Exposure to atrazine affects the expression of key genes in metabolic pathways integral to energy homeostasis in Xenopus laevis tadpoles

Aquatic Toxicology 104 (2011) 254–262

Contents lists available at ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Exposure to atrazine affects the expression of key genes in metabolic pathways integral to energy homeostasis in Xenopus laevis tadpoles Renee M. Zaya ∗ , Zakariya Amini, Ashley S. Whitaker, Charles F. Ide Great Lakes Environmental and Molecular Sciences Center, Department of Biological Sciences, 3425 Wood Hall, Western Michigan University, 1903 West Michigan Avenue, Kalamazoo, MI 49008, USA

a r t i c l e

i n f o

Article history: Received 15 November 2010 Received in revised form 15 March 2011 Accepted 30 April 2011 Keywords: Atrazine Xenopus qRT-PCR Microarray ATP ADP

a b s t r a c t In our laboratory, Xenopus laevis tadpoles exposed throughout development to 200 or 400 ␮g/L atrazine, concentrations reported to periodically occur in puddles, vernal ponds and runoff soon after application, were smaller and had smaller fat bodies (the tadpole’s lipid storage organ) than controls. It was hypothesized that these changes were due to atrazine-related perturbations of energy homeostasis. To investigate this hypothesis, selected metabolic responses to exposure at the transcriptional and biochemical levels in atrazine-exposed tadpoles were measured. DNA microarray technology was used to determine which metabolic pathways were affected after developmental exposure to 400 ␮g/L atrazine. From these data, genes representative of the affected pathways were selected for assay using quantitative real time polymerase chain reaction (qRT-PCR) to measure changes in expression during a 2-week exposure to 400 ␮g/L. Finally, ATP levels were measured from tadpoles both early in and at termination of exposure to 200 and 400 ␮g/L. Microarray analysis revealed significant differential gene expression in metabolic pathways involved with energy homeostasis. Pathways with increased transcription were associated with the conversion of lipids and proteins into energy. Pathways with decreased transcription were associated with carbohydrate metabolism, fat storage, and protein synthesis. Using qRT-PCR, changes in gene expression indicative of an early stress response to atrazine were noted. Exposed tadpoles had significant decreases in acyl-CoA dehydrogenase (AD) and glucocorticoid receptor protein (GR) mRNA after 24 h of exposure, and near-significant (p = 0.07) increases in peroxisome proliferator-activated receptor ␤ (PPAR-␤) mRNA by 72 h. Decreases in AD suggested decreases in fatty acid ␤-oxidation while decreases in GR may have been a receptor desensitization response to a glucocorticoid surge. Involvement of PPAR-␤, an energy homeostasis regulatory molecule, also suggested changes in energy status. Despite, or possibly because of, these early gene changes, there were no differences in either absolute ATP levels or ADP:ATP ratios early in the exposure. However, livers from animals exposed to 200 ␮g/L atrazine had near-significant (p = 0.06) increases in ADP:ATP ratios at the end of exposure suggesting tadpoles may have had difficulty maintaining energy homeostasis. Perturbations in the expression of genes regulating energy metabolism by 24 h into exposure to 400 ␮g/L atrazine was noteworthy, especially since these tadpoles were significantly smaller than controls by 72 h of exposure. © 2011 Elsevier B.V. All rights reserved.

1. Introduction The ubiquitous occurrence of anthropomorphic contaminants in the environment has become an ever-present concern. Agencies must balance the economic and societal needs associated with these compounds with their impacts on our environment and our own health. One such compound, atrazine, has been in use since 1958 and has been valuable to the generation of plen-

∗ Corresponding author. Tel.: +1 269 387 5612; fax: +1 269 387 5609. E-mail addresses: [email protected] (R.M. Zaya), [email protected] (Z. Amini), [email protected] (A.S. Whitaker), [email protected] (C.F. Ide). 0166-445X/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.aquatox.2011.04.022

tiful and inexpensive agricultural products; however, it also has been the subject of much controversy over the safety of its continued use. Atrazine has been shown to be an endocrine disruptor (Bisson and Hontela, 2002; Cooper et al., 2000; Fan et al., 2008; Holloway et al., 2008; Laws et al., 2003; McMullin et al., 2004; Stoker et al., 2002) as well as an immunotoxin (Brodkin et al., 2007; Pinchuk et al., 2007; Pruett et al., 2003; Rowe et al., 2007, 2008), all at low exposure levels. At higher exposure levels, it causes a number of effects that are similar across a number of animal species, including decreases in body weight, body fat stores, anorexia (Eason and Scanlon, 2002; Gammon et al., 2005; Ottinger et al., 2006), developmental delays and abnormalities (Infurna et al., 1988; Nieves-Puigdoller et al., 2007; Rayner et al., 2005; Tavera-Mendoza et al., 2001, 2002; Weigand et al., 2001), and

R.M. Zaya et al. / Aquatic Toxicology 104 (2011) 254–262

changes in behavior (Alvarez and Fuiman, 2005; Ottinger et al., 2006). In previous studies, African Clawed frog tadpoles (Xenopus laevis) exposed to atrazine at levels found in ditches, runoff, and vernal pools soon after application, 200 and 400 ␮g/L (Battaglin et al., 2009; Freeman and Rayburn, 2005; Gaynor et al., 1995), throughout development consistently showed decreases in body weight and length and reductions in fat body size, both which are indicative of possible energy deficits (Langerveld et al., 2009; Zaya et al., 2011). These animals also had changes in the expression of genes responsible for digestive enzymes and growth that suggested transcriptional activity was directed toward increased protein and carbohydrate digestion and reduced growth (Langerveld et al., 2009). In a subsequent study, the livers of exposed tadpoles appeared to be compromised. They were smaller in weight and had greater numbers of hepatocytes immunopositive for activatedcaspase 3, the final protease required for the initiation of the apoptotic process (Elmore, 2007), after exposure to 400 ␮g/L atrazine throughout development (Zaya et al., 2011). Immunopositive cells were considered likely to proceed through apoptosis and die suggesting that atrazine exposed tadpoles had increased rates of programmed cell death in their livers. Traditional toxicological approaches have been widely used to determine the effects of environmental toxins on model species for fish, birds, and amphibians. For some time, the pharmaceutical industry has been incorporating the use of molecular and biochemical technologies to augment traditional toxicology studies for drug development (Gross and Kramer, 2003). The use of this approach is gaining interest in environmental toxicology circles. Since there was an interest in investigating the fundamental mechanisms behind the changes noted in our atrazine studies, the addition of assays that would provide information about changes at the transcriptional and biochemical levels was implemented. It was hoped that this approach would help to test the hypothesis that atrazine exposure altered energy homeostasis in X. laevis tadpoles. Aided by the re-analysis of Affymetrix microarray data generated from a previous study (Langerveld et al., 2009) and bearing in mind the physical and histological effects noted in that and subsequent studies (Zaya et al., 2011), several genes of interest were chosen for study during the exposure using quantitative real-time polymerase chain reaction (qRT-PCR). In addition, ATP and ADP:ATP ratios were measured determine if there were detectable changes in these parameters that would directly indicate a perturbation in energy homeostasis had occurred. The resulting findings provided an initial look into the mechanisms potentially responsible for the changes noted in X. laevis tadpoles after exposure to atrazine throughout development.

2. Methods and materials 2.1. Animals and atrazine exposure The animals used for the analyses reported in this article were from two of the six studies reported in a companion article (Zaya et al., 2011). In addition to measuring a number of physical parameters, a random sample of tadpoles from one study (Study C) was collected for differential gene expression assays while a random sampling from another study (Study F) was used for the analysis of ATP levels and ADP:ATP ratios. These biochemical assays are the focus of this paper. The following is an abbreviated description of the methods and materials regarding the animals reported in this study and their exposure. Details regarding the specific experimental design of all six studies can be found in Table 1 and includes all tests conducted

255

in each study. The results from the phenotypic measurements are presented and discussed in Zaya et al. (2011). In addition, tabulated data from each study are available in the supplemental material. Western Michigan University’s Institutional Animal Care and Use Committee approved all procedures (Protocol #: 06-07-01). Briefly, tadpoles were obtained from an in-house breeding colony. Five days post-hatching, at approximately Nieuwkoop and Faber (NF) Stage 47 (Nieuwkoop and Faber, 1994), tadpoles were separated into 20 cm × 20 cm glass bowls containing 1 L of water with or without atrazine. At the start of the studies, each bowl contained no more than 8 tadpoles and by 2 weeks into the study, there were no more than 4 tadpoles per bowl for the remainder of the studies. Study C had 20 bowls for each concentration level and in Study F there were 20 control and 400 ␮g/L bowls, and 10 200 ␮g/L bowls. Exposure bowls were kept on the lab bench and stacked on wire shelving to accommodate the number of bowls in a single location. To control for environmental variation, all bowls were randomly positioned. Tadpoles were maintained at 19–23 ◦ C with ambient light exposure. Exposure water was completely replaced 3 times weekly. Tadpoles were fed a suspension of powdered Purina rabbit chow #5354 ad libitum. Exposure solutions were prepared by dilution of a stock solution of 25 mg/L atrazine in exposure water. X. laevis tadpoles were exposed to nominal concentrations of 0, 200 and/or 400 ␮g/L atrazine from Day 5 post-hatching, approximately NF Stage 47, to NF Stage 62 (approximately 50 days; Nieuwkoop and Faber, 1994). The 200 and 400 ␮g/L concentrations were chosen since they are within the range reported to periodically occur in puddles, vernal ponds and runoff soon after application (Gaynor et al., 1995; Storrs and Kiesecker, 2004). The 400 ␮g/L level was chosen because it was the exposure concentration used in Langerveld et al. (2009) which produced changes in fat body size. The 200 ␮g/L level was chosen since it was a concentration approximately mid way between 400 ␮g/L and lowest exposure concentration (25 ␮g/L) used in this series of studies (Table 1).

2.2. Reanalysis of Affymetrix Gene chip data In order to further characterize changes in gene expression noted in X. laevis tadpoles after atrazine exposure in a previous study (Langerveld et al., 2009), and to choose genes of interest for the qRT-PCR analysis reported in this article, chp data from the previous study were re-analyzed with different software, GeneSifterTM (VizX Labs, Seattle, WA) an on-line gene analysis software tool. This software was designed to determine which metabolic processes were “over-” or “under-represented” by the overall pattern of gene changes present in analyzed samples. The generation of raw microarray data and chp files using Affymetrix Xenopus laevis genome microarrays was previously described (Langerveld et al., 2009). Twelve chp files from unexposed tadpoles and 11 chp files from 400 ␮g/L atrazine exposed tadpoles were generated using the Affymetrix Microarray Suite v5.0 Software by scaling all probe sets to a mean target intensity of 500. These chp files were uploaded into GeneSifter® and a pairwise analysis was used to find differentially expressed genes (p ≤ 0.05) and any over-represented (z-score > +2) or under-represented (zscore < −2) biochemical pathways. Since RNA was extracted from whole animals and there was the possibility that smaller changes would be masked, a data filter that included a fold change was not used. Instead, a restrictive statistical analysis was applied and only changes that were statistically significant (p ≤ 0.05) were accepted. Significance was determined using a Student’s t-test with a Bonferroni correction. Data from both sexes were combined, normalized to mean intensity and log transformed; only genes with

256

R.M. Zaya et al. / Aquatic Toxicology 104 (2011) 254–262

Table 1 Summary of experimental design for individual exposures. Study ID

Study A

Study B

Study C

Parent ID Exposure level # Bowls/exposure level In-life phase measurements Early individual body weights Weekly body weights (days) Weekly stages (days) Feeding behavior (days) Mortality Terminal measurements Stage at termination Terminal body weight Age at termination Terminal body length Liver weight (% Body weight) Fat body size (% body weight) Sex ratio Liver microscopy (H&E, PAS, ORO) Fat body microscopy (H&E, ORO)

31M, 32F 0, 400 ␮g/L 20

20M, 34F 0, 400 ␮g/L 10

36M, 37F 0, 400 ␮g/L 20

No 22, 29, 36, 43, 50 22, 29, 36, 43, 50 No Yes

No 10, 17, 24, 31, 38 No No Yes

24, 48, 72 h into exposure and Day 14 14, 21, 28, 35, 42 14, 21, 28, 35, 42 No No

Stage 62 Yes Yes Yes Yes (fresh) Yes Yes PAS, ORO ORO, H&E

Stage 58 Yes Yes No Yes (fixed) Yes No H&E ORO, H&E

Stage 62 Yes No Yes Yes (fresh) Yes Yes No No

Other tests

None

None

qRT-PCRa

Study ID

Study D

Study E

Study F

Parent ID Exposure level # Bowls/exposure level In-life phase measurements Early Individual body weights Weekly BW (days) Weekly stages (days) Feeding behavior (days) Mortality Terminal measurements Stage at termination Terminal body weight Age at termination Terminal body length Liver weight (% body weight) Fat body size (% body weight) Sex ratio Liver microscopy (H&E, PAS, ORO) Fat body microscopy (H&E, ORO)

36M, 37F 0, 400 ␮g/L 20

33M, 30F 0, 25, 200 ␮g/L 10

35M, 38F 0, 200, 400 ␮g/L 15 (0 and 400 ␮g/L); 10 (200 ␮g/L)

No 12, 19, 26, 33, 40 12, 19, 26, 33, 40 Days 17–40 Yes

No 15, 23, 30, 37 15, 23, 30, 37 Days 7–37 Yes

24, 48, 72 h into exposure 13, 20, 27, 34 13, 20, 27, 34 Days 6–40 Yes

Stage 62 Yes Yes Yes Yes (fresh) Yes Yes H&E ORO

Stage 62 Yes Yes Yes Yes (fresh) Yes Yes H&E No

Stage 62 Yes Yes Yes Yes (fresh) Yes Yes PAS, ORO No

Other tests

Liver: ICC for activated caspase-3

None

[ATP] and ADP:ATP ratiob

M: male; F: female; No: parameter not measured; Yes: parameter measured; H&E: hematoxylin and eosin staining for morphological analysis; PAS: periodic acid Schiff/diastase staining for glycogen; ORO: Oil Red O staining for lipids; and ICC: immunocytochemistry. a Quantitative real-time polymerase chain reaction, see Zaya et al. (2011) for further details. b ATP concentration and ADP:ATP ratios determined, see Zaya et al. (2011) further for details.

present calls in all control and atrazine-exposed animals were analyzed. 2.3. Differential gene expression A single tadpole from control and atrazine exposure bowls were collected for gene expression analysis at 24, 48, 72 h; and 14 days after the beginning of the exposure. Tadpoles were euthanised by submersion in 0.125 g/L MS222 (ethyl-3-aminobenzoate methanesulfonate salt; Sigma–Aldrich, St. Louis, MO) weighed, snap frozen in liquid nitrogen, and stored at −80 ◦ C until processed. Total RNA extracts were assayed for variations in gene expression related to 400 ␮g/L atrazine exposure at these early time points. 2.3.1. Total RNA extraction Total RNA was isolated from individual whole tadpoles for qRT-PCR assays using Qiagen RNeasy Mini and Midi kits as per manufacturer’s instructions. Yeast mRNA (25 ng for NF Stage 62 tadpoles, 5 ng for 24, 48, 72 h tadpoles, 10 ng for 14-day tadpole samples; ClonTech, Palo Alto, CA) was spiked into each extraction during the tissue homogenation step as an exogenous

internal control for the extraction and analysis. Samples used for qRT-PCR analysis were assessed for concentration and quality using a NanoDrop spectrophotometer (Nanodrop Technologies, Inc., Wilmington, DE). Total RNA samples chosen for analysis had A260 /A280 ratios of at least 2.0, A280 /A230 absorbance ratios of at least 1.7 and passed visual evaluation of 28S and 18S ribosomal RNA by agarose gel electrophoresis. Total RNA (1 ␮g) was converted to cDNA using the High Capacity cDNA Archive Kit (Applied Biosystems) as per manufacturer’s instructions. 2.3.2. Qualitative real-time polymerase chain reaction Genes of interest for this analysis were chosen using the following criterion: (1) they were genes that were significantly changed (increased or decreased; p ≤ 0.05) after the microarray data analysis and (2) they were those that encoded rate-limiting enzymes, enzymes that trigger committed steps of biochemical pathways or proteins that represent other metabolic or signaling processes involved with energy homeostasis. The genes chosen for analysis included Xenopus hypoxia inducible factor 1␣ (HIF1␣; UniGene Xl.4589), carbamoyl-phosphate synthetase 1 (CPS 1; UniGene Xl.50882), E3 component of pyruvate dehydrogenase

R.M. Zaya et al. / Aquatic Toxicology 104 (2011) 254–262 Table 2 qRT-PCR genes tested and their primer probe sequences. Gene name

Sequence

Hypoxia inducible factor 1␣ Forward primer GCAGAGCAAAGAACAATCCTCTTAC AGTCAGCTGAGGAAGAACAGTTC Reverse primer CTGCCCAAGCAACTGA Probe Carbamoyl-phosphate synthetase 1 GTGGTTAAACTCTTTGCTGAATCGA Forward primer TGGAAGAGGCTCTTGGTATCCA Reverse primer TCCCCTGCGTATTTCA Probe E3 component of pyruvate dehydrogenase TGGTGTTGAATTGGGCTCTGT Forward primer CCCAAAAACTCAACTGCTGTAACAT Reverse primer TCCCAGCCGCTGCCAT Probe Acyl-CoA dehydrogenase family member 10 CTTCCGTAGTCGGCTTGTTACT Forward primer GCAAATACTGTAAGTTCCGATGTATGC Reverse primer Probe CAGTGCCTTAATTTTG Peroxisome proliferator activated receptor ␤ CATGCTGAGCTTGTCCAGAGTATAA Forward primer TGTCTCTGTAAATCTCTTGCAGTAATGG Reverse primer Probe CAGCGCGGCTCTACAT Glucocorticoid receptor GCAAGAGAGATGTCAGGAGATGTT Forward primer ACAAGACTTTCATGCAGAGATATTCATCAT Reverse primer TTCACCTGCAATCTTC Probe Yeast actin TGGATTCCGGTGATGGTTGTT Forward primer TCAAAATGGCGTGAGGTAGAGA Reverse primer CTCACGTCGTTCCAATTTACGCTGGTTT Probe

(E3; UniGene Xl.54924), acyl-CoA dehydrogenase family member 10 (AD; UniGene Xl.9459), peroxisome proliferator activated receptor-␤ (PPAR-␤; UniGene ID Xl.846), and glucocorticoid receptor protein (GR; UniGene ID X72211.1). Primer/probe sets for each gene were purchased as Custom-Designed Taqman Gene Expression Assays (Applied Biosystems) except for yeast actin, which was designed using Primer Express software (Applied Biosystems). The sequences for each primer probe set are presented in Table 2. Each 30 ␮L qRT-PCR reaction (n = 8 for both 0 and 400 ␮g/L atrazine) was run in duplicate and contained Taqman Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems) with 0, 2.5 or 5 ng of cDNA and the appropriate primer/probe set. The qRT-PCR reaction was carried out in an Applied Biosystems 7700 Sequence Detection System using thermal cycling conditions of 10 min at 95 ◦ C followed by 50 cycles of 15 s at 95 ◦ C and 1 min at 60 ◦ C. Quantification was determined using 4 point standard curves constructed with pooled control cDNA, with slopes ranging from −3.0 to −3.8. The mean value from each duplicate was calculated and only duplicates with standard deviations of ≤0.25 were used for data analysis. Gene expression data from exposed tadpoles were normalized to the yeast actin signal within each sample. These normalized data were analyzed with an ANOVA using StatView 4.0 software. An exogenous yeast actin gene was chosen as the reference gene to circumvent the potential that the canonical housekeeping genes were potentially affected by the treatments. The data generated by the microarray showed that a number of biochemical pathways containing genes normally used as internal controls were affected negating the use of these genes as endogenous controls. This technique has been successfully used by our laboratory and has been previously published (Lehigh Shirey et al., 2006; Fisher et al., 2006). 2.4. ATP concentration and ADP/ATP ratio determination In Study F (Zaya et al., 2011), tadpoles from each exposure group were collected at 24 (n: control = 10; 200 ␮g/L = 9; 400 ␮g/L = 11), 48 (n = 10 all groups), and 72 h (n: control = 11; both atrazine groups = 10), after the beginning of the exposure and processed as

257

described above. One tadpole from each bowl was also collected at NF Stage 62 (n: control = 12; both atrazine groups = 8), where it was weighed, its body length measured, and its liver excised, weighed and immediately snap frozen with liquid nitrogen. ATP and ADP was extracted and measured from each sample to determine whether there were differences between unexposed tadpoles and those exposed to 200 or 400 ␮g/L atrazine (Study F; Zaya et al., 2011). 2.4.1. ATP and ADP extraction ATP and ADP were extracted from snap frozen whole tadpoles and livers from NF Stage 62 tadpoles using a method described by Napolitano and Shain (2005). Frozen whole tadpoles and livers were placed into a 1.5 mL Eppendorf microfuge tube containing 200 ␮L ice-cold 7% perchloric acid per 10 mg tissue and homogenized with a micropestal (Fisher Scientific). The homogenate was vortexed, allowed to stand on ice for 10 min and centrifuged at 14,000 × g for 5 min at 4 ◦ C. The resulting supernatant was removed and neutralized with a solution of 0.3 M KCl, 0.4 M Tris, and 3M KOH at a rate of 74 ␮L per 200 ␮L of supernatant. The resulting extraction mixture was vortexed and the precipitate removed by centrifugation (14,000 × g for 5 min at 4 ◦ C). The final supernatant was removed, split into aliquots and frozen at −80 ◦ C until assayed. To calculate percent ATP recovery for the extraction, a known amount of ATP was spiked into a sample aliquot immediately following tissue homogenation. Percent recovery for ATP was >98% and was similar to recovery reported by Napolitano and Shain (2005). Since ADP is similar in structure to ATP and there was no direct test for ADP in the experimental design, it was the assumption that the percent recovery for ADP was similar to ATP. 2.4.2. Bioluminescence assay for ATP concentration and ADP:ATP ratio determination All samples were assayed for ATP and ADP content with a firefly luciferase bioluminescence assay using an ATP Determination Kit (Molecular Probes, Inc., Eugene, OR). ATP was directly measured but ADP was first converted to ATP as described in Napolitano and Shain (2005), after which, the total ATP in the sample was measured. Samples were processed for analysis as follows. Extracts were thawed and diluted 1:100 using a buffer containing 200 mM triethanolamine, pH 7.6, 2 mM MgCl2 , and 240 mM KCl. Samples spiked with ATP and ADP were diluted 1:1000 and 1:2000 with the same buffer. For direct measurement of ATP, 20 ␮L of all diluted samples was diluted 1:2 with the above buffer. For the conversion of ADP to ATP, a duplicate 20 ␮L aliquot was diluted 1:2 the above buffer with 4.6 mM phosphoenolpyruvate and 3 U/mL pyruvate kinase added. Both sample preparations were simultaneously incubated at 37 ◦ C for 10 min in a water bath, after which, they were placed on ice until analysis. Standard curves were constructed from 1:2 serial dilutions of an ATP standard provided in the kit using the buffer described above without the additional conversion components. The final concentration range, 1 × 10−6 M to 3.1 × 10−8 M, was found to be in the linear portion of the curve. To monitor ADP conversion, concentrations ranging from 1 × 10−6 M to 1 × 10−8 M of ADP were converted to ATP as described above. These concentrations of ADP were chosen so that they could be directly compared to concentrations along the ATP standard curve. Having assumed that a maximum of 100% conversion of ADP to ATP was possible, 79–85% of ADP was converted to ATP. Increasing the concentration of the substrates and incubation time did not increase the amount of converted ADP. Standard curve samples and ADP conversion controls were processed in parallel with the tissue extract samples. ATP was measured using an ATP Determination Kit following the manufacturer’s instructions. Ten microliters of each sample were dispensed into duplicate wells of a Costar white flat bottom

258

R.M. Zaya et al. / Aquatic Toxicology 104 (2011) 254–262

96-well plate. After all samples were dispensed, 90 ␮L of a reaction mixture containing firefly luciferin and luciferase was added to each sample as quickly as possible and placed into a Tecan Infinite® 500 microplate reader for analysis. The instrument’s plate-reading chamber was warmed to 28 ◦ C and after allowing the reaction to proceed for 2 min, relative luminescence units (RLU) were measured for each well using an integration time of 1000 ms. The ATP and matching ADP samples were run concurrently to control for interassay variability. Each plate contained samples from each of the treatment groups as well as the standard curve samples. ATP concentrations were calculated from the standard curve. The ADP:ATP ratio was calculated using the following equation: ADP = ATP

 RLU  B

RLUA

−1

where RLUB is the relative luminescence units of the converted-ADP sample and RLUA the relative luminescence units of the unconverted ATP sample. Mean absolute ATP concentrations and ADP:ATP ratios were calculated for each exposure group at each time point. Differences between the groups for each time point were analyzed with an ANOVA using StatView 4.0 software (SAS Institute, Inc., Cary, NC). 3. Results 3.1. Reanalysis of Affymetrix Gene chip data Data (chp files) from control and 400 ␮g/L exposed tadpoles generated from Affymetrix Xenopus laevis genome arrays in a previous study (Langerveld et al., 2009) were uploaded into GeneSifter® for analysis. Biochemical pathways that were increased in gene expression included synthesis and degradation of ketone bodies (z score = 4.31), the urea cycle (z score = 3.97), regulation of autophagy (z score = 2.74), citric acid cycle (z score = 2.44), glutathione metabolism (z score = 2.44) and the metabolism of a number of amino acids including methionine, alanine, aspartate, arginine, proline, glycine, serine, and threonine (z score = 2.51–3.86). Those with decreased in gene expression included glycolysis/gluconeogenesis (z score = 2.31), fatty acid elongation in mitochondria (z score = 3.61), and ribosomal proteins (z score = −2.40). 3.2. Differential gene expression The data discussed below were obtained from samples taken from Studies C and F whose in vivo results were previously described in a companion article (Zaya et al., 2011). In these two studies, tadpoles were weighed prior to being snap frozen for analysis. The tadpoles exposed to 400␮g/L were significantly smaller within 72 h of exposure (p ≤ 0.03) in both of these studies. In addition, the tadpoles that remained on study were smaller and had depleted fat stores at the end of the exposure at NF Stage 62 (Zaya et al., 2011). Control and 400␮g/L atrazine exposed tadpoles (Study C, Zaya et al., 2011) were collected at 24, 48, 72 h; and 14 days after the beginning of the exposure for gene expression analysis. Six genes of interest were examined and included hypoxia inducible factor 1␣, carbamoyl-phosphate synthetase 1, E3 component of pyruvate dehydrogenase, acyl-CoA dehydrogenase family member 10, and glucocorticoid receptor protein. Three of these genes were appreciably different from controls over the sampling period (Fig. 1). Significant decreases in the gene expression of acyl-CoA dehydrogenase family member 10 (p = 0.03) and glucocorticoid receptor (p = 0.04) were noted at the 24-h sampling. Peroxisome proliferator activated receptor-␤ gene expression was increased at the 72-h sampling, although this increase was near-significant (p = 0.07). The

Fig. 1. Differentially expressed genes in Xenopus laevis tadpoles after 24, 48, and 72 h and 14 days of exposure to 400 ␮g/L atrazine as determined by qRT-PCR. Box plots of gene expression of acyl-CoA dehydrogenase (a), glucocorticoid receptor (b) after 24 h and PPAR-␤ (c) after 72 h of 400 ␮g/L atrazine exposure found changed from control expression levels. n = 8 for both 0 (white) and 400 ␮g/L atrazine (grey). Exposure was started 5 days post hatching. Gene expression was normalized to yeast actin expression within each sample. Percentages represent the percent expression relative to control. The p values are listed.

gene expression of the remaining genes and time points tested was no different than control levels (Table 3). 3.3. ATP concentration and ADP/ATP ratio determination Tadpoles from each exposure group (Study F; Zaya et al., 2011) were collected at 24, 48, and 72 h after the beginning of the exposure and processed as described above. One tadpole from each bowl was also collected at NF Stage 62 where it was measured and its liver was excised, weighed and immediately snap-frozen with liquid nitrogen. There were no significant differences in absolute ATP levels between controls and tadpoles at any exposure level within

R.M. Zaya et al. / Aquatic Toxicology 104 (2011) 254–262

259

Table 3 qRT-PCR results for genes whose expression was not significantly changed from controls. Time point

Gene name

%Control expression

p value

24 h

Hypoxia inducible factor 1␣ Carbamoyl-phosphate synthetase 1 E3 component of pyruvate dehydrogenase Peroxisome proliferator activated receptor-␤

92.1 75.1 90.6 94.0

0.681 0.143 0.667 0.615

48 h

Hypoxia inducible factor 1␣ Carbamoyl-phosphate synthetase 1 E3 component of pyruvate dehydrogenase Peroxisome proliferator activated receptor-␤ Acyl-CoA dehydrogenase family member 10 Glucocorticoid receptor

Not assayed 76.4 76.9 75.5 125.0 103.2

0.467 0.231 0.121 0.263 0.893

72 h

Hypoxia inducible factor 1␣ Carbamoyl-phosphate synthetase 1 E3 component of pyruvate dehydrogenase Acyl-CoA dehydrogenase family member 10 Glucocorticoid receptor

133.2 75.4 Not assayed 85.8 121.3

Hypoxia inducible factor 1␣ Carbamoyl-phosphate synthetase 1 E3 component of pyruvate dehydrogenase Peroxisome proliferator activated receptor-␤ Acyl-CoA dehydrogenase family member 10 Glucocorticoid receptor

Not assayed Not assayed Not assayed 137.3 252.4 85.6

14 days

the first 72 h of exposure. Nor was there any significant difference when NF Stage 62 livers were tested (Fig. 2a). The ADP:ATP ratio from exposed tadpoles was also not significantly different from controls during the early time points of the study. Livers from NF Stage 62 tadpoles exposed to 200 ␮g/L atrazine had an increase in ADP:ATP ratio compared to control tadpoles (Fig. 2b), although the increase was near-significant (p = 0.062). The very low ADP:ATP ratios noted in the first time points for all exposure groups (Fig. 2b) caused concern; however, it has been reported that ADP:ATP ratios of less than 0.11 have been found in actively growing cells (Bradbury et al., 2000). Since the tadpoles were rapidly growing at this time of collection, it was

Fig. 2. Absolute ATP concentration and ADP:ATP ratios of tadpoles exposed to 0, 200 or 400 ␮g/L atrazine early in exposure and in their liver at the end of exposure (NF Stage 62). Absolute ATP concentration (a) and ADP:ATP ratios (b).

0.223 0.488 0.419 0.252

0.130 0.346 0.379

concluded that this was the basis for the very low ADP:ATP ratios noted. 4. Discussion Measurable physical changes noted in X. laevis tadpoles exposed to atrazine in a previous study (Langerveld et al., 2009) and in the tadpoles used for these assays reported in our companion article (Zaya et al., 2011) lead to the hypothesis that tadpoles experienced an imbalance in energy homeostasis due exposure to 200 or 400 ␮g/L atrazine. To further test this hypothesis, levels of ATP were measured, ADP:ATP ratios were calculated, and the expression of selected genes associated with regulating metabolism in these tadpoles was assessed. In addition, since tadpoles are most likely only transiently exposed to these levels of atrazine in the field, the determination of whether if these changes would manifest themselves within a short time after the initiation of exposure and if exposure was continued would lead to the effects noted at the end of the exposure was of interest. First, the possibility of changes in gene expression in any biochemical pathways responsible for energy metabolism was investigated. To do so, the DNA microarray data generated in the previous study with a similar study design and similar findings (Langerveld et al., 2009) was reanalyzed using GeneSifter software. A number of metabolic pathways were shown significantly changed (z-score <−2 or >+2) in NF Stage 62 tadpoles exposed to 400 ␮g/L throughout development. Over-represented pathways, those with increased gene expression, were associated with the conversion of lipids and proteins into energy (Table 4). These included synthesis and degradation of ketone bodies, the urea cycle, regulation of autophagy, citric acid cycle, glutathione metabolism, and the metabolism of a number of amino acids. Under-represented pathways, those with decreased gene expression, were those associated with carbohydrate metabolism, fat storage, and protein synthesis and included glycolysis/gluconeogenesis, fatty acid elongation in mitochondria, and ribosomal proteins. The changes found in these metabolic pathways were reflective of the changes in body weight and fat body size noted in the tadpoles in the study (Langerveld et al., 2009). Since these physical changes were replicated in the subsequent studies (Zaya et al., 2011), these gene changes were considered representative of gene expression profiles in these tadpoles as well.

260

R.M. Zaya et al. / Aquatic Toxicology 104 (2011) 254–262

Table 4 Over-represented and under-represented metabolic pathways in Stage 62 Xenopus laevis tadpoles exposed to 400 ␮g/L atrazine throughout development determined by Affymetrix DNA Microarraysa and GeneSifterTM on-line software. Upregulated pathways

Functional significance of change

Synthesis/degradation of ketone bodies Urea cycle and metabolism of amino acidsb Citric acid cycle Regulation of autophagy Glutathione metabolism

↑ ↑ ↑ ↑ ↑ ↑ ↑

Downregulated pathways

Functional significance of change

Glycolysis/gluconeogenesis Fatty acid elongation Ribosomal structural proteins

↓ Glucose conversion to energy ↓ Storage of fat ↓ New protein synthesis

a b

Fat conversion to energy Protein breakdown Need for ATP Recycling of cellular components Atrazine excretion Need for reactive O2 species scavenging Need for amino acid transport

Langerveld et al. (2009). Amino acids with increased metabolism included methionine, alanine, aspartate, arginine, proline, glycine, serine, and threonine.

The pattern of changes in gene expression revealed by the microarray data was in line with the measurable physical changes in body condition noted in the atrazine-exposed animals. The atrazine-related increase in gene expression associated with ketone body synthesis and degradation, an adaptive response to starvation, indicated these tadpoles may have mounted a physiological response to a nutritional and/or hormonal disruption (DiMarco and Hoppel, 1975). Since this effect was noted in tadpoles at the end of their experimental exposure, at NF Stage 62, it appeared these animals may have depleted their glucose stores and shifted transcriptional responses to increase fatty acid oxidation to accommodate changes in energy needs. The decreases in the expression of genes involved with glycolysis, gluconeogenesis and fatty acid elongation were also in line with increased fatty acid ␤ oxidation as these are regulated to slow or stop with increased rates of ␤ oxidation of fatty acids (Randle, 1998). The increases in expression of genes encoding enzymes of the urea cycle, the metabolism of a number of amino acids (methionine, alanine, aspartate, arginine, praline, glycine, serine, and threonine), and the regulation of autophagy; and decreases in genes responsible for ribosomal proteins suggested that these tadpoles were catabolizing proteins for use as an energy source. Therefore, the increase in transcription of genes involved with ketone body synthesis and degradation could have stemmed from the breakdown of cellular proteins and their conversion into glucose or ketones via the citric acid cycle (Klionsky and Emr, 2003). In support of that, microarray data indicated that citric acid cycle transcripts were also increased in these tadpoles. Whether or not the deficits in growth represented the redirection of proteins from growth and development to their use as an energy source is unknown. McCarthy and Fuiman (2008) reported fish larvae exposed to a single exposure to atrazine resulted in smaller sized larvae with lower total protein content. They inferred that this effect would result in the deficits in growth noted in their studies. Fat and protein metabolism was also affected by atrazine exposure in quail and fish (Eason and Scanlon, 2002; McCarthy and Fuiman, 2008; Santa-Maria et al., 1987; Srinivas et al., 1991). The transcriptional over-representation of glutathione metabolism is accounted for by the multiple functions of glutathione. Excretion of atrazine and its metabolites is accomplished after Phase I metabolism followed by conjugation to glutathione (Abel et al., 2004; Egaas et al., 1993; Hanioka et al., 1999; Lang et al., 1996; Weigand et al., 2001). Glutathione assists in the transport of amino acids in and out of cells (Lu, 2009). The utilization of amino acids in the generation of energy requires this movement of amino acids and would result in increases in glutathione to satisfy this need. Finally, glutathione is also involved with controlling reactive oxygen species (Hansen et al., 2006; Lu, 2009), and in a state of heightened metabolism, as these tadpoles

were, the production of reactive oxygen species is likely. Additionally, atrazine has been shown to cause oxidative stress in a number of tissues in fish (Dorval et al., 2005; Elia et al., 2002; Yuanxiang et al., 2010). Since the measurable physical changes noted in atrazineexposed tadpoles corroborated the metabolic pathways revealed by the microarray data, these results were used to identify several genes of interest for further study using qRT-PCR analysis. In order to determine if changes in the metabolic pathways revealed by the microarrays were detectable early in the exposure, qRT-PCR was employed to detect changes in these genes and considered any change from normal expression levels to be indicative of fluxes in pathway activity. The genes of interest were all significantly upor down-regulated (p ≤ 0.05) in the microarray data analysis and encoded enzymes or proteins involved with regulating metabolic processes involved with energy homeostasis and included HIF-1␣, CPS 1, E3 component of pyruvate dehydrogenase (dihydrolipoyl dehydrogenase), PPAR-␤, AD, and GR. HIF-1␣ responds transcriptionally to hypoxia and stimulates glycolytic gene expression (Hu et al., 2003; Lando et al., 2003). CPS 1 is the rate-limiting enzymatic step for the urea cycle irreversibly converting ammonia and bicarbonate to carbamoyl phosphate to start the urea cycle in liver mitochondria (Waterlow, 1999). The E3 is a component of the enzyme that regulates the conversion of pyruvate to acetyl-CoA prior to its entering the citric acid cycle (Patel and Korotchkina, 2006). PPAR-␤ is a regulatory molecule for energy homeostasis that activates mitochondrial ␤ oxidation of fatty acids (Lin et al., 2003). AD family member 10 is the enzyme that starts the dismantlement of fatty acids for their utilization in ␤ oxidation within the mitochondria (Wanders et al., 2010). Finally, the GR interacts with the glucocorticoid hormone response element and hormone to stimulate transcription of genes responsible for carbohydrate, protein and lipid metabolism (Kyrou and Tsigos, 2009). Two of the six genes measured had significant differences and one showed a increasing trend in gene expression within 72 h after the beginning of exposure to 400 ␮g/L. Both AD and the GR were significantly (p ≤ 0.04) down-regulated as compared to unexposed controls after 24 h of exposure and PPAR-␤ was marginally up-regulated (p = 0.07) after 72 h of exposure. Changes in the expression of these genes suggested the occurrence of a disturbance in the regulation of energy homeostasis. Down-regulation of AD implies that exposed tadpoles were not using fatty acid ␤ oxidation for energy generation after 24 h of exposure. Messner et al. (1979) have found that rats have responded to atrazine exposure with initial and rapid elevations of blood glucose. They reported increases in hepatic cyclic AMP and glycogen phosphorylase activity in the rats after atrazine exposure. These

R.M. Zaya et al. / Aquatic Toxicology 104 (2011) 254–262

changes would have escalated the rate of glycogen breakdown and increased blood glucose levels. The release of glucose in response to exposure would render ␤ oxidation of fatty acids unnecessary and could have resulted in the suppression of genes associated with this process. In line with the possibility that the exposed tadpoles responded to atrazine exposure with a spike in blood glucose, was the downregulation in GR gene expression. This down-regulation indicated there could have been an initial surge in glucocorticoid hormone, possibly as a stress response, which may have been responsible for changes in blood glucose. Dong et al. (1988) reported that down-regulation of GR occurs rapidly in response to spikes in dexamethasone in rat liver tissue in vitro. Exposed tadpoles may have responded to atrazine exposure with a surge in glucocorticoid hormone as atrazine-induced stress responses occurring within hours of exposure have been reported in fish and rats (Cericato et al., 2009; Gluth and Hanke, 1985; Messner et al., 1979). Finally, the slight increase in PPAR-␤ transcripts suggested the tadpoles were redirecting their energy producing pathways through activation of the PPAR-␤ signaling pathway. All of the qRT-PCR results indicate there was an adaptive response in energy homeostasis that occurred within 24 h of atrazine exposure. The final assays performed to assess the energy status of the atrazine exposed tadpoles were ATP and ADP concentration determinations. Tadpoles exposed to 200 or 400 ␮g/L atrazine were analyzed. From these data absolute ATP concentrations (normalized to the tadpole’s body or liver weight) were calculated and the ADP:ATP ratio in each sample. A change in ATP would obviously indicate fluxes in energy requirements. A change in ADP:ATP ratio would also indicate a change in flux but it also revealed the organism’s ability to replenish its ATP stores; an increase in the ratio would indicate an accumulating deficit in ATP. There were no significant changes in absolute ATP concentration in any of the early samples. This was not surprising in that the qRT-PCR studies indicated that exposed tadpoles were responding adaptively to the stress of exposure quickly after onset. It was also possible that the limited number of sample collections could have missed sampling during an energy flux. There were also no differences in absolute ATP concentration in livers from NF Stage 62 tadpoles even after continuous exposure of atrazine for 45–60 days. Again, this was not surprising as these tadpoles had most likely adapted prior to study termination otherwise they would have succumbed to the exposure. Additionally, the increase in the rate of apoptosis noted in the liver from NF Stage 62 tadpole livers implied that energy stores were not detrimentally depleted since the process of apoptosis requires energy to occur (Elmore, 2007; Gupta, 2003). The ADP:ATP ratios were also calculated from the same samples assayed for absolute ATP. In parallel with absolute ATP concentrations, the ratios early in the exposure were not statistically different than control levels. While livers from animals exposed to 400 ␮g/L atrazine were no different than controls, livers from NF Stage 62 animals exposed to 200 ␮g/L atrazine had marginal increases in ADP:ATP ratios, although these increases were only nearly significant (p = 0.06). Interestingly, there was also a near-significant increase in mortality (p = 0.058) in this exposure group (Zaya et al., 2011). However, more studies measuring mortality and ATP levels would have to be conducted to determine whether there is any causal relationship between these effects. 5. Conclusion Our laboratory set out to investigate the mechanism(s) behind changes in body size and fat body size in X. laevis tadpoles exposed to 200 or 400 ␮g/L atrazine, concentrations reported to periodically occur in puddles, vernal ponds and runoff soon after application

261

(Gaynor et al., 1995; Storrs and Kiesecker, 2004). A protocol was developed that provided a predictable set of responses in animals exposed (Zaya et al., 2011) to these concentrations to which was added biochemical and molecular assays that allowed further investigation into these responses. The reproducibility of the results from this protocol allowed conclusions to be drawn with confidence from a prior study that showed similar responses to atrazine exposure (Langerveld et al., 2009). Raw microarray data generated in the initial prior study was re-analyzed to provide a profile of altered biochemical pathways associated with atrazine exposure. This profile was then used to choose genes for differential gene expression analyses in a different set of animals at a different time point in the exposure. Using this approach, changes in genes were detected that suggested that 400 ␮g/L atrazine was inducing an energy imbalance in exposed tadpoles starting early in the exposure and continuing throughout the exposure. The etiology of the apparent energy imbalance is unknown but could be due to the detoxification and excretion of atrazine and/or endocrine disruption. Biotransformed atrazine is excreted after conjugation with glutathione (Abel et al., 2004; Egaas et al., 1993; McMullin et al., 2003), an energetically demanding detoxification pathway (Boyle et al., 2000). Atrazine is a known endocrine disruptor (Cooper et al., 2000; Gammon et al., 2005; McMullin et al., 2004; Stoker et al., 2002) and may be stimulating hormonally mediated mobilization and increased ␤-oxidation of lipids. It was noteworthy that when tadpoles were exposed to 400 ␮g/L, the atrazine-related changes in gene expression indicative of perturbations in energy homeostasis were noted within 24 h of exposure. In addition, exposure to 400 ␮g/L atrazine resulted in significantly smaller tadpoles within 3 days of exposure (Zaya et al., 2011). Changes in body weight early in the exposure showed that even short exposures to atrazine significantly altered normal physiological functioning in these animals. Whether these changes could have been reversed if these tadpoles were removed from atrazine exposure is unknown; however, the animals that continued in the exposure until NF Stage 62 were smaller and had decreases in fat body size (Zaya et al., 2011). It is conceivable that tadpoles could be exposed to these levels of atrazine for short periods of time, potentially in conjunction with a number of other stressors, i.e. other pollutants, environmental conditions, infectious disease. The effects of these added stressors could potentiate atrazine’s effects or prolong recovery, although this would need to be investigated further.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.aquatox.2011.04.022.

References Abel, E.L., Opp, S.M., Verlinde, C.L.M.J., Bammler, T.K., Eaton, D.L., 2004. Characterization of atrazine biotransformation by human and murine glutathione-stransferases. Toxicol. Sci. 80, 230–238. Alvarez, M.C., Fuiman, L.A., 2005. Environmental levels of atrazine and its degradation products impair survival skills and growth of red drum larvae. Aquat. Toxicol. 74, 229–241. Battaglin, W.A., Rice, K.C., Focazio, M.J., Salmons, S., Barry, R.X., 2009. The occurrence of glyphosate, atrazine and other pesticides in vernal pools and adjacent streams in Washington, DC, Maryland, Iowa and Wyoming, 2005–2006. Environ. Monit. Assess. 155, 281–307. Bisson, M., Hontela, A., 2002. Cytotoxic and endocrine-disrupting potential of atrazine, diazinon, endosulfan, and mancozeb in adrenocortical steroidogenic cells of rainbow trout exposed in vitro. Toxicol. Appl. Pharmacol. 180, 110–117. Boyle, R., McLean, S., Foley, W.J., Davies, N.W., 2000. Comparative metabolism of dietary terpene, p-cymene, in generalist and specialist folivorous marsupials. J. Chem. Ecol. 25, 2109–2126. Bradbury, D.A., Simmons, T.D., Slater, K.J., Crouch, S.P.M., 2000. Measurement of the ADP:ATP ratio in human leukaemic cell lines can be used as an indicator of the cell viability, necrosis and apoptosis. J. Immunol. Meth. 240, 79–92.

262

R.M. Zaya et al. / Aquatic Toxicology 104 (2011) 254–262

Brodkin, M.A., Madhoun, H., Rameswaren, M., Vatnick, I., 2007. Atrazine is an immune disruptor in adult northern leopard frogs (Rana pipiens). Environ. Toxicol. Chem. 26, 80–84. Cericato, L., Neto, J.G., Kreutz, L.C., Quevedo, R.M., da Rosa, J.G., Koakoski, G., Centenaro, L., Pottker, E., Marqueze, A., Barcellos, L.J., 2009. Responsiveness of the interrenal tissue of Jundia (Rhamdi quelen) to an in vivo ACTH test following acute exposure to sublethal concentrations of agrichemicals. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 149, 363–367. Cooper, R.I., Stoker, T.E., Tyrey, L., Goldman, J.M., McElroy, W.K., 2000. Atrazine disrupts the hypothalamic control of pituitary-ovarian function. Toxicol. Sci. 53, 297–307. DiMarco, J.P., Hoppel, C., 1975. Hepatic mitochondrial function in ketogenic states. Diabetes, starvation and after growth hormone administration. J. Clin. Invest. 55, 1237–1244. Dong, Y., Poellinger, L., Gustafsson, J.A., Okret, S., 1988. Regulation of glucocorticoid receptor expression: evidence for transcriptional and posttranslational mechanisms. Mol. Endocrinol. 2, 1256–1264. Dorval, J., Leblond, V., Deblois, C., Hontela, H., 2005. Oxidative stress and endocrine endpoints in white sucker (Catostomus commersoni) from a river impacted by agricultural chemicals. Environ. Toxicol. Chem. 24, 1273–1280. Eason, T.H., Scanlon, P.F., 2002. Effects of atrazine and glyphosate ingestion on body weight and nutritional well-being of Coturnix quail. Z. Zagdwiss 48 (Suppl. 1), 281–285. Egaas, E., Skaare, J.U., Svendsen, N.O., Sandvik, M., Falls, J.G., Dauterman, W.C., Collier, T.K., Netland, J., 1993. A comparative study of effects of atrazine on xenobiotic metabolizing enzymes in fish and insect, and of the in vitro phase II atrazine metabolism in some fish, insects, mammals and one plant species. Comp. Biochem. Physiol. C 106, 141–149. Elia, A.C., Waller, W.T., Norton, S.J., 2002. Biochemical responses of bluegill sunfish (Lepomis macrochirus Rafinesque) at atrazine induced oxidative stress. Bull. Environ. Contam. Toxicol. 68, 809–816. Elmore, S., 2007. Apoptosis: a review of programmed cell death. Toxicol. Pathol. 35, 495–516. Fan, W.Q., Yanase, T., Morinaga, H., Gondo, S., Okabe, T., Nomura, M., Komatsu, T., Morohashi, K.I., Hayes, T.B., Takayanagi, R., Nawata, H., 2008. Atrazine-induced aromatase expression is SF-1 dependent: implications for endocrine disruption in wildlife and reproductive cancers in humans. Environ. Health Perspect. 115, 720–727. Freeman, J.L., Rayburn, A.L., 2005. Developmental impact of atrazine on metamorphing Xenopus laevis as revealed by nuclear analysis and morphology. Environ. Toxicol. Chem. 24, 1648–1653. Fisher, M.A., Mehne, C., Means, J.C., Ide, C.F., 2006. Induction of CYP1A mRNA in Carp (Cyprinus carpio) from the Kalamazoo River Polychlorinated BiphenylContaminated Superfund Site and in a Laboratory Study. Arch. Environ. Contam. Toxicol. 50, 14–22. Gammon, D.W., Aldous, C.N., Carr, W.C., Sanborn, J.R., Pfeifer, K.F., 2005. A risk assessment of atrazine use in California: human health and ecological aspects. Pest Manag. Sci. 61, 331–355. Gaynor, J.D., Tan, C.S., Drury, C.F., van Wesenbeeck, I.J., Welacky, T.W., 1995. Atrazine in surface and subsurface runoff as affected by cultural practices. Water Qual. Res. J. Can. 30, 513–531. Gluth, G., Hanke, W., 1985. A comparison of physiological changes in carp, Cyrpinus carpio, induced by several pollutants at the sublethal concentrations. 1. The dependency on exposure time. Ecotoxicol. Environ. Saf. 9, 179–188. Gross, C.J., Kramer, J.A., 2003. The role of investigative molecular toxicology in early stage drug development. Expert Opin. Drug Saf. 2, 147–159. Gupta, S., 2003. Molecular signaling in death receptor and mitochondrial pathways of apoptosis. Int. J. Oncol. 22, 15–20 (review). Hanioka, N., Jinno, H., Tanaka-Kagawa, T., Nishimura, T., Ando, M., 1999. In vitro metabolism of simazine, atrazine, and propazine by hepatic Cytochrome P450 enzymes of rat, mouse and guinea pig, and oestrogenic activity of chlorotriazines and their main metabolites. Xenobiotica 29, 1213–1226. Hansen, J.M., Go, Y.M., Jones, D.P., 2006. Nuclear and mitochondrial compartmentation of oxidative stress and redox signaling. Annu. Rev. Pharmacol. Toxicol. 46, 215–243. Holloway, A.C., Anger, D.A., Crankshaw, D.J., Wu, M., Foster, G., 2008. Atrazineinduced changes in aromatase activity in estrogen sensitive target tissues. J. Appl. Toxicol. 28, 260–270. Hu, C., Wang, L., Chodosh, L.A., Keith, B., Simon, M.C., 2003. Differential roles of hypoxia factor 1␤ (HIF-1␤) and HIF-2␤ in hypoxic gene regulation. Mol. Cell. Biol. 23, 9361–9374. Infurna, R., Levy, B., Meng, C., Yau, E., Traina, V., Rolofson, G., Stevens, J., Barnett, J., 1988. Teratological evaluations of atrazine technical, a triazine herbicide, in rats and rabbits. J. Toxicol. Environ. Health 24, 307–319. Klionsky, D.J., Emr, S.C., 2003. Autophagy as a regulated pathway of cellular degradation. Science 290, 1717–1721. Kyrou, L., Tsigos, C., 2009. Stress hormones: physiological stress and regulation of metabolism. Curr. Opin. Pharmacol. 9, 787–793. Lando, D., Gorman, J.J., Whitelaw, M.L., Peet, D.J., 2003. Oxygen regulation of hypoxiainducible factors by prolyl and asparaginyl hydroxylation. Eur. J. Biochem. 270, 781–790. Lang, D., Criegee, D., Grothusen, A., Saalfrank, R.W., Böcker, R.H., 1996. In vitro metabolism of atrazine, terbuthylazine, ametryne, and terbutryne in rats, pigs, and humans. Drug Metab. Dispos. 24, 859–865. Langerveld, A.J., Celestine, R., Zaya, R., Mihalko, D., Ide, C.F., 2009. Chronic exposure to high levels of atrazine alters expression of genes that regulate immune and

growth-related functions in developing Xenopus laevis tadpoles. Environ. Res. 109, 379–389. Laws, S.C., Ferrel, J.M., Stoker, T.E., Cooper, R.L., 2003. Pubertal development in female Wistar rats following exposure to propazine and atrazine biotransformation by-products, diamino-s-chlorotriazine and hydroxyatrazine. Toxicol. Sci. 76, 190–200. Lehigh Shirey, E.A., Langerveld, A.J., Mihalko, D., Ide, C.F., 2006. Polychlorinated biphenyl exposure delays metamorphosis and alters thyroid hormone system gene expression in developing Xenopus laevis. Environ. Res 102, 205–214. Lin, J., Tarr, P.T., Yang, R., Rhee, J., Puigserver, P., Newgard, C.B., Spiegelman, B.M., 2003. PGC-1␤ in the regulation of hepatic glucose and energy metabolism. J. Biol. Chem. 278, 30843–30848. Lu, S.C., 2009. Regulation of glutathione synthesis. Mol. Asp. Med. 30, 42–59. McCarthy, I.D., Fuiman, L.A., 2008. Growth and protein metabolism in red drum (Sciaenops ocellatus) larvae exposed to environmental levels of atrazine and malathion. Aquat. Toxicol. 88, 220–229. McMullin, T.S., Brzezicki, J.M., Cranmer, B.K., Tessari, J.D., Andersen, M.E., 2003. Pharmacokinetic modeling of disposition and time-course studies with [14C]atrazine. J. Toxicol. Environ. Health A 66, 941–964. McMullin, T.S., Andersen, M.E., Nagahara, A., Lund, T.D., Pak, T., Handa, R.J., Hanneman, W.H., 2004. Evidence that atrazine and diaminochlorotriazine inhibit the estrogen/progesterone induced surge of luteinizing hormone in female SpragueDawley rats without changing estrogen receptor actin. Toxicol. Sci. 79, 278– 286. Messner, B., Berndt, J., Still, J., 1979. Increases in rat liver cyclic AMP and glycogen phosphorylase activity caused by the herbicide atrazine. Biochem. Pharmacol. 28, 207–210. Napolitano, M.J., Shain, D.H., 2005. Quantitating adenylate nucleotides in diverse organisms. J. Biophys. Meth. 63, 69–77. Nieuwkoop, P.D., Faber, J., 1994. Normal Table of Xenopus laevis (Daudin) a Systematic and Chronological Survey of the Development from the Fertilized Egg Till the End of Metamorphosis. Garland Publishing, Inc., New York & London. Nieves-Puigdoller, K., Bjornsson, B.N., McCormick, S.D., 2007. Effects of hexazinone and atrazine on the physiology and endocrinology of smolt development in Atlantic salmon. Aquat. Toxicol. 84, 27–37. Ottinger, M.A., Lavoie, E., Thompson, N., Whitehouse, K., Barton, M., Abdelnabi, M., McKernan, M., Pollack, S., Quinn, M., 2006. Comparative effects of estrogenic, androgenic endocrine disruptors, and atrazine on behavior and neuroendocrine systems in quail. ICN 2006 Conference Abstracts, Comparative neuroendocrinology. Front. Neuroendocr. 27, 23. Patel, M.S., Korotchkina, L.G., 2006. Regulation of the pyruvate dehydrogenase complex. Biochem. Soc. Trans. 34, 217–222. Pinchuk, L.M., Lee, S.R., Filipov, N.M., 2007. In vitro atrazine exposure affects that phenotypic and functional maturation of dendritic cells. Toxicol. Appl. Pharmacol. 223, 206–217. Pruett, S.B., Fan, R., Zheng, Q., Myers, L.P., Hébert, P., 2003. Modeling and predicting immunological effects of chemical stressors: characterization of a quantitative biomarker for immunological changes caused by atrazine and ethanol. Toxicol. Sci. 75, 343–354. Randle, P.J., 1998. Regulatory interactions between lipids and carbohydrates: the glucose fatty acid cycle after 35 years. Diabetes Metab. Rev. 14, 263–283. Rayner, J.L., Enoch, R.R., Fenton, S., 2005. Adverse effects of prenatal exposure to atrazine during a critical period of mammary gland growth. Toxicol. Sci. 87, 255–266. Rowe, A.M., Brundage, K.M., Barnett, J.B., 2007. In vitro atrazine-exposure inhibits human natural killer cell lytic granule release. Toxicol. Appl. Pharmacol. 221, 179–188. Rowe, A.M., Brundage, K.M., Barnett, J.B., 2008. Developmental immunotoxicity of atrazine in rodents. Basic Clin. Pharmacol. Toxicol. 102, 139–145. Santa-Maria, C., Moreno, J., Lopez-Campos, J.L., 1987. Hepatotoxicity induced by the herbicide atrazine in the rat. J. Appl. Toxicol. 7, 373–378. Srinivas, T., Prasad, T.A., Raffi, G.M., Reddy, D.C., 1991. Effect of atrazine on some aspects of lipid metabolism in fresh water fish. Biochem. Int. 23, 603–609. Stoker, T.E., Guidici, D.L., Laws, S.C., Cooper, R.L., 2002. The effects of atrazine metabolites on puberty and thyroid function in the male Wistar rat. Toxicol. Sci. 67, 198–206. Storrs, S.I., Kiesecker, J.M., 2004. Survivorship patterns of larval amphibians exposed to low concentrations of atrazine. Environ. Health Perspect. 112, 1054–1057. Tavera-Mendoza, L., Ruby, S., Brousseau, P., Fournier, M., Cyr, D., Marcogliese, D., 2001. Response of the amphibian tadpole (Xenopus laevis) to atrazine during sexual differentiation of the testis. Environ. Toxicol. Chem. 21, 527–531. Tavera-Mendoza, L., Ruby, S., Brousseau, P., Fournier, M., Cyr, D., Marcogliese, D., 2002. Response of the amphibian tadpole (Xenopus laevis) to atrazine during sexual differentiation of the ovary. Environ. Toxicol. Chem. 21, 1264–1267. Wanders, R.J., Ferdinandusse, S., Brites, P., Kemp, S., 2010. Peroxisomes, lipid metabolism and lipotoxicity. Biochim. Biophys. Acta 1801, 272–280. Waterlow, J.C., 1999. The mysteries of nitrogen balance. Nutr. Res. Rev. 12, 25–54. Weigand, C., Krause, E., Steinberg, C., Pflugmacher, S., 2001. Toxicokinetics of atrazine in embryos of the zebrafish (Danio rerio). Ecotoxicol. Environ. Saf. 49, 199–205. Yuanxiang, J., Xiangxiang, Z., Shu, L., Chen, L., Sun, L., Qian, H., Liu, W., Fu, Z., 2010. Oxidative stress response and gene expression with atrazine exposure in adult female zebrafish (Danio rerio). Chemosphere 78, 846–852. Zaya, R.M., Amini, Z., Whitaker, A.S., Kohler, S., Ide, C.F., 2011 Atrazine exposure affects growth, body condition and liver health in Xenopus laevis tadpoles, Aquat. Toxicol. doi:10.1016/j.aquatox.2011.04.021.