutaneous tumor nodules were photographed (Fig. 4b, p < 0.01). As shown in the growth curves and weights of tumors, the overexpression of miR-499a5p could accelerate tumor growth in vivo (Fig. 4b). While, mice that received miR-499a-5p inhibitors treatment developed smaller tumor nodules compared to those received negative controls treatment (Fig. 4c, p < 0.01). And the growth curves and weights of tumors indicated the anti-miR-499a-5p targeted therapy could inhibit tumor growth in vivo (Fig. 4c). 3.5. Down-regulation of endogenous miR-499a-5p inhibits exosomeinduced cell proliferation, migration and EMT
3.2. MiR-499a-5p is upregulated in both highly metastatic cell lines and their exosomes
To confirm that exosomes can function as vehicles of secreted miR499a-5p, we determined miR-499a-5p levels by qPCR in both A549 and SPC-A-1-BM cells treated with exosomes isolated from SPC-A-1 or SPCA-1-BM cells. Owing to higher miR-499a-5p expression level in SPC-A1-BM derived exosomes, an increase in intracellular level of miR-499a5p was observed in recipient cells co-cultured with exosomes from SPCA-1-BM cells in contrast with those from SPC-A-1 cells (Fig. 5a). To determine if exosomal miR-499a-5p had the pro-cancer capacity, CCK, wound healing and transwell assays were performed in recipient cells exposed to exosomes from the two different cells with or without miR499a-5p inhibitors. Results showed that exosomes isolated from SPC-A1-BM cells enhanced NSCLC cell proliferation and migration compared
In previous studies, SPC-A-1BM was established from SPC-A-1 through in vivo selection in BALB/c mouse models [25,26]. SPC-A-1BM cells showed higher migratory and invasive capability compared to SPC-A-1 cells. By wound healing assay and Transwell migration assay, the difference of cell migration ability was determined (Fig. 2a and b). Moreover, SPC-A-1-BM was more aggressive and capable of invading through extracellular matrigel compared to SPC-A-1 using transwell invasion assay (Fig. 2c). Due to the nature of the two cell lines, a highthroughput sequencing was applied to screen candidate metastasis-associated miRNAs in their exosomes. The result illustrated that miR499a-5p was upregulated in SPC-A-1BM exosomes (Supplementary Fig. 208
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
Fig. 4. MiR-499a-5p accelerated tumor growth in vivo. Cell suspension of A549 cells in a volume of 100 μL were injected subcutaneously into BALB/c nude mice. After implantation 2 weeks, miR499a-5p mimics (5nmol/ mouse), inhibitors (10nmol/mouse) and negative controls were injected subcutaneously at a 3-day interval. a Subcutaneous tumor nodules of mimics treatment group were photographed. b In mimics treatment group, the growth curve of tumor volumes was shown. The weights of tumors were recorded. c Subcutaneous tumor nodules of inhibiors treatment group were photographed. d In inhibitors treatment group, the growth curve of tumor volumes was shown. The weights of tumors were recorded. **p < 0.01; ***p < 0.001. The error bars in all graphs represented SD.
cells were transfected with miR-499a-5p inhibitors (Fig. 6a). We next attempted to study whether miR-499a-5p regulated metastasis through mTOR pathway. After A549 and SPC-A-1-BM cells were transfected with miR-499a-5p mimics, with or without the mTOR pathway inhibitor rapamycin, EMT markers were detected. Rapamycin could downregulate the expression of pS6K1 and p4E-BP1 and the EMT-promoting effect of miR-499a-5p mimics was partially attenuated by rapamycin (Fig. 6b). Scratch and transwell assays revealed that downregulating mTOR pathway could suppress miR-499a-5p-induced migration (Fig. 6c and d). Meanwhile, when we added the mTOR pathway activator MHY 1485 into the cells transfected with miR-499a5p inhibitors, we observed that activation of mTOR pathway could rescue the suppression of miR-499a-5p inhibitors-induced EMT. All evidences suggested that mTOR pathway was involved in the miR499a-5p-induced NSCLC cell metastasis.
to those from SPC-A-1 cells and knockdown of miR-499a-5p blocked the pro-cancer effect (Fig. 5b, c, d). Further, western blots were performed to assess the effect of exosomal miR-499a on EMT. Exosomes isolated from SPC-A-1-BM cells increased EMT. Also, cells transfected with miR499a-5p inhibitor showed decreased EMT induced by those exosomes (Fig. 5e). In conclusion, exosomes derived from SPC-A-1-BM cells enhanced proliferation, migration and EMT of recipient cells, which could be inhibited by miR-499a-5p inhibitor. This results suggested that miR499a-5p in exosomes was responsible for the observed cell proliferation and metastasis in our study. 3.6. MTOR pathway is involved in the miR-499a-induced NSCLC cell migration To further investigate the underlying molecular mechanisms of the simulative effects of miR-499a-5p on the metastasis of NSCLC cells, we performed western blots to screen related candidate pathways, including the MAPK (p-JNK, p-ERK, p-P38), pAKT and mTOR pathways. The results revealed that mTOR pathway was activated by miR499a overexpression and suppressed with the miR499a inhibition. When cells were transfected with miR-499a-5p mimics, protein levels of p-S6K1 and p-4E-BP1 increased, indicating the activation of mTOR pathway. On the contrary, protein levels of p-S6K1 and p-4E-BP1 decreased when
4. Discussion Accumulating evidence implicates that exosomes, known as extracellular microvesicles, can serve as critical mediators in a series of physiological and pathological processes, especially in the initiation, development, and further metastasis of cancer [29,30]. It has been reported that lung cancer-derived exosomes could enhance the migration, 209
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
Fig. 5. Exosomes promoted cell proliferation, migration and EMT, which could be inhibited by miR499a inhibitor. Exosomes (50 μg/ mL) isolated from SPCA-1 and SPC-A-1-BM cells were added into A549 and SPC-A-1-BM recipient cells, followed by transfection with miR-499a-5p inhibitors. a Expressions of miR499a-5p in recipient cells after addition of exosomes were detected by qPCR. b Cell proliferation was measured by CCK8 assay. c Cell migration was assessed by wound healing assay. Scale bar = 400 μm.d Cell migration was assessed by transwell assays. Scale bar = 100 μm. e Expressions of EMT markers E-cadherin, N-cadherin, β -catenin and Vimentin were detected by Western blot. *p < 0.05; **p < 0.01. The error bars in all graphs represented SD.
210
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
Fig. 6. MTOR pathway was involved in the miR-499a-5p-induced NSCLC cell metastasis. a miR-499a-5p activated mTOR pathway. Protein levels of p-S6K1, p4E-BP1 were measured using Western blot analysis in A549 and SPC-A-1-BM cells transfected with miR-499a-5p mimics or inhibitors and negative controls. b The mTOR pathway inhibitor rapamycin could suppress miR-499a-5p-induced EMT. A549 and SPC-A-1-BM cells were transfected with miR-499a-5p mimics and negative controls followed by addition of rapamycin (100 ng/ml). Expressions of p-S6K1,p-4E-BP1 and EMT markers were analyzed by Western blot. c, d The mTOR pathway inhibitor rapamycin could suppress miR-499a-5p-induced migration. Scratch (Scale bar = 400 μm.) and transwell assays (Scale bar = 100 μm.) were performed. e The mTOR pathway activator MHY1485 could rescue the suppression of EMT caused by miR-499a-5p inhibitors. A549 and SPC-A-1-BM cells were transfected with miR-499a-5p inhibitors and negative controls followed by addition of MHY1485 (10 μM). Expressions of p-S6K1,p-4E-BP1 and EMT markers were detected by Western blot. **p < 0.01; ***p < 0.001. The error bars in all graphs represented SD. 211
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
cycles, promoting biosynthesis of proteins and limiting catabolic processes especially like autophagy [37]. Recently, it has been reported to play a key role in the migration, invasion and EMT in various cancers, such as colorectal cancer, gastric cancer, gallbladder cancer, liver cancer, breast cancer, renal cell carcinoma, and lung cancer [38,39]. Several studies demonstrated that mTOR mediates EMT through RhoA and Rac1 in colorectal cancer, gallbladder cancer and prostate cancer [40–42]. In NSCLC, emerging evidence shows that many miRNAs may influence tumor metastasis through mTOR pathway, for example: miR193a-3p/5p suppress the migration and EMT via downregulating the mTOR pathway [43]. In our present study, it was observed that introduction of mTOR inhibitors or activators could rescue the increasing or decreasing effect on metastasis of miR-499a-5p overexpression or knockdown, suggesting that miR499a-5p promoted the migration and EMT via mTOR signaling. For the first time, we confirmed the existence of the miR499a-5p/mTOR axis and its metastatic promoting effect in lung adenocarinoma. Unfortunately, one limit of our research is failure to determine the direct target gene of miR-499a-5p and to further investigate the potential interaction between target gene and mTOR pathway. Besides, considering their anticancer function, the combination of the inhibitors of mTOR and miR-499a-5p deserves further investigation and may have a promising prospect. In conclusion, miR-499a-5p was significantly upregulated in highly metastatic NSCLC cells plus with their exosomes and could serve as a pro-metastatic role. Our work provides another piece of evidence that miRNAs can be transferred in form of exosomes, facilitating cell proliferation, migration and EMT. To the best of our knowledge, this is the first report which confirms the oncogenic effect of miR-499a-5p and establishes the miR499a/mTOR axis in NSCLC. However, additional experiments are necessary to delineate the underlying precise mechanisms. Collectively, our research provides novel diagnostic and therapeutic options for late stage lung cancer patients by targeting exosomal miR499a together with mTOR pathway.
invasion and EMT in human bronchial epithelial cells (HBEC) and cancer cells [31,32]. Recent studies have focused on the function of exosomal miRNAs in cell-to-cell communication and interaction [33]. MiRNAs are often packaged into exosomes and secreted by cancer cells, then taken up by other neighboring cells. However, which miRNA is working and the underlying molecular mechanisms remain still unclear. Thus, we applied a high-throughput sequencing of exosomal miRNAs to screen candidate metastasis-associated miRNAs, including miR-206, miR-205–5p, miR-1-3p, miR-133a-3p, miR-214–3p, miR-133 b, miR127–3p, miR-200 b-3p, miR-375, miR-499a-5p, miR-199a-5p, miR200c-3p etc., then selected the most likely metastasis-related one to perform further functional verification experiments. As previously described, we cultured SPC-A-1-BM, a human lung adenocarcinoma cell line, which has higher bone metastatic potential compared to its parental SPC-A-1 cell line. In our research, it was found that SPC-A-1-BM cells have a higher migratory and invasive capability in comparison with SPC-A-1 cells. Moreover, SPC-A-1-BM derived exosomes induced a more metastatic phenotype in recipient cancer cells compared to SPC-A-1 derived exosomes. We found that both intracellular and exosomal miR-499a-5p levels were elevated in cells with higher invasiveness, suggesting that miR-499a-5p may be correlated with metastasis. We propose that miR-499a-5p would be a metastasisrelated biomarker for lung cancer. Nowadays, since liquid biopsy technologies quickly evolve, detection of serum exosomes as a non-invasive procedure has become more promising, giving consideration to its increasing diagnostic and prognostic value. Previous study established a circulating exosomal miRNAs panel to discriminate between adenocarcinoma (AC) and squamous cell carcinoma (SCC) for early stage NSCLC [34]. MiR-181–5p, miR-30a-3p, miR-30e-3p and miR361–5p were adenocarcinoma-specific, while miR-10 b-5p, miR-15 b-5p and miR-320 b were squamous cell carcinoma-specific [34]. In our study, however, one shortfall is the lack of verification in clinical serum samples. The detection of serum exosomal miR-499a-5p should be carried out in the future to investigate whether it concurs with our experimental data. MiR-499a has been reported as an ideal tumor biomarker as it is involved in several biological processes, for examples: cellular senescence, apoptosis, inflammation and immune responses, all of which contribute to the occurrence and development of tumors [35]. Overexpression of miR-499a-5p was reported to facilitate the invasion of colorectal cancer cells in vitro by targeting FOXO4 and PDCD4 and promote tumor metastasis to lung and liver in vivo [36]. It was previously observed that miR-499a-5p upregulation enhanced proliferation and migration of HBV-related HCC cells via MAPK624. However, the role of miR-499a-5p in NSCLC was not illustrated. We firstly demonstrated that miR-499a-5p could promote the proliferation, migration and EMT in lung adenocarcinoma cell in vitro and inhibition of miR-499a-5p could suppress tumor growth in vivo. Our finding that miR-499a-5p exhibits cancer promoting properties is consistent with previous reports in other cancers. Further, our data supports the hypothesis that exosomes increase the metastatic ability by transfer of miR-499a-5p. MiR499a-sufficient exosomes increased the proliferation, migration and EMT, which could be inhibited by miR-499a-5p downregulation. Taken together, it may provide an anti-miR499a strategy as a novel gene therapeutic application to treat NSCLC patients and it is worth speculating that the use of exosomes as vehicles for miRNA antagomirs might achieve improved efficacy for cancer therapy. To further investigate which signaling pathway is involved in the miR-499a-5p-induced metastatic promoting effect, we screened multiple signal pathways using Western blot analysis. Interestingly, mTOR pathway was found to be activated by miR-499a-5p upregulation and inhibited by miR-499a-5p downregulation. mTOR pathway is mostly mediated by phosphorylation of two downstream effectors, the eukaryotic initiation factor 4 E (eIF4E)-binding protein 1 (4 E-BP1) and the p70 ribosomal S6 kinase 1 (p70S6K1). mTOR signaling regulates cell proliferation, apoptosis, metabolism and survival by controlling cell
Conflicts of interest The authors declare that they have no conflict of interest. Acknowledgements This work was funded by the National Key R&D Program of China (2016YFC1303300 to S.L.), the National Natural Science Foundation of China (81672272 to S.L. and 81773115 to W.X.), the National Key Grant of China (2016YFC0906400 to W.X.), the Key Project of Shanghai Health & Family Planning Commission (201540365 to S.L.), Shanghai Municipal Science & Technology Commission Research Project (17431906103 to S.L.), and Shanghai Scientific Research Projects (14140902800 to S.L.) Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.yexcr.2019.03.035. References [1] F. Bray, et al., Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA A Cancer J. Clin. 68 (2018) 394–424. [2] N. Hanna, et al., Systemic therapy for stage IV non-small-cell lung cancer: American Society of Clinical Oncology clinical practice guideline update, J. Clin. Oncol. 35 (2017) 3484–3515. [3] H. Acloque, M.S. Adams, K. Fishwick, M. Bronner-Fraser, M.A. Nieto, Epithelialmesenchymal transitions: the importance of changing cell state in development and disease, J. Clin. Investig. 119 (2009) 1438–1449. [4] M.A. Nieto, R.Y.-J. Huang, R.A. Jackson, J.P. Thiery, EMT: 2016, Cell 166 (2016) 21–45. [5] C. Théry, M. Ostrowski, E. Segura, Membrane vesicles as conveyors of immune
212
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
responses, Nat. Rev. Immunol. 9 (2009) 581. [6] A.V. Vlassov, S. Magdaleno, R. Setterquist, R. Conrad, Exosomes: current knowledge of their composition, biological functions, and diagnostic and therapeutic potentials, Biochim. Biophys. Acta Gen. Subj. 1820 (2012) 940–948. [7] C. Lässer, et al., Human saliva, plasma and breast milk exosomes contain RNA: uptake by macrophages, J. Transl. Med. 9 (2011) 9. [8] F. Andre, et al., Malignant effusions and immunogenic tumour-derived exosomes, Lancet 360 (2002) 295–305. [9] E. Hosseini-Beheshti, et al., Exosomes confer pro-survival signals to alter the phenotype of prostate cells in their surrounding environment, Oncotarget 7 (2016) 14639. [10] A.S. Azmi, B. Bao, F.H. Sarkar, Exosomes in cancer development, metastasis, and drug resistance: a comprehensive review, Cancer Metastasis Rev. 32 (2013) 623–642. [11] Y. Hsu, et al., Hypoxic lung cancer-secreted exosomal miR-23a increased angiogenesis and vascular permeability by targeting prolyl hydroxylase and tight junction protein ZO-1, Oncogene 36 (2017) 4929. [12] B. Costa-Silva, et al., Pancreatic cancer exosomes initiate pre-metastatic niche formation in the liver, Nat. Cell Biol. 17 (2015) 816. [13] J.R. Lytle, T.A. Yario, J.A. Steitz, Target mRNAs are repressed as efficiently by microRNA-binding sites in the 5′ UTR as in the 3′ UTR, Proc. Natl. Acad. Sci. Unit. States Am. 104 (2007) 9667–9672. [14] D.P. Bartel, MicroRNAs: target recognition and regulatory functions, Cell 136 (2009) 215–233. [15] J. Lu, et al., MicroRNA expression profiles classify human cancers, Nature 435 (2005) 834. [16] W.C. Zhang, et al., Tumour-initiating cell-specific miR-1246 and miR-1290 expression converge to promote non-small cell lung cancer progression, Nat. Commun. 7 (2016) 11702. [17] M. Florczuk, A. Szpechcinski, J. Chorostowska-Wynimko, miRNAs as biomarkers and therapeutic targets in non-small cell lung cancer: current perspectives, Targeted Oncol. 12 (2017) 179–200. [18] T.-H. Chang, et al., Upregulation of microRNA-137 expression by Slug promotes tumor invasion and metastasis of non-small cell lung cancer cells through suppression of TFAP2C, Cancer Lett. 402 (2017) 190–202. [19] F. Olivieri, et al., Admission levels of circulating miR-499-5p and risk of death in elderly patients after acute non-ST elevation myocardial infarction, Int. J. Cardiol. 172 (2014) e276–e278. [20] W. Du, et al., Associations of single nucleotide polymorphisms in miR-146a, miR196a, miR-149 and miR-499 with colorectal cancer susceptibility, Asian Pac. J. Cancer Prev. APJCP 15 (2014) 1047–1055. [21] F. Qiu, et al., Sequence Variation in Mature microRNA-499 Confers Unfavorable Prognosis of Lung Cancer Patients Treated with Platinum-Based Chemotherapy, Clinical Cancer Research, 2015. [22] A. Okamoto, et al., Enhanced efficacy of doxorubicin by microRNA-499-mediated improvement of tumor blood flow, J. Clin. Med. 5 (2016) 10. [23] X. Li, et al., MiR-499 regulates cell proliferation and apoptosis during late-stage cardiac differentiation via Sox 6 and cyclin D1, PLoS One 8 (2013) e74504. [24] Z. Xiang, S. Wang, Y. Xiang, Up-regulated microRNA499a by hepatitis B virus
[25]
[26]
[27] [28]
[29] [30] [31] [32]
[33] [34]
[35] [36]
[37] [38]
[39] [40]
[41] [42] [43]
213
induced hepatocellular carcinogenesis via targeting MAPK6, PLoS One 9 (2014) e111410. S. Yang, et al., Establishment of an experimental human lung adenocarcinoma cell line SPC-A-1BM with high bone metastases potency by 99 mTc-MDP bone scintigraphy, Nucl. Med. Biol. 36 (2009) 313–321. Y. Yu, et al., Everolimus and zoledronic acid—a potential synergistic treatment for lung adenocarcinoma bone metastasis, Acta Biochim. Biophys. Sin. 46 (2014) 792–801. S.T.-Y. Chuo, J.C.-Y. Chien, C.P.-K. Lai, Imaging extracellular vesicles: current and emerging methods, J. Biomed. Sci. 25 (2018) 91. V. Sokolova, et al., Characterisation of exosomes derived from human cells by nanoparticle tracking analysis and scanning electron microscopy, Colloids Surfaces B Biointerfaces 87 (2011) 146–150. A. Hoshino, et al., Tumour exosome integrins determine organotropic metastasis, Nature 527 (2015) 329. A.J. Szempruch, et al., Extracellular vesicles from Trypanosoma brucei mediate virulence factor transfer and cause host anemia, Cell 164 (2016) 246–257. M.A. Rahman, et al., Lung cancer exosomes as drivers of epithelial mesenchymal transition, Oncotarget 7 (2016) 54852. H. Wu, et al., Circulating exosomal microRNA‐96 promotes cell proliferation, migration and drug resistance by targeting LMO7, J. Cell Mol. Med. 21 (2017) 1228–1236. H. Valadi, et al., Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells, Nat. Cell Biol. 9 (2007) 654. X. Jin, et al., Evaluation of tumor-derived exosomal miRNA as potential diagnostic biomarkers for early-stage non–small cell lung cancer using next-generation sequencing, Clin. Cancer Res. 23 (2017) 5311–5319. J.-X. Wang, et al., miR-499 regulates mitochondrial dynamics by targeting calcineurin and dynamin-related protein-1, Nat. Med. 17 (2011) 71. X. Liu, et al., MicroRNA-499-5p promotes cellular invasion and tumor metastasis in colorectal cancer by targeting FOXO4 and PDCD4, Carcinogenesis 32 (2011) 1798–1805. C. Fumarola, M.A. Bonelli, P.G. Petronini, R.R. Alfieri, Targeting PI3K/AKT/mTOR pathway in non small cell lung cancer, Biochem. Pharmacol. 90 (2014) 197–207. A. Kwasnicki, D. Jeevan, A. Braun, R. Murali, M. Jhanwar-Uniyal, Involvement of mTOR signaling pathways in regulating growth and dissemination of metastatic brain tumors via EMT, Anticancer Res. 35 (2015) 689–696. P. Zhang, et al., MiR-646 inhibited cell proliferation and EMT-induced metastasis by targeting FOXK1 in gastric cancer, Br. J. Canc. 117 (2017) 525. P. Gulhati, et al., mTORC1 and mTORC2 regulate EMT, motility and metastasis of colorectal cancer via RhoA and Rac1 signaling pathways, Cancer Res. 4058 (2011) 2010. H. Zong, et al., Inhibition of mTOR pathway attenuates migration and invasion of gallbladder cancer via EMT inhibition, Mol. Biol. Rep. 41 (2014) 4507–4512. X. Chen, et al., mTOR regulate EMT through RhoA and Rac1 pathway in prostate cancer, Mol. Carcinog. 54 (2015) 1086–1095. T. Yu, et al., MicroRNA-193a-3p and-5p suppress the metastasis of human nonsmall-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway, Oncogene 34 (2015) 413.
Contents lists available at ScienceDirect
Experimental Cell Research journal homepage: www.elsevier.com/locate/yexcr
Research article
Exosomal miR-499a-5p promotes cell proliferation, migration and EMT via mTOR signaling pathway in lung adenocarcinoma
T
Shan Hea,b, Ziming Lia, Yongfeng Yua, Qingyu Zengb, Yirui Chengb, Wenxiang Jia, Weiliang Xiab,∗∗, Shun Lua,∗ a b
Shanghai Lung Cancer Center, Shanghai Chest Hospital, Shanghai Jiao Tong University, West Huaihai Road 241, Shanghai, 200030, China School of Biomedical Engineering and Med-X Research Institute, Shanghai Jiao Tong University, Huashan Road 1954, Shanghai, 200030, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Exosome miR499a mTOR pathway Lung cancer
Tumor-derived exosomes contain informative microRNAs involved in carcinogenesis, cell migration, invasion and epithelial–mesenchymal transition (EMT), eventually contributing to metastasis of cancers. This study aims to clarify which and how exosomal miRNA affects tumor carcinogenesis and metastasis. Among them, miR-499a5p was upregulated in both highly metastatic lung cancer cell line and their exosomes. MiR-499a-5p overexpression promoted cell proliferation, migration and EMT, while miR-499a-5p knockdown suppressed these processes in vitro. Inhibition of miR-499a-5p by antagomirs administration restrained tumor growth in vivo. Consequently, miR499a-sufficient exosomes, derived from highly metastatic cell line, enhanced cell proliferation, migration and EMT via mTOR pathway, and the effect could be inhibited by miR-499a-5p inhibitor. The study reveals the potential diagnostic and therapeutic value of cancer-derived exosomal miR-499a-5p, and sheds a new insight on a novel molecular mechanism which modulates metastasis.
1. Introduction Worldwide, lung cancer remains the most commonly diagnosed cancer with the incidence rate of 11.6% and the leading cause of cancer death, accounting for 18.4% of the total deaths [1]. Due to late detection, the tumor is frequently diagnosed in advanced stage or even metastasized, leading to limited treatment [2]. Epithelial–mesenchymal transition (EMT) is a transition process by which cells alter their characteristics from epithelial to mesenchymal [3]. During EMT, tumor cells lose epithelial polarity and cell–cell adhesion contacts, contributing to increased migration, invasion and metastasis [4]. Therefore, research of potential molecular mechanisms during metastasis has great prospects and might offer novel insights for promising new therapies. Exosomes are 30–150 nm sized extracellular vesicles with lipid-bilayer membranes, which protects them from enzymatic degradation [5]. Exosomes contain lipids, transmembrane proteins, messenger RNAs (mRNA) and micro-RNAs (miRNAs) [6], and can be isolated in most of biological fluids, including blood, urine, saliva [7], pleural effusion and ascites [8]. Their function is related to various biological processes, including antigen presentation, apoptosis, angiogenesis, inflammation,
∗
and coagulation [6]. They are regarded as extracellular messengers by exchange of proteins, miRNAs and mRNA, thus contributing to cell-tocell communication. Over the past few years, evidence has indicated that cancer-derived exosomes could remodel tumor microenvironment [9], promote cancer development [10], enhance angiogenesis [11] and pre-metastatic niche formation [12]. MicroRNAs (miRNAs), identified as short non-coding RNAs, play an essential role in negative regulation of gene expression by interacting with the 3′-untranslated regions of protein-coding mRNA, thereby contributing to mRNA degradation and the inhibition of mRNA translation [13,14]. Accumulating evidence demonstrates that miRNAs are often implicated in the carcinogenesis, invasion and metastasis of a variety of cancers, especially in non-small cell lung cancer (NSCLC) [15–18]. Several research reveal that miR499a probably exhibited a poor prognosis in diverse diseases, such as myocardial infarction, colorectal cancer, blood tumor and NSCLC [19–22]. Li et al. indicated that miR499a promoted proliferation and inhibited apoptosis during latestage cardiac differentiation [23]. Xiang et al. observed that miR499a increased proliferation and migration of HBV-related HCC cells [24]. In previous studies, a highly metastatic cell line, SPC-A-1BM, was
Corresponding author. Corresponding author. E-mail addresses: [email protected] (W. Xia), [email protected] (S. Lu).
∗∗
https://doi.org/10.1016/j.yexcr.2019.03.035 Received 7 February 2019; Received in revised form 18 March 2019; Accepted 27 March 2019 Available online 10 April 2019 0014-4827/ © 2019 Published by Elsevier Inc.
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
established from a weakly metastatic cell (SPC-A-1) through in vivo selection in BALB/c mouse models [25,26]. Because the two cell lines have a parallel genetic background, exosomes derived from them can be applied to a high-throughput sequencing to screen candidate metastasis-associated miRNAs. The result reveals that miR499a was upregulated in SPC-A-1BM derived exosomes. However, whether and how the exosomal miR499a influences the carcinogenesis and metastasis of NSCLC cells remain elusive. In this study, we have investigated the potential function of exosome transfer uptake and found that miR-499a5p could be delivered via exosomes to recipient cancer cells, facilitating tumor development and metastasis. In addition, we determined the influence of miR-499a-5p on NSCLC cells and further investigated underlying molecular mechanism.
μg/mL ) suspended with fresh medium were added to the culture medium. After 3h or 6 h of co-cultivation, cells were washed with PBS twice. The coverslips were moved out and fixed in 4% paraformaldehyde for 10 min at room temperature. The coverslips were washed three times and incubated with 0.5% DAPI (Sigma) for 5 min in the dark. After washing, the slides were fixed and added with anti-fluorescence quencher for stomage. The stained cells and exosomes were photographed under a laser-scanning confocal microscope. 2.4. Nanoparticle tracking analysis (NTA) Exosomes were analyzed by nanoparticle tracking, using the ZetaView instrument (Particle Metrix, Germany). The exosomes were diluted in PBS at proper ratios then injected into the cell. Samples were administered and recorded under controlled flsow, using the NanoSight syringe pump and script control system, giving the concentration and median size by the software (ZetaView 8.03.04.01).
2. Materials and methods 2.1. Cell culture Human lung cancer cells A549, human bronchial epithelial cells BEAS-2B were obtained from the American Type Culture Collection (Manassas, VA, USA). Human lung cancer cells SPCA1 were from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China). The SPC-A-1-BM human lung adenocarcinoma cell line was a generous gift from Dr. Shun Lu (Shanghai Chest Hospital). SPC-A-1-BM is a human lung adenocarcinoma cell line with high bone metastatic ability compared to its parental cell line SPC-A-125. A549, BEAS-2B, SPCA1 cells were maintained in Dulbecco's Modified Eagle's Medium (DEME; Hyclone, Thermo Fisher Scientific, Waltham, MA, USA) containing 10% FBS (Lonza, Walkersville, MD, USA) or exosomefree FBS and 1% Penicillin-streptomycin (Hyclone) under 5% CO2 at 37 °C in a humidified incubator (Thermo, Forma Series II). SPCA1-BM cells were cultured in RPMI 1640 (Hyclone) supplemented with 10% FBS or exosome-free FBS and 1% penicillin-streptomycin. To obtain exosome-free FBS, the serum was ultra-centrifuged at 120,000 g for 16 h at 4 °C, then filtered through 0.22 μm filter (Millipore, CA, USA) prior to use.
2.5. Western blots Proteins were extracted from cells and exosomes with a mixture of RIPA buffer (Millipore), protease and phosphatase inhibitor cocktail (1:100) plus PMSF (Beyotime) and quantified using a BCA Protein Assay Kit (Thermo Fisher Scientific, Rockford, IL, USA). Protein samples were separated by 10% SDS-polyacrylamide gels and transferred to 0.45 μm nitrocellulose membranes (Millipore) using a semi-dry electrotransfer method. After blocking in tris-buffered saline and Tween-20 (TBST) containing 5% non-fat milk, the membranes were incubated overnight at 4 °C with the following primary antibodies: TSG101 (Abcam, Cambridge, UK), CD9 (Cell Signaling Technology, Danvers, MA, USA), ALIX (CST), E-cadherin (CST), N-cadherin (CST), Vimentin (CST), β− catenin (CST), p70 S6 kinase (CST), phospho-p70 S6 kinase (CST), 4EBP1 (CST), phopho-4EBP1 (CST), β− Actin (Santa Cruz Biotechnology, Dallas, TX, USA). Subsequent visualization was detected with enhanced chemiluminescence (ECL; Thermo Fisher Scientific) using ECL imaging system (Tanon, 5200, China).
2.2. Exosome isolation and labeling
2.6. RNA isolation and real-time PCR
The exosome-free culture medium was collected and centrifuged at 300 × g for 10 min, followed by 2000 × g for 20 min and 10,000 g for 30min. After discarding the pellets, the obtained medium was centrifuged at 110,000 g for 70 min at 4 °C to pellet exosomes. The pellet was diluted with PBS and centrifuged at 110,000 g for 70 min again, and finally resuspended in PBS. Purified exosomes were labeled with PKH26 red fluorescent labeling kit (Sigma, St. Louis, MO) as described by the manufacturer. Briefly, exosomes and 1 μl PKH26 were respectively diluted in 1 ml Dilution C. The obtained solutions were mixed and incubated for 1 min. Then the reaction was ended with 2 ml added exosome-free FBS. The mixture were centrifuged at 110,000 g for 70 min at 4 °C to pellet stained exosomes, which were used for uptake assay.
Total RNA from the cells and exosomes was isolated using RNAiso Plus (TaKaRa, Shiga, Japan) and QIAzol Lysis Reagent (Qiagen, Valencia, CA), respectively. The Mir-X miRNA First Strand Synthesis Kit (Clontech, Mountain View, CA, USA) was used in reverse transcription of miRNAs. mRNA levels were quantified using real-time analysis with SYBR Green (Clontech) on ABI 7900 H T according to the following protocol: 95 °C for 10 s, 40 cycles consisting of 95 °C for 5 s and 60 °C for 20 s, 95 °C for 60 s, 55 °C for 30 s, and 95 °C for 30 s. The intracellular miRNA expression level was normalized to U6 while the exosomal miRNA expression was normalized to cel-miR-39 (Exiqon, Vedbaek, Denmark) as a spike-in control. The primers were listed as follows: miR499a (forward 5′ − TTAAGACTTGCAGTGATGTTT − 3′); U6 (forward 5′ − CGCTTCGGCAGCACATATACTAAAATTGGAAC − 3′; reverse 5′ − GCTTCACGAATTTGCGTGTCATCCTTGC − 3′); cel-miR-39-F (forward 5′ − ACACTCCAGCTGGGTCACCGGGTGTAAATC − 3′; reverse 5′ − TGGTGTCGTGGAGTCG − 3′).
2.3. Transmission electron microscopy (TEM) and fluorescent imaging of exosome uptake The samples were prepared based on Thery's method (Thery et al., 2006). Briefly, an aliquot of exosome (5 μl) was dripped onto a copper grid. After sedimentation for 1 min, the droplet was sopped up using the air-laid paper. Then 5 μl of 2% uranyl acetate solution (Merck, 1.01005.9025) was loaded onto the same copper grid for negativestaining for 1 min. Then the staining solution was socked-out by air-laid paper. Finally, the samples on the copper grid were imaged on a Tecnai G2 spirit Biotwin TEM. For fluorescent imaging, the lung cancer cells A549 were seeded on coverslips in 24-well plates and the PHK26 labeled exosomes (20
2.7. miRNA mimics and inhibitors transfection Cells was transfected at 80% confluency with miR-499a-5p mimics and inhibitors or scrambled control (RiBoBio, Guangzhou, China) using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocols. 2.8. Cell proliferation assay 10,00 cells per well were seeded in a 96 well plate. 24 h after the 204
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
Fig. 1. Characterization of exosomes derived from lung adenocarcinoma cells. a Electron microscopy assay of exosomes derived from lung cancer cells. Scale bar = 100 nm b Western Blot analysis for exosomes marker in exosomes and cell lysates. c The amount of proteins in exosomes from the same number of SPC-A-1 and SPC-A-1-BM cells was quantified by BCA assay. SPC-A-1-BM (highly metastatic cell line) secreted more exosomes compared to SPC-A-1 cells. d The particle size of exosomes was measured by nanoparticle tracking analysis (NTA). e Cellular uptake of exosomes (1 μg/ mL) labeled with PKH26 by A549 cells. Image was captured 3 h and 6 h after addition of exosomes to the culture medium. Scale bar = 50 μm. Con, control; Exo, exosome. **p < 0.01. The error bars in all graphs represented SD.
treatment, Cell Counting Kit-8 solution (Yeasen, Shanghai, China) was added to each well at the dilution of 1:10, followed by incubation at 37 °C for 1–3 h. Absorbance at 450 nm was measured by microplate reader (Synergy 2; BioTek, Winooski, VT, USA).
monolayer was scraped with a sterile pipette tip. Then the cells were incubated with FBS-free medium and different reagents. Cell migration images were photographed using inverted microscope at 0 h and 24 h after scratch. The non-closed gap area demonstrated the ability of migration. The assays were performed three independent times.
2.9. Wound healing assay 2.10. Transwell assay 500,000 cells were seeded into 6-well plates per well and after growing to approximately 90% confluency, the confluent cell
The migration and invasion ability of cancer cells were assessed 205
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
Fig. 2. Upregulation of miR-499a-5p in both highly metastatic cell lines and their exosomes. SPC-A-1-BM had higher migration and invasion ability compared to SPCA-1 cell line. a Scratch assays were used to assess cell migration. Scale bar = 400 μm.b, c Transwell assays were used to assess cell migration and invasion. Scale bar = 100 μm.d, e Detection of differential expression of intracellular and exosomal miR-499a-5p among BEAS-2B, SPC-A-1, A549 and SPC-A-1-BM cell, as determined by qPCR. U6 and cel-miR-39-F were used as an internal control. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. The error bars in all graphs represented SD.
and stained with 0.1% crystal violet for 20 min. Then the cells attached to the lower surface of the membrane were imaged and counted by using microscope in three randomly selected areas per well.
using 8-mm pore size chamber inserts (Corning, New York, NY, USA). 2 × 104 cells stably expressing miR499a mimics, inhibitors and negative controls, suspended in 100 μl FBS-free medium, were added into the upper chamber per well (coated with or without matrigel) and the lower chamber was filled with 600 μl medium supplemented with 10% FBS as a chemoattractant. 24 h later, non-migrating or non-invading cells were removed from the upper surface of the membrane gently by cotton swab. The membrane was fixed with 100% methanol for 20 min
2.11. In vivo subcutaneous lung cancer model Cell suspension of A549 (5 × 106 cells) in a volume of 100 μl were injected subcutaneously into the right flanks of BALB/c male nude 206
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
Fig. 3. MiR-499a-5p promoted cell proliferation, migration and EMT in vitro. A549 and SPC-A-1-BM cells were transfected with miR-499a-5p mimics or inhibitors and negative controls. a, b Cell proliferation was measured by CCK8 assay. c The expressions of miR499a-5p after transfection were measured by qPCR. d, e Wound healing assay was performed on A549 and SPC-A-1-BM cells after transfection. Scale bar = 400 μm. f, g Transwell migration assays for A549 and SPC-A-1BM cells were determined. Scale bar = 100 μm.h Expressions of EMT markers E-cadherin, N-cadherin, β -catenin and Vimentin were detected by Western blot. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. The error bars in all graphs represented SD.
207
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
S2). Next, we verified the intracellular expression levels of miR-499a-5p in different lung cancer cells and human bronchial epithelial cells (BEAS-2B) and exosomal expression levels in different cells-derived exosomes by real-time PCR. The results demonstrated that the expressions of miR-499a-5p were upregulated both at endogenous and exosomal level in highly-metastatic SPC-A-1-BM cells (Fig. 2d and e). Thus, we focused on miR-499a-5p in the following experiments to study which role it played in tumor proliferation and metastasis.
mice. 2 weeks after implantation, miR-499a-5p mimics (5 nmol/ mouse), inhibitors (10 nmol/mouse) and negative controls (RiBoBio, Guangzhou, China) were respectively injected subcutaneously at a 3day interval. Tumor volumes were examined by caliper every 3 days, and calculated as formula 0.5 × length × width2. The sequence of the mimics and inhibitors were as follows: Negative Control mimics (sense 5′- UUUGUACUACACAAAAGUACUG-3′, antisense 5′-CAGUACUUUUG UGUAGUACAAA-3′); Negative Control Inhibitors (sense 5′- CAGUACU UUUGUGUAGUACAAA-3′); hsa-miR-499a-5p mimics sense (sense 5′-UUAAGACUUGCAGUGAUGUUU-3′, antisense AAACAUCACUGCAA GUCUUAA); hsa-miR-499a-5p inhibitors (sense 5′-AAACAUCACUGCA AGUCUUAA-3′).
3.3. MiR-499a-5p promotes cell proliferation, migration and EMT in vitro In order to investigate the impact miR-499a-5p had on NSCLC cell proliferation and migration, Loss- and gain-of-function experiments of miR-499a-5p were conducted adopting a transient transfection method with miR-499a-5p mimics or inhibitors. CCK assay demonstrated that in A549 and SPC-A-1-BM cells, miR-499a-5p overexpression promoted cell proliferation (Fig. 3a); on the contrary, miR-499a-5p inhibition restrained cell proliferation (Fig. 3b). Overexpression and knockdown effect of miR-499a-5p mimics and inhibitors were confirmed by qPCR, compared to negative controls (Fig. 3c). Scratch and transwell assays showed that overexpression of miR-499a-5p enhanced the migration capability (Fig. 3d, f), while miR-499a-5p knockdown exhibited suppressed migration capability (Fig. 3e, g). Furthermore, we measured the expressions of the epithelial and mesenchymal markers by Western blot analysis and found that E-cadherin was downregulated, and N-cadherin, β-catenin and Vimentin were upregulated in line with miR-499a5p overexpression. In contrast, the protein level of E-cadherin decreased, while N-cadherin, β-catenin and Vimentin levels increased in miR-499a-5p-inhibitor-treated cells. These illustrated that miR-499a-5p is a positive regulator of NSCLC proliferation, migration and EMT, thus contributing to metastasis.
2.12. Statistical analysis All data were expressed as mean ± standard and plotted using GraphPad Prism 7 software (GraphPad Software, Inc. La Jolla, CA). T test was used for analyzing the differences between two groups. Comparisons among several groups were analyzed by oneway ANOVAs with Tukey's post-hoc tests. p < 0.05 was considered statistically significant. All experiments were performed in triplicate and repeated at least three times. 3. Results 3.1. Isolation and characterization of exosomes derived from lung adenocarcinoma cells We incubated three lung adenocarcinoma cell lines, i.e., SPC-A-1, SPC-A-1-BM and A549, in medium containing exosome-free FBS. Exosomes purified from these three cell lines by serial ultra-centrifugation were identified by transmission electron microscopy (TEM) to be small (30–100 nm) spherical vesicles with bilayer membranes (Fig. 1a) [27]. The presence of common exosome markers, including ALIX, TSG101 and CD9, were observed by Western Blots (Fig. 1b). Total protein concentration of exosomes secreted by the same number of different cells was quantified by BCA assay and it revealed that SPC-A1-BM (highly metastatic cell line) secreted more exosomes compared to SPC-A-1 (Fig. 1c). NanoSight tracking analysis (NTA) was used to examine the diameter of isolated vesicles [28]. Nanoparticles derived from all three cell lines were mostly in a range of 30–150 nm in diameter (Fig. 1d). As we could see, the diameter range size of isolated vesicles analyzed in NTA and TEM basically coincided. Furthermore, we studied whether these exosomes could be taken up by cancer cells. Exosomes labeled with red dye PKH26(1 μg/mL were added into the culture medium of A549 cell, and then fluorescent imaging proved the presence of red fluorescence in the vicinity of the stained nucleus, which indicated that the recipient cells had shown direct uptake of exosomes in a time-dependent manner (Fig. 1e). And in Supplementary figure 1, when merged with bright field, we could see the cellular internalization of exosomes.
3.4. MiR-499a-5p accelerates tumor growth in vivo Aimed to further verify how miR-499a-5p influences tumor growth in vivo, subcutaneous xenograft models were established on BALB/c nude mice. Two weeks after implantation, miR-499a-5p mimics (5 nmol/mouse), inhibitors (10 nmol/mouse), and negative controls were injected subcutaneously into tumor nodules at a 3-day interval. Tumor volumes were examined by caliper every 3 days. Mice that received miR-499a-5p mimics treatment developed larger tumor nodules compared to those received negative controls treatment. The subcutaneous tumor nodules were photographed (Fig. 4b, p < 0.01). As shown in the growth curves and weights of tumors, the overexpression of miR-499a5p could accelerate tumor growth in vivo (Fig. 4b). While, mice that received miR-499a-5p inhibitors treatment developed smaller tumor nodules compared to those received negative controls treatment (Fig. 4c, p < 0.01). And the growth curves and weights of tumors indicated the anti-miR-499a-5p targeted therapy could inhibit tumor growth in vivo (Fig. 4c). 3.5. Down-regulation of endogenous miR-499a-5p inhibits exosomeinduced cell proliferation, migration and EMT
3.2. MiR-499a-5p is upregulated in both highly metastatic cell lines and their exosomes
To confirm that exosomes can function as vehicles of secreted miR499a-5p, we determined miR-499a-5p levels by qPCR in both A549 and SPC-A-1-BM cells treated with exosomes isolated from SPC-A-1 or SPCA-1-BM cells. Owing to higher miR-499a-5p expression level in SPC-A1-BM derived exosomes, an increase in intracellular level of miR-499a5p was observed in recipient cells co-cultured with exosomes from SPCA-1-BM cells in contrast with those from SPC-A-1 cells (Fig. 5a). To determine if exosomal miR-499a-5p had the pro-cancer capacity, CCK, wound healing and transwell assays were performed in recipient cells exposed to exosomes from the two different cells with or without miR499a-5p inhibitors. Results showed that exosomes isolated from SPC-A1-BM cells enhanced NSCLC cell proliferation and migration compared
In previous studies, SPC-A-1BM was established from SPC-A-1 through in vivo selection in BALB/c mouse models [25,26]. SPC-A-1BM cells showed higher migratory and invasive capability compared to SPC-A-1 cells. By wound healing assay and Transwell migration assay, the difference of cell migration ability was determined (Fig. 2a and b). Moreover, SPC-A-1-BM was more aggressive and capable of invading through extracellular matrigel compared to SPC-A-1 using transwell invasion assay (Fig. 2c). Due to the nature of the two cell lines, a highthroughput sequencing was applied to screen candidate metastasis-associated miRNAs in their exosomes. The result illustrated that miR499a-5p was upregulated in SPC-A-1BM exosomes (Supplementary Fig. 208
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
Fig. 4. MiR-499a-5p accelerated tumor growth in vivo. Cell suspension of A549 cells in a volume of 100 μL were injected subcutaneously into BALB/c nude mice. After implantation 2 weeks, miR499a-5p mimics (5nmol/ mouse), inhibitors (10nmol/mouse) and negative controls were injected subcutaneously at a 3-day interval. a Subcutaneous tumor nodules of mimics treatment group were photographed. b In mimics treatment group, the growth curve of tumor volumes was shown. The weights of tumors were recorded. c Subcutaneous tumor nodules of inhibiors treatment group were photographed. d In inhibitors treatment group, the growth curve of tumor volumes was shown. The weights of tumors were recorded. **p < 0.01; ***p < 0.001. The error bars in all graphs represented SD.
cells were transfected with miR-499a-5p inhibitors (Fig. 6a). We next attempted to study whether miR-499a-5p regulated metastasis through mTOR pathway. After A549 and SPC-A-1-BM cells were transfected with miR-499a-5p mimics, with or without the mTOR pathway inhibitor rapamycin, EMT markers were detected. Rapamycin could downregulate the expression of pS6K1 and p4E-BP1 and the EMT-promoting effect of miR-499a-5p mimics was partially attenuated by rapamycin (Fig. 6b). Scratch and transwell assays revealed that downregulating mTOR pathway could suppress miR-499a-5p-induced migration (Fig. 6c and d). Meanwhile, when we added the mTOR pathway activator MHY 1485 into the cells transfected with miR-499a5p inhibitors, we observed that activation of mTOR pathway could rescue the suppression of miR-499a-5p inhibitors-induced EMT. All evidences suggested that mTOR pathway was involved in the miR499a-5p-induced NSCLC cell metastasis.
to those from SPC-A-1 cells and knockdown of miR-499a-5p blocked the pro-cancer effect (Fig. 5b, c, d). Further, western blots were performed to assess the effect of exosomal miR-499a on EMT. Exosomes isolated from SPC-A-1-BM cells increased EMT. Also, cells transfected with miR499a-5p inhibitor showed decreased EMT induced by those exosomes (Fig. 5e). In conclusion, exosomes derived from SPC-A-1-BM cells enhanced proliferation, migration and EMT of recipient cells, which could be inhibited by miR-499a-5p inhibitor. This results suggested that miR499a-5p in exosomes was responsible for the observed cell proliferation and metastasis in our study. 3.6. MTOR pathway is involved in the miR-499a-induced NSCLC cell migration To further investigate the underlying molecular mechanisms of the simulative effects of miR-499a-5p on the metastasis of NSCLC cells, we performed western blots to screen related candidate pathways, including the MAPK (p-JNK, p-ERK, p-P38), pAKT and mTOR pathways. The results revealed that mTOR pathway was activated by miR499a overexpression and suppressed with the miR499a inhibition. When cells were transfected with miR-499a-5p mimics, protein levels of p-S6K1 and p-4E-BP1 increased, indicating the activation of mTOR pathway. On the contrary, protein levels of p-S6K1 and p-4E-BP1 decreased when
4. Discussion Accumulating evidence implicates that exosomes, known as extracellular microvesicles, can serve as critical mediators in a series of physiological and pathological processes, especially in the initiation, development, and further metastasis of cancer [29,30]. It has been reported that lung cancer-derived exosomes could enhance the migration, 209
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
Fig. 5. Exosomes promoted cell proliferation, migration and EMT, which could be inhibited by miR499a inhibitor. Exosomes (50 μg/ mL) isolated from SPCA-1 and SPC-A-1-BM cells were added into A549 and SPC-A-1-BM recipient cells, followed by transfection with miR-499a-5p inhibitors. a Expressions of miR499a-5p in recipient cells after addition of exosomes were detected by qPCR. b Cell proliferation was measured by CCK8 assay. c Cell migration was assessed by wound healing assay. Scale bar = 400 μm.d Cell migration was assessed by transwell assays. Scale bar = 100 μm. e Expressions of EMT markers E-cadherin, N-cadherin, β -catenin and Vimentin were detected by Western blot. *p < 0.05; **p < 0.01. The error bars in all graphs represented SD.
210
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
Fig. 6. MTOR pathway was involved in the miR-499a-5p-induced NSCLC cell metastasis. a miR-499a-5p activated mTOR pathway. Protein levels of p-S6K1, p4E-BP1 were measured using Western blot analysis in A549 and SPC-A-1-BM cells transfected with miR-499a-5p mimics or inhibitors and negative controls. b The mTOR pathway inhibitor rapamycin could suppress miR-499a-5p-induced EMT. A549 and SPC-A-1-BM cells were transfected with miR-499a-5p mimics and negative controls followed by addition of rapamycin (100 ng/ml). Expressions of p-S6K1,p-4E-BP1 and EMT markers were analyzed by Western blot. c, d The mTOR pathway inhibitor rapamycin could suppress miR-499a-5p-induced migration. Scratch (Scale bar = 400 μm.) and transwell assays (Scale bar = 100 μm.) were performed. e The mTOR pathway activator MHY1485 could rescue the suppression of EMT caused by miR-499a-5p inhibitors. A549 and SPC-A-1-BM cells were transfected with miR-499a-5p inhibitors and negative controls followed by addition of MHY1485 (10 μM). Expressions of p-S6K1,p-4E-BP1 and EMT markers were detected by Western blot. **p < 0.01; ***p < 0.001. The error bars in all graphs represented SD. 211
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
cycles, promoting biosynthesis of proteins and limiting catabolic processes especially like autophagy [37]. Recently, it has been reported to play a key role in the migration, invasion and EMT in various cancers, such as colorectal cancer, gastric cancer, gallbladder cancer, liver cancer, breast cancer, renal cell carcinoma, and lung cancer [38,39]. Several studies demonstrated that mTOR mediates EMT through RhoA and Rac1 in colorectal cancer, gallbladder cancer and prostate cancer [40–42]. In NSCLC, emerging evidence shows that many miRNAs may influence tumor metastasis through mTOR pathway, for example: miR193a-3p/5p suppress the migration and EMT via downregulating the mTOR pathway [43]. In our present study, it was observed that introduction of mTOR inhibitors or activators could rescue the increasing or decreasing effect on metastasis of miR-499a-5p overexpression or knockdown, suggesting that miR499a-5p promoted the migration and EMT via mTOR signaling. For the first time, we confirmed the existence of the miR499a-5p/mTOR axis and its metastatic promoting effect in lung adenocarinoma. Unfortunately, one limit of our research is failure to determine the direct target gene of miR-499a-5p and to further investigate the potential interaction between target gene and mTOR pathway. Besides, considering their anticancer function, the combination of the inhibitors of mTOR and miR-499a-5p deserves further investigation and may have a promising prospect. In conclusion, miR-499a-5p was significantly upregulated in highly metastatic NSCLC cells plus with their exosomes and could serve as a pro-metastatic role. Our work provides another piece of evidence that miRNAs can be transferred in form of exosomes, facilitating cell proliferation, migration and EMT. To the best of our knowledge, this is the first report which confirms the oncogenic effect of miR-499a-5p and establishes the miR499a/mTOR axis in NSCLC. However, additional experiments are necessary to delineate the underlying precise mechanisms. Collectively, our research provides novel diagnostic and therapeutic options for late stage lung cancer patients by targeting exosomal miR499a together with mTOR pathway.
invasion and EMT in human bronchial epithelial cells (HBEC) and cancer cells [31,32]. Recent studies have focused on the function of exosomal miRNAs in cell-to-cell communication and interaction [33]. MiRNAs are often packaged into exosomes and secreted by cancer cells, then taken up by other neighboring cells. However, which miRNA is working and the underlying molecular mechanisms remain still unclear. Thus, we applied a high-throughput sequencing of exosomal miRNAs to screen candidate metastasis-associated miRNAs, including miR-206, miR-205–5p, miR-1-3p, miR-133a-3p, miR-214–3p, miR-133 b, miR127–3p, miR-200 b-3p, miR-375, miR-499a-5p, miR-199a-5p, miR200c-3p etc., then selected the most likely metastasis-related one to perform further functional verification experiments. As previously described, we cultured SPC-A-1-BM, a human lung adenocarcinoma cell line, which has higher bone metastatic potential compared to its parental SPC-A-1 cell line. In our research, it was found that SPC-A-1-BM cells have a higher migratory and invasive capability in comparison with SPC-A-1 cells. Moreover, SPC-A-1-BM derived exosomes induced a more metastatic phenotype in recipient cancer cells compared to SPC-A-1 derived exosomes. We found that both intracellular and exosomal miR-499a-5p levels were elevated in cells with higher invasiveness, suggesting that miR-499a-5p may be correlated with metastasis. We propose that miR-499a-5p would be a metastasisrelated biomarker for lung cancer. Nowadays, since liquid biopsy technologies quickly evolve, detection of serum exosomes as a non-invasive procedure has become more promising, giving consideration to its increasing diagnostic and prognostic value. Previous study established a circulating exosomal miRNAs panel to discriminate between adenocarcinoma (AC) and squamous cell carcinoma (SCC) for early stage NSCLC [34]. MiR-181–5p, miR-30a-3p, miR-30e-3p and miR361–5p were adenocarcinoma-specific, while miR-10 b-5p, miR-15 b-5p and miR-320 b were squamous cell carcinoma-specific [34]. In our study, however, one shortfall is the lack of verification in clinical serum samples. The detection of serum exosomal miR-499a-5p should be carried out in the future to investigate whether it concurs with our experimental data. MiR-499a has been reported as an ideal tumor biomarker as it is involved in several biological processes, for examples: cellular senescence, apoptosis, inflammation and immune responses, all of which contribute to the occurrence and development of tumors [35]. Overexpression of miR-499a-5p was reported to facilitate the invasion of colorectal cancer cells in vitro by targeting FOXO4 and PDCD4 and promote tumor metastasis to lung and liver in vivo [36]. It was previously observed that miR-499a-5p upregulation enhanced proliferation and migration of HBV-related HCC cells via MAPK624. However, the role of miR-499a-5p in NSCLC was not illustrated. We firstly demonstrated that miR-499a-5p could promote the proliferation, migration and EMT in lung adenocarcinoma cell in vitro and inhibition of miR-499a-5p could suppress tumor growth in vivo. Our finding that miR-499a-5p exhibits cancer promoting properties is consistent with previous reports in other cancers. Further, our data supports the hypothesis that exosomes increase the metastatic ability by transfer of miR-499a-5p. MiR499a-sufficient exosomes increased the proliferation, migration and EMT, which could be inhibited by miR-499a-5p downregulation. Taken together, it may provide an anti-miR499a strategy as a novel gene therapeutic application to treat NSCLC patients and it is worth speculating that the use of exosomes as vehicles for miRNA antagomirs might achieve improved efficacy for cancer therapy. To further investigate which signaling pathway is involved in the miR-499a-5p-induced metastatic promoting effect, we screened multiple signal pathways using Western blot analysis. Interestingly, mTOR pathway was found to be activated by miR-499a-5p upregulation and inhibited by miR-499a-5p downregulation. mTOR pathway is mostly mediated by phosphorylation of two downstream effectors, the eukaryotic initiation factor 4 E (eIF4E)-binding protein 1 (4 E-BP1) and the p70 ribosomal S6 kinase 1 (p70S6K1). mTOR signaling regulates cell proliferation, apoptosis, metabolism and survival by controlling cell
Conflicts of interest The authors declare that they have no conflict of interest. Acknowledgements This work was funded by the National Key R&D Program of China (2016YFC1303300 to S.L.), the National Natural Science Foundation of China (81672272 to S.L. and 81773115 to W.X.), the National Key Grant of China (2016YFC0906400 to W.X.), the Key Project of Shanghai Health & Family Planning Commission (201540365 to S.L.), Shanghai Municipal Science & Technology Commission Research Project (17431906103 to S.L.), and Shanghai Scientific Research Projects (14140902800 to S.L.) Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.yexcr.2019.03.035. References [1] F. Bray, et al., Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA A Cancer J. Clin. 68 (2018) 394–424. [2] N. Hanna, et al., Systemic therapy for stage IV non-small-cell lung cancer: American Society of Clinical Oncology clinical practice guideline update, J. Clin. Oncol. 35 (2017) 3484–3515. [3] H. Acloque, M.S. Adams, K. Fishwick, M. Bronner-Fraser, M.A. Nieto, Epithelialmesenchymal transitions: the importance of changing cell state in development and disease, J. Clin. Investig. 119 (2009) 1438–1449. [4] M.A. Nieto, R.Y.-J. Huang, R.A. Jackson, J.P. Thiery, EMT: 2016, Cell 166 (2016) 21–45. [5] C. Théry, M. Ostrowski, E. Segura, Membrane vesicles as conveyors of immune
212
Experimental Cell Research 379 (2019) 203–213
S. He, et al.
responses, Nat. Rev. Immunol. 9 (2009) 581. [6] A.V. Vlassov, S. Magdaleno, R. Setterquist, R. Conrad, Exosomes: current knowledge of their composition, biological functions, and diagnostic and therapeutic potentials, Biochim. Biophys. Acta Gen. Subj. 1820 (2012) 940–948. [7] C. Lässer, et al., Human saliva, plasma and breast milk exosomes contain RNA: uptake by macrophages, J. Transl. Med. 9 (2011) 9. [8] F. Andre, et al., Malignant effusions and immunogenic tumour-derived exosomes, Lancet 360 (2002) 295–305. [9] E. Hosseini-Beheshti, et al., Exosomes confer pro-survival signals to alter the phenotype of prostate cells in their surrounding environment, Oncotarget 7 (2016) 14639. [10] A.S. Azmi, B. Bao, F.H. Sarkar, Exosomes in cancer development, metastasis, and drug resistance: a comprehensive review, Cancer Metastasis Rev. 32 (2013) 623–642. [11] Y. Hsu, et al., Hypoxic lung cancer-secreted exosomal miR-23a increased angiogenesis and vascular permeability by targeting prolyl hydroxylase and tight junction protein ZO-1, Oncogene 36 (2017) 4929. [12] B. Costa-Silva, et al., Pancreatic cancer exosomes initiate pre-metastatic niche formation in the liver, Nat. Cell Biol. 17 (2015) 816. [13] J.R. Lytle, T.A. Yario, J.A. Steitz, Target mRNAs are repressed as efficiently by microRNA-binding sites in the 5′ UTR as in the 3′ UTR, Proc. Natl. Acad. Sci. Unit. States Am. 104 (2007) 9667–9672. [14] D.P. Bartel, MicroRNAs: target recognition and regulatory functions, Cell 136 (2009) 215–233. [15] J. Lu, et al., MicroRNA expression profiles classify human cancers, Nature 435 (2005) 834. [16] W.C. Zhang, et al., Tumour-initiating cell-specific miR-1246 and miR-1290 expression converge to promote non-small cell lung cancer progression, Nat. Commun. 7 (2016) 11702. [17] M. Florczuk, A. Szpechcinski, J. Chorostowska-Wynimko, miRNAs as biomarkers and therapeutic targets in non-small cell lung cancer: current perspectives, Targeted Oncol. 12 (2017) 179–200. [18] T.-H. Chang, et al., Upregulation of microRNA-137 expression by Slug promotes tumor invasion and metastasis of non-small cell lung cancer cells through suppression of TFAP2C, Cancer Lett. 402 (2017) 190–202. [19] F. Olivieri, et al., Admission levels of circulating miR-499-5p and risk of death in elderly patients after acute non-ST elevation myocardial infarction, Int. J. Cardiol. 172 (2014) e276–e278. [20] W. Du, et al., Associations of single nucleotide polymorphisms in miR-146a, miR196a, miR-149 and miR-499 with colorectal cancer susceptibility, Asian Pac. J. Cancer Prev. APJCP 15 (2014) 1047–1055. [21] F. Qiu, et al., Sequence Variation in Mature microRNA-499 Confers Unfavorable Prognosis of Lung Cancer Patients Treated with Platinum-Based Chemotherapy, Clinical Cancer Research, 2015. [22] A. Okamoto, et al., Enhanced efficacy of doxorubicin by microRNA-499-mediated improvement of tumor blood flow, J. Clin. Med. 5 (2016) 10. [23] X. Li, et al., MiR-499 regulates cell proliferation and apoptosis during late-stage cardiac differentiation via Sox 6 and cyclin D1, PLoS One 8 (2013) e74504. [24] Z. Xiang, S. Wang, Y. Xiang, Up-regulated microRNA499a by hepatitis B virus
[25]
[26]
[27] [28]
[29] [30] [31] [32]
[33] [34]
[35] [36]
[37] [38]
[39] [40]
[41] [42] [43]
213
induced hepatocellular carcinogenesis via targeting MAPK6, PLoS One 9 (2014) e111410. S. Yang, et al., Establishment of an experimental human lung adenocarcinoma cell line SPC-A-1BM with high bone metastases potency by 99 mTc-MDP bone scintigraphy, Nucl. Med. Biol. 36 (2009) 313–321. Y. Yu, et al., Everolimus and zoledronic acid—a potential synergistic treatment for lung adenocarcinoma bone metastasis, Acta Biochim. Biophys. Sin. 46 (2014) 792–801. S.T.-Y. Chuo, J.C.-Y. Chien, C.P.-K. Lai, Imaging extracellular vesicles: current and emerging methods, J. Biomed. Sci. 25 (2018) 91. V. Sokolova, et al., Characterisation of exosomes derived from human cells by nanoparticle tracking analysis and scanning electron microscopy, Colloids Surfaces B Biointerfaces 87 (2011) 146–150. A. Hoshino, et al., Tumour exosome integrins determine organotropic metastasis, Nature 527 (2015) 329. A.J. Szempruch, et al., Extracellular vesicles from Trypanosoma brucei mediate virulence factor transfer and cause host anemia, Cell 164 (2016) 246–257. M.A. Rahman, et al., Lung cancer exosomes as drivers of epithelial mesenchymal transition, Oncotarget 7 (2016) 54852. H. Wu, et al., Circulating exosomal microRNA‐96 promotes cell proliferation, migration and drug resistance by targeting LMO7, J. Cell Mol. Med. 21 (2017) 1228–1236. H. Valadi, et al., Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells, Nat. Cell Biol. 9 (2007) 654. X. Jin, et al., Evaluation of tumor-derived exosomal miRNA as potential diagnostic biomarkers for early-stage non–small cell lung cancer using next-generation sequencing, Clin. Cancer Res. 23 (2017) 5311–5319. J.-X. Wang, et al., miR-499 regulates mitochondrial dynamics by targeting calcineurin and dynamin-related protein-1, Nat. Med. 17 (2011) 71. X. Liu, et al., MicroRNA-499-5p promotes cellular invasion and tumor metastasis in colorectal cancer by targeting FOXO4 and PDCD4, Carcinogenesis 32 (2011) 1798–1805. C. Fumarola, M.A. Bonelli, P.G. Petronini, R.R. Alfieri, Targeting PI3K/AKT/mTOR pathway in non small cell lung cancer, Biochem. Pharmacol. 90 (2014) 197–207. A. Kwasnicki, D. Jeevan, A. Braun, R. Murali, M. Jhanwar-Uniyal, Involvement of mTOR signaling pathways in regulating growth and dissemination of metastatic brain tumors via EMT, Anticancer Res. 35 (2015) 689–696. P. Zhang, et al., MiR-646 inhibited cell proliferation and EMT-induced metastasis by targeting FOXK1 in gastric cancer, Br. J. Canc. 117 (2017) 525. P. Gulhati, et al., mTORC1 and mTORC2 regulate EMT, motility and metastasis of colorectal cancer via RhoA and Rac1 signaling pathways, Cancer Res. 4058 (2011) 2010. H. Zong, et al., Inhibition of mTOR pathway attenuates migration and invasion of gallbladder cancer via EMT inhibition, Mol. Biol. Rep. 41 (2014) 4507–4512. X. Chen, et al., mTOR regulate EMT through RhoA and Rac1 pathway in prostate cancer, Mol. Carcinog. 54 (2015) 1086–1095. T. Yu, et al., MicroRNA-193a-3p and-5p suppress the metastasis of human nonsmall-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway, Oncogene 34 (2015) 413.