Expression analysis for candidate genes associated with eggshell mechanical property

Journal of Integrative Agriculture 2016, 15(2): 397–402 Available online at www.sciencedirect.com

ScienceDirect

RESEARCH ARTICLE

Expression analysis for candidate genes associated with eggshell mechanical property SUN Cong-jiao, DUaN Zhong-yi, QU Lu-jiang, ZhENg Jiang-xia, YaNg Ning, XU gui-yun National Engineering Laboratory for Animal Breeding/Key Laboratory of Animal Genetics and Breeding, Ministry of Agriculture/ College of Animal Science and Technology, China Agricultural University, Beijing 100193, P.R.China

abstract Damaged eggshells result in losses of eggs. The genetic mechanism of variable eggshell strength is still unclear. The current study was conducted to verify whether the eggshell calcification related genes, CALB1, SPP1, DMP4, BMP2 and SLIT2, were associated with eggshell mechanical property. For this purpose quantitative PCR (q-PCR) analysis was performed to detect gene expression between two groups of hens laying strong and weak eggs. The hens were selected from 360 White Leghorn layers at 60 wk to ensure that the strong and weak eggs differed significantly in breaking strength but not in eggshell thickness and weight. Using this special strong/weak eggshell model, we found that the expression of CALB1 in the uterus of strong shell group was about 3-fold higher (P<0.05) than that in weak shell group. The DMP4 expression was significantly higher (2-fold, P<0.05) in the uterus of weak shell group than that in strong shell group. However, no difference was observed for genes of SPP1, SLIT2 and BMP2 between these two groups. The current study provides a new insight to investigate the association of candidate genes with eggshell mechanical property. Keywords: eggshell mechanical property, eggshell calcification related genes, q-PCR, chicken

ascertain the genetic mechanism of the variable eggshell

1. Introduction Avian eggshell, as a unique bioceramic material produced by birds, can protect the eggs from mechanical damage (Nys et al. 2004; Chien et al. 2009). Fine eggshell quality can reduce the economic losses causing by the damaged or cracked eggshells, which account for 6 to 10% of total egg loss (Preisinger and Flock 2000). For poultry geneticist, to

quality is out of the most important thing. It can be speculated that certain genes must exit and play roles in the process of eggshell mineralization and ultimately determine eggshell quality. The process of eggshell mineralization occurs in uterus for about 20 h, consisting of three stage, initial stage (5 to 10 h post-ovulation), rapid deposition stage (10 to 20 h post-ovulation) and final stage (21 to 24 h post-ovulation) (Gautron et al. 1997; Nys et al. 1999). The eggshell is mainly formed in the rapid deposition stage, which needs play more attention to. It can be found that certain eggs produced by hens of same breed and age differ significantly

Received 3 December, 2014 Accepted 9 March, 2015 SUN Cong-jiao, Mobile: +86-15910707895, E-mail: suncongjiao @163.com; Correspondence XU Gui-yun, Mobile: +86-13601372958, Fax: +86-10-62732741, E-mail: [email protected]

in breaking strength but not in other parameters such as

© 2016, CAAS. All rights reserved. Published by Elsevier Ltd. doi: 10.1016/S2095-3119(14)60969-2

optimal models for the investigation of molecular mechanism

eggshell thickness and eggshell weight. This type of “strong” and “weak” eggs, and the corresponding hens can be the underlying eggshell quality (Sun et al. 2013).

398

SUN Cong-jiao et al. Journal of Integrative Agriculture 2016, 15(2): 397–402

The genes of CALB1 (calbindin) and SPP1 (osteopontin) have been extensively explored for their roles in eggshell calcification in recent decades. Calbindin as a active Ca2+ transcellular transporter exerts significant effects in delivering active calcium in the uterus (Nys et al. 1989; Jonchere et al. 2012). Osteopontin is a main eggshell matrix protein (Pines et al. 1995), regulating the eggshell calcification process by inhibiting calcium carbonate precipitation in a phosphorylation-dependent manner (Pines 2007; Hincke et al. 2008). Bar et al. (1992a) pointed out that the expression of CALB1 fluctuates markedly during the daily egg cycle, in close temporal association with egg shell calcification, which was consistent with Yang et al. (2013). Similarly, Jeong et al. (2012) demonstrated the expressions of CALB1 and SPP1 increased significantly in the shell gland between 3 and 20 h post-ovulation, revealing temporal changes in gene expression in different stages of the laying cycle. No research however has been carried out to illustrate the association of these two genes with eggshell mechanical property. The other three genes, dentin matrix protein-4 (DMP4), bone morphogenetic protein 2 (BMP2) and slit homolog 2 (SLIT2) were also observed for their overexpression during eggshell calcification, and they have been speculated for their potential roles in determining eggshell strength (Jonchere et al. 2010). This study was conducted with an appropriate strong/ weak eggshell model to determine whether the candidate genes, CALB1, SPP1 DMP4, BMP2 and SLIT2, are associated with eggshell mechanical property.

2. Results 2.1. Mechanical properties of strong and weak eggs produced by selected hens The egg traits of the strong and weak eggs laid by 12 selected hens were shown in Table 1. The breaking strength of the strong group ((3.891±0.123) kg) was significantly higher than that of the weak group ((2.365±0.177) kg). Similarly, the parameter of toughness was (49.6±2.210) and (29.7±2.93)

kg mm–3/2 in the two groups, respectively. The average breaking strength and toughness of the whole population were (2.971±0.688) and (39.8±6.30) kg mm–3/2, respectively, differing significantly with the strong and weak groups. No significant differences were observed for the parameters of egg weight, shape index, eggshell thickness, eggshell weight and shell percentage among the strong group, weak group and the whole population (Table 1).

2.2. Differential expression of candidate genes between strong and weak shell groups In the present study, we used the novel strong/weak eggshell strength model to verify the expression of these genes in the two groups. The relative expressions of the five candidate genes in the uterus of the two groups were presented in Fig. 1. Q-PCR analysis revealed that the CALB1 expression in the uterus of strong shell group was significantly higher than that in the weak shell group. On the contrary, the uterus of weak shell group had significantly higher DMP4 expression than that of strong shell group. There were no expression differences for SPP1, SLIT2 and BMP2 genes between these two groups.

3. Discussion This special strong/weak eggshell model can remove the effect of other eggshell traits on eggshell strength, allowing us to correlate specific genes with eggshell strength. Previous studies used the pre-/post-molting (Ahmed et al. 2005) or young/old (Panheleux et al. 2000; Rodriguez-Navarro et al. 2002) layer model for the investigation of key factors (such as matrix protein concentrations, eggshell ultrastructures) affecting eggshell quality. Hens employed in these models were in different physiological status, i.e., undergoing molting and aging process. As a result, the uterus could secret specific proteins to uterine fluid corresponding to certain physiological status. Another related study was performed by Liu et al. (2013), who conducted a transcriptome analysis between two groups of uterus bathing strong and weak eggs

Table 1 Comparison of eggshell mechanical properties of eggs laid by the selected hens

Egg weight (g) Shape index (length/width) Eggshell weight (g) Shell percentage (%) Eggshell thickness (mm) Breaking strength (kg) Toughness (kg mm–3/2)

Strong eggs (three eggs/hen, six hens) 59.0±2.82 1.36±0.03 6.30±0.16 10.6±0.32 0.340±0.008 3.891±0.123 A 49.6±2.21 A

Weak eggs (three eggs/hen, six hens) 59.5±2.63 1.37±0.03 6.37±0.20 11.3±0.45 0.337±0.008 2.365±0.177 C 29.7±2.93 C

A–C mean different letters within each row differ significantly (P<0.01). All values are shown as means±SD.

Population (three eggs/hen, 360 hens) 59.1±5.08 1.36±0.07 6.32±0.53 10.4±0.77 0.334±0.024 2.971±0.688 B 39.8±6.30 B

SUN Cong-jiao et al. Journal of Integrative Agriculture 2016, 15(2): 397–402

Hens laying strong eggs CALB1 40

*

Relative expression of target genes to β-actin

30 20 10

(×10 ) 5 –2

3 2 1 0

*

5

0.8

4

0.6

3

0.4

2

0.2

1

SPP1

0

(×10 ) 7 –2

BMP2

6

1.0

0.0

0

4

Hens laying weak eggs DMP4

1.2

399

SLIT2

6 5 4 3 2 1 5

Fig. 1 Comparison of gene expression levels in the uterus of hens laying strong and weak eggs. Data are means±SD.

respectively. However, in this model, the strong/weak eggs not only differed significantly in breaking strength but also in eggshell thickness, eggshell weight, shape index and egg weight, giving no valid evidence that the different expressed genes screened by transcriptome data were related to eggshell strength only (maybe relate to other traits, such as shell weight or shape index). In contrast, strong/weak eggshells possessing same thickness and weight were used in the present study. We selected these five genes in the currently study due to specific reasons. These five genes have been proved to associate with eggshell calcification processes such as CALB1 and SPP1 (Bar et al. 1992a; Pines et al. 1995) or predicted to associate with eggshell mechanical property (BMP2, SLIT2 and DMP4) due to their high expression in uterus when eggshell calcifying and their specific conserved domain and 3-D structure (Jonchere et al. 2010). However, there were no direct evidences proved that they related to eggshell strength. Calbindin encoded by CALB1 was known as Ca2+ transcellular transporter in epithelial and tubular cells of intestine and uterus. Previous study suggested hens laying eggs with a low shell weight had significantly lower intestinal and eggshell gland calbindin as compared with those laying eggs with a high shell weight (Bar et al. 1992b). In the current study, eggs laid by hens of two groups have the same eggshell weight, eggshell thickness and egg weight. Hence, the function of CALB1 as Ca2+ transcellular transporter may

be not the causal reason for strong eggshell. We can have hypothesis that certain Ca2+ dependent biological process relating to eggshell calcification was enhanced by the redundant Ca2+ concentration caused by large amount of calbindin. Osteopontin encoded by SPP1 likely regulated eggshell growth by inhibiting calcite growth at specific crystallographic faces (Chien et al. 2008; Hincke et al. 2008). Other evidence pointed out the abnormal expression of SPP1 in uterus is related to abnormalities and cracks in the eggshell (Arazi et al. 2009). SPP1 was over-expressed when shell is calcifying (Jeong et al. 2012) and was regulated by mechanical strain consecutive to the presence of an egg in uterus (Lavelin et al. 1998). In the current study however no significant expression difference of SPP1 was observed in these two groups, suggesting SPP1 was not the major gene influencing eggshell strength. The gene of DMP4 encodes dentin matrix protein-4 which is a calcium-binding protein that plays a role in dentin mineralization (Hao et al. 2007) and was newly identified as uterine protein (Jonchere et al. 2010). Our results showed hens in weak egg group having higher DMP4 expression compared to strong group. It is the first time to verify the likely role of DMP4 in eggshell calcification. The accurate roles for DMP4 in eggshell calcification need further investigations. SLIT2 encodes a large extracellular matrix protein composed of leucine rich repeat motifs (Battye et al. 2001), which provides a structural framework for protein-protein interactions (Kobe and Deisenhofer 1993). In addition, SLIT

400

SUN Cong-jiao et al. Journal of Integrative Agriculture 2016, 15(2): 397–402

has a calcium-binding site at the N-terminus. Consequently, it was speculated that SLIT could interact with calcium to favor crystal nucleation and morphology of crystals by interacting with some crystal faces of calcite (Jonchere et al. 2010). The protein encoded by BMP2 belongs to the transforming growth factor-β (TGFβ) superfamily (Duprez et al. 1996), acting as a disulfide-linked homodimer and induces bone and cartilage formation (Sekiya et al. 2005). Our results showed that these two genes, however, have no effect on eggshell strength at mRNA level.

4. Conclusion In summary, a proper and efficient strong/weak eggshell model was used in this experiment and we suggested that CALB1 and DMP4, in mRNA level, may play a positive and negative role respectively in the formation of strong eggshell. The current study provided a new insight to investigate the association of other candidate genes with eggshell mechanical property.

5. Materials and methods 5.1. Birds management 360 White Leghorn layers at 60 wks from an experimental line kept in our experiment farm in China Agricultural University for over 20 years were used in this experiment. All layers were caged individually subjecting to a light/dark cycle of 16 h light and 8 h darkness (16 L:8 D) and were fed ad libitum. The whole procedure was strictly performed according to the protocol approved by the Animal Welfare Committee of China Agricultural University (permit number XK622).

5.2. Measurements of egg traits Three eggs per hen were collected from the experimental population. All measurements were determined on the day

of sampling. Egg weight was measured using an electronic scale with an accuracy of 0.1 g. Egg Shape Index Gauge (FHK Co. Ltd., Tokyo, Japan) was used for the determination of egg length and width. Then breaking strength was measured pole to pole with the Eggshell Force Gauge (Model-II, Robotmation Co. Ltd., Tokyo, Japan). After the removal of egg internal contents, the eggshells were washed clean with tap water. Eggshell weights were measured after drying in the air at room temperature. Fracture toughness (KC) were then calculated based on the data previously acquired according to the formulas developed by Bain (1990), KC= Knd(F/T3/2), where Knd=0.777[2.388+(2.9934×12/Width)]1/2, F is breaking strength (N), and T is eggshell thickness (mm).

5.3. Sample collection Twelve hens were then selected from the 360 hens according to eggshell traits. Among them, 6 hens produced strong eggs and the rest 6 hens produced weak eggs. Eggs from these two groups differed significantly in breaking strength and fracture toughness, but not in eggshell thickness, eggshell weight and the other parameters (Table 1). The 12 hens were sacrificed at 18–19 h post-ovulation to obtain the uterus tissues.

5.4. RNa extraction and q-PCR Total RNA was extracted from uterus with total RNA Kit (OMEGA, USA). Briefly, 1 mg of total RNA was used for cDNA synthesis using EasyScript RT Kit (TransGen, Beijing). Primers of all candidate genes were designed by Primer 5.0 software (Primer, Canada). Primer sequences were shown in Table 2. PCR products of reference and target genes were cloned into pMDTM19-T vector (TaKaRa Bio. Inc., Japan) and transfected to DH5α Escherichia coli competent cells (Tiangen Biotech, Beijing, China) for amplification. Plasmids containing reference and target genes were extracted as standard samples to establish the

Table 2 Primer sequences used for quantitative PCR (q-PCR) Gene β-actin CALB1 DMP4 SPP1 BMP2 SLIT2

Sequences (5´→3´) F: TATGTGCAAGGCCGGTTTC R: TGTCTTTCTGGCCCATACCAA F: TCAGCCTTGGTCTTGGCAT R: TGTGTGGAGTGGAAGTAAAGCC F: CGAATGCTCTTACTACTGCTCAACC R: TAGGAACGCCTCCAAGGGTTTCTC F: AGGAGTTGCTGCTGGGATTG R: TGCCTGGATTTGCTCACTGG F: AAGGCATCCGTTGTATGTGG R: AGCGGAAAAGGACATTCCC F: GCTAAGATACACTCCCAAAC R: ACTGACCCTCACTCTACCAC

Length (bp) 110

Annealing temperature (°C) 60

116

60

138

60

146

60

108

60

173

60

SUN Cong-jiao et al. Journal of Integrative Agriculture 2016, 15(2): 397–402

standard curve. Standard curve was made with a 10-fold serial dilution of the plasmids DNA (10–1 to 10–8). The PCR reactions were conducted using ABI Prism 7500 system (Applied Biosystems, Carlsbad, CA), and performed in a total volume of 15 μL with 1 μL cDNA, 130 nmol primers L–1, and 7.5 μL SYBR Green Real Master Mix (Applied Biosystems). The optimum thermal cycling parameters were: 95°C for 10 min, 40 cycles of 95°C for 10 s, 60°C for 1 min, 95°C for 15 s, 60°C for 1 min and 95°C for 30 s. The expression ratios were calculated with standard curve method.

5.5. Statistical analysis Egg traits and gene expression levels in uterus between the two groups were analyzed by Student’s t-test with SAS 9.1 (SAS Institute Inc., Cary, NC).

acknowledgements The current research was funded by the National Natural Science Foundation of China (31472084), the National High Technology Research and Development Program of China (2013AA102501), the National Key Technology R&D Program of China (2011BAD28B03), the Programs for Changjiang Scholars and Innovative Research in University, China (IRT1191), and the China Agriculture Research Systems (CARS-41).

References Ahmed A M H, Rodriguez-Navarro A B, Vidal M L, Gautron J, García-Ruiz J M, Nys Y. 2005. Changes in eggshell mechanical properties, crystallographic texture and in matrix proteins induced by moult in hens. British Poultry Science, 46, 268–279. Arazi H, Yoselewitz I, Malka Y, Kelner Y, Genin O, Pines M. 2009. Osteopontin and calbindin gene expression in the eggshell gland as related to eggshell abnormalities. Poultry Science, 88, 647–653. Bain M M. 1990. Eggshell strength: A mechanical ultrastructural evaluation. Ph D thesis, Faculty of Veterinary Medicine, University of Glasgow, UK. Bar A, Striem S, Vax E, Talpaz H, Hurwitz S. 1992a. Regulation of calbindin mRNA and calbindin turnover in intestine and shell gland of the chicken. American Journal of Physiology, 262, 800–805. Bar A, Vax E, Striem S. 1992b. Relationships between calbindin (Mr 28,000) and calcium transport by the eggshell gland. Comparative Biochemistry and Physiology, 101, 845–848. Battye R, Stevens A, Perry R L, Jacobs J R. 2001. Repellent signaling by slit requires the leucine-rich repeats. The Journal of Neuroscience, 21, 4290–4298. Chien Y C, Hincke M, Vali H, McKee M. 2008. Ultrastructural

401

matrix-mineral relationships in avian eggshell, and effects of osteopontin on calcite growth in vitro. Journal of Structural Biology, 163, 84–99. Chien Y C, Hincke M T, McKee M D. 2009. Ultrastructure of avian eggshell during resorption following egg fertilization. Journal of Structural Biology, 168, 527–538. Duprez D, Coltey M, Amthor H, Brickell P, Tickle C. 1996. Bone morphogenetic protein-2 (BMP-2) inhibits muscle development and promotes cartilage formation in chick limb bud cultures. Developmental Biology, 174, 448–452. Gautron J, Hincke M T, Nys Y. 1997. Precursor matrix proteins in the uterine fluid change with stages of eggshell formation in hens. Connective Tissue Research, 36, 195–210. Hao J, Narayanan K, Muni T, Ramachandran A, George A. 2007. Dentin matrix protein 4, a novel secretory calciumbinding protein that modulates odontoblast differentiation. The Journal of Biological Chemistry, 282, 15357–15365. Hincke M T, Chien Y C, Gerstenfeld L C, McKee M D. 2008. Colloidal-gold immunocytochemical localization of osteopontin in avian eggshell gland and eggshell. Journal of Histochemistry & Cytochemistry, 56, 467–476. Jeong W, Lim W, Kim J, Ahn S E, Lee H C, Jeong J W, Han J Y, Song G, Bazer F W. 2012. Cell-specific and temporal aspects of gene expression in the chicken oviduct at different stages of the laying cycle 1. Biology of Reproduction, 86, 172–180. Jonchere V, Brionne A, Gautron J, Nys Y. 2012. Identification of uterine ion transporters for mineralisation precursors of the avian eggshell. BMC Physiology, 12, 10. Jonchere V, Rehault-Godbert S, Hennequet-Antier C, Cabau C, Sibut V, Cogburn L, Nys Y, Gautron J. 2010. Gene expression profiling to identify eggshell proteins involved in physical defense of the chicken egg. BMC Genomics, 11, 57. Kobe B, Deisenhofer J. 1993. Crystal structure of porcine ribonuclease inhibitor, a protein with leucine-rich repeats. Nature, 366, 751–756. Lavelin I, Yarden N, Ben-Bassat S, Bar A, Pines M. 1998. Regulation of osteopontin gene expression during egg shell formation in the laying hen by mechanical strain. Matrix Biology, 17, 615–623. Liu Z, Zheng Q, Zhang X, Lu L. 2013. Microarray analysis of genes involved with shell strength in layer shell gland at the early stage of active calcification. Asian-Australasian Journal of Animal Sciences, 26, 609–624. Nys Y, Gautron J, Garcia-Ruiz J M, Hincke M T. 2004. Avian eggshell mineralization: Biochemical and functional characterization of matrix proteins. Comptes Rendus Palevol, 3, 549–562. Nys Y, Hincke M, Arias J, Garcia-Ruiz J, Solomon S. 1999. Avian eggshell mineralization. Poultry and Avian Biology Reviews, 10, 143–166. Nys Y, Mayel-Afshar S, Bouillon R, Van Baelen H, Lawson D. 1989. Increases in calbindin D 28K mRNA in the uterus of the domestic fowl induced by sexual maturity and shell formation. General and Comparative Endocrinology, 76,

402

SUN Cong-jiao et al. Journal of Integrative Agriculture 2016, 15(2): 397–402

322–329. Panheleux M, Nys Y, Williams J, Gautron J, Boldicke T, Hincke M T. 2000. Extraction and quantification by ELISA of eggshell organic matrix proteins (ovocleidin-17, ovalbumin, ovotransferrin) in shell from young and old hens. Poultry Science, 79, 580–588. Pines M. 2007. The involvement of matrix proteins in eggshell formation. In: Proceedings of the 19th Australian Poultry Science Symposium. Sydney, New South Wales, Australia. pp. 130–133. Pines M, Knopov V, Bar A. 1995. Involvement of osteopontin in egg shell formation in the laying chicken. Matrix Biology, 14, 765–771. Preisinger R, Flock D K. 2000. Genetic Changes in Layer Breeding: Historical Trends and Future Prospects. BSAS Occasional Publication, UK. pp. 20–28.

Rodriguez-Navarro A, Kalin O, Nys Y, Garcia-Ruiz J M. 2002. Influence of the microstructure on the shell strength of eggs laid by hens of different ages. British Poultry Science, 43, 395–403. Sekiya I, Larson B L, Vuoristo J T, Reger R L, Prockop D J. 2005. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell and Tissue Research, 320, 269–276. Sun C, Xu G, Yang N. 2013. Differential label-free quantitative proteomic analysis of avian eggshell matrix and uterine fluid proteins associated with eggshell mechanical property. Proteomics, 13, 3523–3536. Yang J, Zhao Z, Hou J, Zhou Z, Deng Y, Dai J. 2013. Expression of TRPV6 and CaBP-D28k in the egg shell gland (uterus) during the oviposition cycle of the laying hen. British Poultry Science, 54, 398–406. (Managing editor ZHANG Juan)