Expression analysis of the plasma membrane H+-ATPase pma4 transcription promoter from Nicotiana plumbaginifolia activated by the CaMV 35S promoter enhancer

Plant Science 149 (1999) 157 – 165 www.elsevier.com/locate/plantsci

Expression analysis of the plasma membrane H+-ATPase pma4 transcription promoter from Nicotiana plumbaginifolia activated by the CaMV 35S promoter enhancer Rongmin Zhao, Luc Moriau, Marc Boutry * Uni6ersite´ Catholique de Lou6ain, Unite´ de Biochimie Physiologique, Place Croix du Sud 2 -20, B-1348 Lou6ain-la-Neu6e, Belgium Received 11 June 1999; received in revised form 27 July 1999; accepted 27 July 1999

Abstract pma4 is the major plasma membrane H+-ATPase gene in Nicotiana plumbaginifolia. To study its physiological role by overexpression, we evaluated the possibility of enhancing the pma4 transcription promoter using a 165-bp enhancing sequence of the CaMV 35S transcription promoter. This was inserted into the pma4 promoter either 500 or 50 nucleotides upstream from the transcription start site. Transient expression with the gusA reporter gene showed that both enhanced pma4 promoters had a 4to 13-fold greater transcription activity than the native pma4 promoter. Quantitative analysis of stable transgenic plants also showed that both enhanced pma4 promoters conferred much greater GUS activity. Histochemical assay showed that the enhanced promoters produced strong GUS activity in most cell types as already observed in the 35S or the native pma4 promoter. In the cell types where either the 35S or pma4 promoter was inactive, the enhanced promoters mimicked expression of the active one. However, there were cases (e.g. root cortex of seedlings) where, although both 35S and pma4 promoters were active, none of the enhanced promoters induced GUS activity. This might indicate the interference of promoter regulatory elements. The two enhanced pma4 promoters conferred similar expression throughout the plant development, implying that there was no regulatory element at either the pma4 −500 or −50 position, that conferred important tissue specificity. © 1999 Elsevier Science Ireland Ltd. All rights reserved. Keywords: CaMV 35S enhancer; gusA reporter gene; Plasma membrane H+-ATPase; Tissue-specific expression; Transcription promoter

1. Introduction The plant plasma membrane proton ATPase (H+-ATPase) generates an electrochemical potential difference across the plasma membrane which is essential for transport of many ions and metabolites [1 – 4]. Studies of several species have shown that this enzyme is encoded by a gene family whose members are differentially expressed [5–7]. In Nicotiana plumbaginifolia, nine p6 lasma m6 embrane H+-A6 TPase genes (pma1 to pma9) were isolated. Among the eight pma genes analysed, pma4 was found to be the gene ex* Corresponding author. Tel.: + 32-10-473621; fax: + 32-10473872. E-mail address: [email protected] (M. Boutry)

pressed at the highest level and in the largest number of cell types [6,8,9] (also, M. Oufattole, personal communication). Thus, pma4 appeared to be a good candidate for a functional study based on its overexpression, cosuppression or antisense suppression. Although the cauliflower mosaic virus (CaMV) 35S promoter is very often used for this purpose, we thought that it would be more appropriate to modify pma4 expression in those cell types where it is normally expressed. Therefore, we investigated whether the homologous promoter (pma4) could be reinforced by a transcription enhancer. Sequences within the CaMV 35S promoter were shown to be able to enhance the expression of plant genes [10–12]. Dissection of the 35S enhancer (between − 343 and −90) into subdo-

0168-9452/99/$ - see front matter © 1999 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 1 6 8 - 9 4 5 2 ( 9 9 ) 0 0 1 5 5 - 7

158

R. Zhao et al. / Plant Science 149 (1999) 157–165

mains demonstrated the modular organization and the synergetic interaction between the subdomains [13 – 15]. The subdomains within the 35S enhancer could also show synergetic interaction with heterologous promoters [16,17], sometimes by modifying their tissue expression specificity [18]. The sequence extending between positions −209 and −46, in particular, has been used as an enhancer, regardless of its position and orientation, to activate the transcription of promoters in both dicot [19] and monocot [20]. To examine the possibility of constructing an enhanced pma4 promoter, we inserted the 35S enhancer ( −209 to −46) into the pma4 transcription promoter, at two different positions. We hereby report the expression analysis of the two enhanced pma4 promoters, using the gusA reporter gene after transient and stable transformation and compare their tissue-specific expression with the parent promoters.

2. Methods

2.1. Constructs The pma4 promoter (2320 bp BamHI-XhoI fragment, including the 2066 bp upstream of the transcription start site and 254 bp encompassing the 5% untranslated transcribed sequence and the PMA4 first eight codons), linked to the gusA reporter gene and the nos terminator (Tnos) in the binary vector construct pma4-gusA [9] was inserted into pBluescriptSK(+ ) (Stratagene) between BamHI and EcoRI to generate construct PMA4GUS. Construct 35SGUS was as previously described [8]. The 165 bp CaMV 35S enhancer (− 209 to −45 upstream of the 35S transcription start site [19]) was amplified from the pBI121 vector [21] with two primers GAACTGCAGCCATCGTTGAAGATGCC and CGGAATTCGAAGGATAGTGGGATTG (the introduced PstI and EcoRI sites are underlined) and inserted into pBluescriptSK(+) between PstI and EcoRI. To obtain a pma4 promoter region with the 35S enhancer inserted at − 500, the 1550 bp BamHIDraI fragment (promoter 5% region) and the 765 bp DraI-XhoI fragment (promoter 3% region) of the PMA4GUS construct were inserted upstream and downstream of the 35S enhancer in the

BamHI and SmaI, or EcoRV and XhoI sites, respectively. Finally, the XhoI fragment from construct PMA4GUS containing gusA and Tnos was inserted to give EN500PMA4GUS. To insert the 35S enhancer 50 bp upstream of the pma4 transcription start site, a 3% fragment of the pma4 promoter region was amplified with the primer GCGAATTCACTGCTGGAGTGTCC (located from −49 to −34, the introduced EcoRI is underlined) and the 17mer universal primer (Stratagene) from pPRP4XB, a derivative of pBluescriptSK( +) in which the 2320 bp BamHI-XhoI pma4 promoter region had been inserted. The amplified fragment was digested with EcoRI and XhoI and inserted into pBluescriptSK( +). The pma4 promoter 5% fragment was amplified with the oligonucleotide GAACTGCAGTAAACACACCTCACC (complementary to pma4 from −49 to −64, the introduced PstI was underlined) and the 16mer reverse primer (Stratagene) from pPRP4XB, digested with BamHI and PstI and inserted into the corresponding sites, upstream of the pma4 promoter 3% fragment. The 35S enhancer was then inserted between PstI and EcoRI to generate pEN50PMA4. Sequencing revealed that there were several point mutations in the 5% amplified fragment of pEN50PMA4. The 5% XbaI-SpeI fragment of pEN50PMA4 was therefore replaced by the BamH-SpeI fragment of pPRP4XB with XbaI and BamHI ends blunted. Finally, the XhoI fragment of construct PMA4GUS was inserted to give EN50PMA4GUS. All sequences amplified by PCR were checked by sequencing.

2.2. Protoplast preparation and transformation Nicotiana tabacum cv. SR1 protoplasts were prepared, electroporated using a Gene Pulser Transfection Apparatus (BIO-RAD) and cultured as previously described [8]. After 24 h incubation in the dark at 26°C, the cells were collected and sonicated for 10 s in a 0.8 ml solution of 0.1 M sodium phosphate, pH 7.0, 5.5 mM b-mercaptoethanol with the Virsonic Cell Disrupter 16-850 (Virtis, Gardiner, NY). The supernatant was collected after centrifugation at 2000 rpm for 10 min (Sorvall® GLC-2) and used for protein quantitation [22] and GUS activity assay.

R. Zhao et al. / Plant Science 149 (1999) 157–165

2.3. Leaf disc transformation The BamHI-XhoI native pma4 promoter region in the Agrobacterium tumefaciens binary vector construct pma4-gusA [9] was replaced by the BamHI-XhoI fragment of construct EN50PMA4GUS or EN500PMA4GUS, to generate binary vectors containing the enhanced PMA4GUS cassettes. The binary plasmids were transferred into A. tumefaciens and the leaf disc transformation of N. tabacum cv. SR1 was conducted as An et al. [23].

159

2.6. Tobacco in 6itro culture and in 6i6o growth condition Seeds of N. tabacum cv. SR1 were sterilized for 1 min in 70% (v/v) ethanol, 25 min in 50% (v/v) commercial bleach and washed four times in sterile water. They were then sowed on solid medium (4.4 g/l Murashige and Skoog salt (ICN), pH 5.8, 2% sucrose, 0.7% agar) and grown at 25°C under 16 h light (50 mE.s − 1 m − 2). Plants were transferred to soil and grown in the green house at 27°C (16 h light per day).

2.4. GUS acti6ity assay Leaf discs (50 mg) were homogenized at 4°C in 140 ml extraction buffer (50 mM sodium phosphate, pH 7.0, 5.5 mM b-mercaptoethanol) in 1.5 ml Eppendorf tubes with a plastic pestle. The extract was centrifuged for 20 min at 14 000 rpm, 4°C. Total proteins in the supernatant were measured [22]. GUS activity in leaf disc and protoplast extracts was measured, using 5 mg protein, with the substrate 4-methylumbelliferyl-b-D-glucuronide (4-MUG, Sigma) [21]. The fluorescence was measured at various times with an Aminco Bowman® series I luminescence spectrometer (Simo Aminco®) with excitation at 365 nm and emission at 450 nm. GUS specific activity was calculated from the slope after linear regression analysis.

2.5. Histochemical staining All plant tissues were hand cut. The seeds were cut in two along the longitudinal axis. All handcut materials were washed twice with 0.1 mM sodium phosphate, pH 7.0 and then stained in 0.1 M NaH2PO4, pH 7.0, 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, 1.0 mM 5-bromo-4-chloro-3-indolyl-b-D-glucuronide cyclohexylamine (X-gluc, Chemica Alta) at 37°C for 15 min to 16 h. With easy to oxidize material such as flowers, 10 mM b-mercaptoethanol was added. When staining tissues with high GUS activity, only 0.2 mM X-gluc was added. After staining, the plant tissues were fixed with 50% (v/v) ethanol, 9% (v/v) formaldehyde, 5% (v/v) acetic acid for 2 h. The leaf, stem and flower tissues were then depigmented with 100% ethanol. All materials were finally preserved in 50% (w/v) glycerol, 0.1% (w/v) NaN3.

3. Results

3.1. Insertion of CaMV 35S enhancer increased the pma4 promoter acti6ity in both protoplasts and transgenic plants The constructs for transient expression are shown in Fig. 1. 35SGUS [8] contained the CaMV 35S promoter. PMA4GUS contained 2066 bp of sequence upstream of the pma4 transcription initiation site. In addition, we kept from the pma4 transcribed region, the 5% untranslated sequence and the PMA4 first eight codons [24] (designated L4 in Fig. 1). EN50PMA4GUS and EN500PMA4GUS derived from PMA4GUS in which the CaMV 35S enhancer (−208 to −46) was inserted at position −500 or −50, respectively, upstream of the pma4 transcription start. Two insertion sites were chosen to cope with a possible disruption of an essential element of the pma4 promoter. For a quantitative analysis, we first evaluated the constructs in transient expression after electroporation of tobacco leaf protoplasts (Fig. 2A). Both the EN50PMA4GUS and EN500PMA4GUS constructs conferred a 4- to 13-fold higher transcription activity than the PMA4GUS construct. This indicated that the pma4 promoter was greatly activated by the 35S enhancer. Both EN50PMA4GUS and EN500PMA4GUS showed a similar activity, indicating that the enhancer did not disrupt a pma4 sequence important for transcription. To elucidate whether the enhanced promoters did in fact confer a higher expression than the native pma4 promoter in planta and whether the insertion of the 35S enhancer might change the

160

R. Zhao et al. / Plant Science 149 (1999) 157–165

tissue specificity of the pma4 promoter, the constructs were stably transformed into tobacco. The GUS activity in transgenic leaves was quantified for 15 representatives of each construct (Fig. 2B). Although the GUS activity largely varied depending upon the transformant, presumably due to the position effect, the overall GUS activity conferred by the enhanced promoters was much higher than that by the native pma4 promoter. The enhanced pma4 promoters also conferred a higher GUS activity than did the 35S promoter, as already observed in leaf protoplasts. We also noticed that the 35SGUS plants showed a higher GUS activity than did PMA4GUS plants, in contrast with the transient expression data on 35SGUS which showed about 3-fold less GUS activity than PMA4GUS. This suggests that the pma4 promoter might be strongly activated in protoplasts.

3.2. GUS histochemical analysis during plant de6elopment Both transient and stable transformation showed that the enhanced pma4 promoter conferred a higher GUS expression than the native pma4 promoter. Histochemical analysis was then conducted on the F1 generation to study whether

the insertion of the 35S enhancer might have changed the pma4 tissue-specific expression. Twelve independent transgenic lines for both EN50PMA4GUS and EN500PMA4GUS were analysed. Although the expression pattern of pma4 [9] and CaMV 35S [13–15] promoters has been described, the F1 generation of four independent transgenic lines of both PMA4GUS and 35SGUS constructs was analyzed as a control. We analyzed GUS expression in mature seeds after 24 h imbibition and 3 days incubation in water, in 15-day-old seedlings grown in vitro, in 5–7 cm plantlets (in soil) and in flowering plants. The data are summarized in Table 1. As both pma4 and CaMV 35S promoters induced GUS expression in many cell types at almost all developmental stages, it was not surprising to observe a similar situation for the enhanced promoters (Table 1). The main differences between the activated promoters and the parent promoters are as described hereafter. In the seeds with emerging taproots, GUS expression was found in the cotyledons and the endosperms of the four constructs. However, a difference was found in the roots. The native pma4 was not expressed in roots at this stage (Fig. 3A). As for the 35S promoter, only faint staining could

Fig. 1. gusA fusion constructs for transient expression. The sequence of the junction of the pma4 promoter and the gusA gene is represented below. The pma4 (left) and gusA (right) initiation ATG and the XhoI site are underlined. Abbreviations: 35S, CaMV 35S promoter, EN, CaMV 35S promoter enhancer ( −208 to − 46), L4, pma4 leader (5% untranslated transcribed sequence), Tnos, nopaline synthase gene terminator.

R. Zhao et al. / Plant Science 149 (1999) 157–165

Fig. 2. GUS specific activity conferred by the various constructs. (A) The GUS specific activity was measured in transiently transformed tobacco protoplasts. The indicated values represent the ratio of GUS activity of each sample by that of PMA4GUS used as a reference. Bars represent the mean 9 confidence interval (95%) of four electroporation assays. Different bar patterns represent different batches of protoplasts. (B) The GUS specific activity was measured in transgenic plant leaves. Leaves (8–10 cm long of 5–8 cm tall plants) from 15 representatives of independent primary transgenic lines for each construct were assayed for GUS activity. The mean9confidence interval (95%) is indicated for each construct.

be observed in the stele (Fig. 3B). This contrasts with a previous report [13] showing high expression. The difference possibly results from the fact that that we used emerging roots at a much earlier stage (3 instead of 6 days) [13]. Additionally, these emerging roots were germinated in water instead of sucrose-containing MS medium. Sucrose has been found to stimulate 35S promoter expression [17]. On the other hand, the two enhanced promoters conferred expression in the cap and the meristem of the root tip and in the central stele (Fig. 3C and D). A longer incubation time also revealed GUS expression in the epidermis and root hairs, driven by both enhanced promoters (not shown). In 15-day-old seedlings grown in vitro, GUS was expressed strongly in all the root tissues of

161

PMA4GUS (Fig. 3E) and 35SGUS (Fig. 3F) plants. For both enhanced promoters, GUS activity in roots mainly appeared in hairs, epidermis and much less in the central cylinder and not at all in the cortex (shown in Fig. 3G for EN500PMA4GUS). In the 8–10 cm long leaves of 5–7 cm tall plantlets, the native pma4, the 35S and the enhanced pma4 promoters all induced GUS expression in conductive tissues, mesophyll cells and the guard cells. However, the native pma4 (Fig. 3H) conferred only very weak GUS activity in the mesophyll, compared with the 35S (Fig. 3I) and the enhanced pma4 promoters (Fig. 3J). In flowers, all four promoters conferred GUS activity in most tissues, especially the conductive tissues. However, in anthers from stage seven [25], both enhanced pma4 promoters expressed GUS in the microspores and pollen grains (Fig. 3M and P), thus retaining the tissue specificity of native pma4 (Fig. 3K and N). But for the 35SGUS plants (Fig. 3L and O), neither the microspores, nor the mature pollen grains displayed any GUS activity, as mentioned in previous reports [26,27].

4. Discussion The CaMV 35S promoter is the most commonly used promoter to drive gene expression in transgenic plants. Out of a series of promoters analyzed in transgenic Arabidopsis thaliana, CaMV 35S was the strongest [28]. Furthermore, the 35S promoter induces expression in most plant cell types. This advantage was often used to overexpress a foreign gene in transgenic plants. However, the overexpression driven by the 35S promoter often induced gene silencing [29,30] or did not show any phenotype [31,32]. It has been suggested that the 35S promoter did not induce expression in those cell types where target genes were normally expressed. In our study, we used the short 35S enhancer sequence (165 bp) to successfully activate, by 4- to 13-fold, the native pma4 promoter. We also systematically analyzed the tissue specificity of the chimeric promoters and compared it with that of native pma4 and 35S promoters (Table 1). It is clear that the two enhanced pma4 promoters have a similar expression pattern, indicating that the insertion of the 35S enhancer does not disrupt important cis elements in the pma4 promoter.

162

R. Zhao et al. / Plant Science 149 (1999) 157–165

Fig. 3. Histochemical localization of GUS in transgenic plants containing different constructs. (A – D) 3-day-old taproots of PMA4GUS (A), 35SGUS (B), EN50PMA4GUS (C) and EN500PMA4GUS (D). (E – G) Root cross-section of 15-day-old plants of PMA4GUS (E), 35SGUS (F) and EN500PMA4GUS (G). (H – J) 8 – 10 cm long leaves of 5 – 7 cm tall plants of PMA4GUS (H), 35SGUS (I) and EN500PMA4GUS (J). (K–M) Cross-section in anther (stage 7) of PMA4GUS (K), 35SGUS (L) and EN500PMA4GUS (M) plants.(N–P) pollen grains of PMA4GUS (N), 35SGUS (O) and EN500PMA4GUS (P) plants. Black bars represent 0.5 mm. White bars represent 0.1 mm.

R. Zhao et al. / Plant Science 149 (1999) 157–165

Histochemical analysis also revealed that both enhanced pma4 promoters induced strong GUS expression in many cell types in which the native pma4 was expressed, such as long trichomes, conductive tissues, guard cells and most parts of flower organs. Additionally, the enhanced pma4 promoters induced GUS expression in the microspores and in pollen grains whereas the 35S promoter did not, indicating the qualitative similarity between the enhanced and the native pma4 promoters in the reproductive tissues. Both enhanced pma4 promoters also showed some new characteristics when compared with the

163

native pma4 promoter. For instance, they conferred GUS activity in the root stele emerging from the seeds, showing a feature of the 35S promoter. This showed that the 35S enhancer somehow modified the tissue specificity of the heterologous promoter to which it was fused and brought some characteristics of the 35S promoter. This is in agreement with the report that the PR-1 promoter shows the tissue specificity of the 35S promoter when activated by the 35S enhancer [18]. Therefore, these data cast doubt upon the use of the term ‘enhancer’ to designate this 35S-derived sequence.

Table 1 Tissue-specific expression of the gusA fusion constructs Promoter Seed (with emerging roots) Endosperm Cotyledon Root Tip Epidermis Hair Stele Cortex 15-day-old seedlings Root Tip Elongation zone Maturation region Hair Epidermis Cortex Stele Cotyledon Epidermis Mesophyll Conductive tissues 5–7 cm tall plantlet Long trichome Leaf Epidermis Guard cells Mesophyll Conductive tissues Stem Inner phloem 5–7 cm tall plantlet Outer phloem Xylem par enchyma Cortex

pma4a

35S

en50

en500

++b +++

++ ++ +++ +++

++ +++

−− −− −− −− −−

−− −− −− + −−

+++ + + ++ −−

+++ + + ++ −−

++ −−

++ ++

+++ −−

+++ −−

++ ++ +++ +++

++ ++ +++ +++

+++ +++ −− +

+++ +++ −− +

+ + ++

++ ++ ++

+++ + +/−−

+++ + +/−−

+++

++

+++

+++

+ ++ + ++

+ + ++ ++

++ ++ ++ +++

++ ++ ++ +++

+++

+++

+++

+++

+ +

++ ++

++ ++

++ ++

+

++

++

++

Promoter Root Tip Cortex Epidermis Conductive tissues Flowering plant Long trichome Leaf Mesophyll Epidermis Guard cell Conductive tissues Stem Phloem Xylem par enchyma Sepal Petal Anther Pollen grain Style and stigma Root Tip Elongation zone Maturation region Epidermis Cortex Conductive tissues

pma4

35S

en50

+ + + +

++ +++ +/−− + + ++ ++ ++

+++ +/−− ++ ++

++

+

++

+ + + ++

+ + + + + ++ ++ +++

+ + ++ +++

++ +

++ ++

++ ++

++ ++

++ ++ ++ ++ ++

++ ++ + −− ++

++ ++ ++ ++ ++

++ ++ ++ ++ ++

+ +

++ +

+++/−− ++

+++ ++

+ + +

+ + +

+++/−− +/−− +

+++ −− +

++

en500

a Abbreviations: pma4, 35S, en50 and en500 refer to constructs PMA4GUS, 35SGUS, EN50PMA4GUS and EN500PMA4GUS as defined in Fig. 1. b +++, blue colour observed after staining for less than 1 h; ++, blue colour observed after staining for 3–5 h; +, blue colour observed after staining for 16 h; −−, no staining observed after 16 h; +/−−, some plants were stained, others were not.

164

R. Zhao et al. / Plant Science 149 (1999) 157–165

Synergetic interaction has been observed between cis elements of the 35S promoter [15]. Both the native pma4 and 35S promoter did not induce expression in the tip of roots emerging from seeds. However, both enhanced pma4 promoters strongly expressed GUS in these cells, indicating that synergetic interactions also exist between the pma4 and 35S sequences. Compared with the two native promoters, the two enhanced pma4 promoters also lost activity in some cell types. Unlike both pma4 and 35S promoters, they did not express in conductive tissues of cotyledon and cortex of 15-dayold seedling roots. This might indicate some interference between regulatory elements of both promoter sequences. As a conclusion, the 165 bp CaMV 35S enhancer, inserted within the pma4 promoter at either 500 or 50 nucleotides upstream of the transcription start site, increased the transcriptional activity of the native pma4 promoter. The fusion promoters showed expression in many cell types as the native pma4 and 35S promoter did. They also conferred some new characteristics.

Acknowledgements This work was supported by grants from the Belgian National Fund for Scientific Research, the European Commission (BIOTECH programme) and the Interuniversity ‘poles of attraction’ programme of the Belgian Government Office for Scientific, Technical and Cultural Affairs.

References [1] R. Serrano, Structure and function of plasma membrane ATPase, Annu. Rev. Plant Physiol. Plant Mol. Biol. 40 (1989) 61–94. [2] M.R. Sussman, Molecular analysis of proteins in the plant plasma membrane, Annu. Rev. Plant Physiol. Plant Mol. Biol. 45 (1994) 211–234. [3] B. Michelet, M. Boutry, The plasma membrane H+-ATPase: a highly regulated enzyme with multiple physiological functions, Plant Physiol. 108 (1995) 1–6. [4] M.G. Palmgren, Proton gradients and plant growth: role of the plasma membrane H+-ATPase, Adv. Bot. Res. 28 (1998) 1–70. [5] J.F. Harper, L. Manney, N.D. DeWitt, M.H. Yoo, M.R. Sussman, The Arabidopsis thaliana plasma membrane H+-ATPase multigene family, J. Biol. Chem. 265 (1990) 13601–13608.

[6] C. Perez, B. Michelet, V. Ferrant, P. Bogaerts, M. Boutry, Differential expression within a three-gene subfamily encoding a plasma membrane H+-ATPase in Nicotiana plumbaginifolia, J. Biol. Chem. 267 (1992) 1204 – 1211. [7] N.N. Ewing, A.B. Bennett, Assessment of the number and expression of P-type H+-ATPase genes in tomato, Plant Physiol. 106 (1994) 547 – 557. [8] B. Michelet, M. Lukaszewicz, V. Dupriez, M. Boutry, A plant plasma membrane proton-ATPase gene is regulated by development and environment and shows signs of a translational regulation, Plant Cell 6 (1994) 1375–1389. [9] L. Moriau, B. Michelet, P. Bogaerts, L. Lambert, A.M. Michel, M. Oufattole, M. Boutry, Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme, Plant J. 19 (1999) 31 – 41. [10] L. Balcells, G. Coupland, The presence of enhancers adjacent to the Ac promoter increases the abundance of transposase mRNA and alters the timing of Ds excision in Arabidopsis, Plant Mol. Biol. 24 (1994) 789 – 798. [11] R. Kay, A. Chen, M. Daly, J. McPherson, Duplication of CaMV 35S promoter sequences creates a strong enhancer for plant genes, Science 236 (1987) 1299 –1302. [12] I. Mitsuhara, M. Ugaki, H. Hirochika, M. Ohshima, T. Murakami, Y. Gotoh, et al., Efficient promoter cassettes for enhanced expression of foreign genes in dicotyledonous and monocotyledonous plants, Plant Cell Physiol. 37 (1996) 49 – 59. [13] P.N. Benfey, L. Ren, N.-H. Chua, The CaMV 35 enhancer contains at least two domains which can confer different development and tissue-specific expression patterns, EMBO J. 8 (1989) 2199 – 2202. [14] P.N. Benfey, L. Ren, N-H. Chua, Tissue-specific expression from CaMV 35S enhancer subdomains in early stages of plant development, EMBO J. 9 (1990) 1677– 1684. [15] P.N. Benfey, L. Ren, N-H. Chua, Combinatorial and synergistic properties of CaMV 35S enhancer subdomains, EMBO J. 9 (1990) 1685 – 1696. [16] L. Comai, P. Moran, D. Maslyar, Novel and useful properties of a chimeric plant promoter combining CaMV 35S and MAS elements, Plant Mol. Biol. 15 (1990) 373 – 381. [17] M. Ni, D. Cui, S.B. Gelvin, Sequence-specific interactions of wound-inducible nuclear factors with mannopine synthase 3% promoter would-responsive elements, Plant Mol. Biol. 30 (1996) 77 – 96. [18] A. Beilmann, K. Albrecht, S. Schultze, G. Wanner, U. Pfitzner, Activation of a truncated PR-1 promoter by endogenous enhancers in transgenic plants, Plant Mol. Biol. 18 (1992) 65 – 78. [19] R-X. Fang, F. Nagy, S. Sivasubramaniam, N-H. Chua, Multiple cis regulatory elements for maximal expression of the cauliflower mosaic virus 35S promoter in transgenic plants, Plant Cell 1 (1989) 141 – 150. [20] S. Omirulleh, M. Abraham, M. Golovkin, I. Stefanov, M.K. Karabaev, L. Mustardy, et al., Activity of a chimeric promoter with the doubled CaMV 35S enhancer element in protoplast-derived cells and transgenic plants in maize, Plant Mol. Biol. 21 (1993) 415 – 428.

R. Zhao et al. / Plant Science 149 (1999) 157–165

[21] R.A. Jefferson, T.A Kavanagh, M.W. Bevan, Gus fusions: b-Glucuronidase as a sensitive and versatile gene fusion marker in higher plants, EMBO J. 6 (1987) 3901 – 3907. [22] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [23] G. An, P.R. Ebert, A. Mitra, S.B. Ha, Binary vectors, in: S.B. Gelvin, R.A. Schilperoort, D.P.S. Verma (Eds.), Plant Molecular Biology Manual, Kluwer Academic Publishers, Dordrecht, 1988, pp. A3/1–A3/19. [24] L. Moriau, P. Bogaerts, J.L. Jonniaux, M. Boutry, Identification and characterization of a second plasma membrane H+-ATPase gene subfamily in Nicotiana plumbaginifolia, Plant Mol. Biol. 21 (1993) 955–963. [25] A.M. Koltunow, J. Truettner, K.H. Cox, M. Wallroth, R.B. Goldberg, Different temporal and spatial gene expression patterns occur during anther development, Plant Cell 2 (1990) 1201–1224. [26] F.D. Guerrero, L. Crossland, G.S. Smutzer, D.A. Hamilton, J.P. Mascarenhas, Promoter sequences from a maize pollen-specific gene direct tissue-specific tran-

.

[27]

[28]

[29]

[30]

[31]

[32]

165

scription in tobacco, Mol. Gen. Genet. 224 (1990) 161– 168. L. Plegt, R.J. Bino, Glucuronidase activity during development of the male gametophyte from transgenic and non-transgenic plants, Mol. Gen. Genet. 216 (1989) 321– 327. S. Holtorf, K. Apel, H. Bohlmann, Comparison of different constitutive and inducible promoters for the overexpression of transgenes in Arabidopsis thaliana, Plant Mol. Biol. 29 (1995) 637 – 646. H. Vaucheret, C. Be´clin, T. Elmayan, F. Feuerbach, C. Godon, J-B. Morel, et al., Transgene-induced gene silencing in plants, Plant J. 16 (1998) 651 – 659. M.A. Matzke, A.J.M. Matzke, How and why do plants inactivate homologous (trans)genes?, Plant Physiol. 107 (1995) 679 – 685. P. Crete, M. Caboche, C. Meyer, Nitrate reductase expression is regulated at the post-transcriptional level by the nitrogen source in Nicotiana plumbaginifolia and Arabidopsis thaliana, Plant J. 1 (1997) 625 – 634. J.C. Young, N.D. DeWitt, M.R. Sussman, A transgene encoding a plasma membrane H+-ATPase that confers acid resistance in Arabidopsis thaliana seedlings, Genetics 149 (1998) 501 – 507.