- Email: [email protected]
Expression and characterization of two STAT isoforms from Sf9 cells
ARTICLE IN PRESS Developmental and Comparative Immunology (2008) 32, 814–824
Available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/dci
Expression and characterization of two STAT isoforms from Sf9 cells$ Maw-Sheng Yeha,1, Chia-Hsiung Chengb,1, Chih-Ming Chouc, Ya-Li Hsud, Cheng-Ying Chub, Gen-Der Chenb, Shui-Tsung Chenb, Guang-Chao Chenb, Chang-Jen Huangb,d, a
Department of Food and Nutrition, Hung-Kuang University, Taichung, Taiwan Institute of Biological Chemistry, Academia Sinica, 128, Sec 2, Academia Road, Taipei 115, Taiwan c Department of Biochemistry, Taipei Medical University, Taipei, Taiwan d Institute of Cellular and Organismic Biology, Academia Sinica, Taipei, Taiwan b
Received 21 November 2007; accepted 3 December 2007 Available online 26 December 2007
KEYWORDS STAT; DNA binding; Baculovirus; Insect Sf9 cells
Summary In invertebrates, the JAK–STAT signaling pathway is involved in the anti-bacterial response and is part of an anti-viral response in Drosophila. In this study, we show that two STAT transcripts are generated by alternative splicing and encode two isoforms of Sf-STAT with different C-terminal ends. These two isoforms were produced and purified using the recombinant baculovirus technology. Both purified isoforms showed similar DNA-binding activity and displayed weak but significant transactivation potential toward a Drosophila promoter that contained a STAT-binding motif. No significant activation of the Sf-STAT protein in Sf9 cells was found by infection with baculovirus AcMNPV. & 2007 Elsevier Ltd. All rights reserved.
Introduction Innate immunity is an ancestrally common defense system for insects and mammals to defend themselves from
$ The sequence data in this paper has been submitted to the EMBL/GenBank Data Libraries under the accession number AF329946, AF329947 and AF436838. Corresponding author. Tel.: +886 2 2785 5696; fax: +886 2 2788 9759. E-mail address: [email protected] (C.-J. Huang). 1 These authors contributed equally to this work.
0145-305X/$ - see front matter & 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2007.12.001
invading bacterial, fungal and viral pathogens. This defense system has been demonstrated to be conserved as an intracellular signaling pathway that can rapidly respond to infection by transcriptional regulation [1,2]. In Drosophila, there are three distinct pathways that make up the innate immune system. Two pathways are activated by different bacterial peptidoglycans (PGNs). Diaminopimelic acid-containing PGN activates the Imd pathway, while lysinecontaining PGN activates the Toll pathway [3,4]. These two pathways cause the expression of genes via distinct NFkB-like transcription factors [5–7]. The mammalian Toll-like receptor and TNF cascade pathways that regulate NF-kB activity are similar to these two pathways in insect [8,9].
ARTICLE IN PRESS Expression and characterization of two STAT isoforms from Sf9 cells In addition to the Toll/Imd pathways, the JAK–STAT pathway has been associated with septic injury [10]. Among invertebrates, the Drosophila JAK–STAT pathway has been intensively studied. Initially, a single JAK homolog, hopscotch [11], and a STAT protein (STAT92E) were identified [12,13]. Then, a secreted glycoprotein, Unpaired, was identified as a ligand [14] that binds to the receptor Domeless [15]. Moreover, negative regulators such as the SOCS proteins [16,17] and a PIAS homolog [18] have also been found in Drosophila. Thus, the Drosophila JAK–STAT pathway is similar to mammalian JAK–STAT pathway [19,20]. In Drosophila, the JAK–STAT pathway was first identified to be involved in embryonic segmentation [11] and was later shown to control a number of developmental events, such as eye formation, spermatogenesis and oogenesis, somatic control of male germline sexual development, tracheal morphogenesis and gut morphogenesis [21–27]. However, activation of the JAK–STAT pathway in response to bacterial infection has also been reported in mosquito [28,29]. Recently, the Drosophila JAK–STAT pathway has been shown to be required for anti-viral response [30]. Taken together, these results indicate that the JAK/STAT pathway could directly participate in the immune response of insects. The Sf9 cell line is derived from the pupal ovarian tissue of the fall army worm (Spodoptera frugiperda) [31] and is usually used as host cells for the production of heterologous proteins in the baculovirus expression system [32]. It has been reported that the nuclear extracts from Sf9 cells have STAT-binding activity with or without serum in the culture medium [33]. In addition, the recombinant mammalian STAT proteins produced in Sf9 cells are tyrosine phosphorylated [34,35]. This suggests that an active protein tyrosine kinase is present in Sf9 cells under normal growth condition or infection with recombinant baculovirus. Tyrosine kinase that can activate endogeneous or recombinant STAT proteins has not been characterized. In this study, we isolated and characterized the endogenous STAT gene from Sf9 cells. Interestingly, we found that there are two STAT transcripts derived by alternative splicing, and this leads to the generation of two isoforms of the protein, the long form and the short form. The DNA-binding ability and transactivation ability of these two isoforms were compared, and both isoforms were found to have similar transactivation potential toward a Drosophila promoter that contained a STAT-binding motif. The possible function of these STAT proteins in insect cells was investigated using infection by a wild-type baculovirus, Autographa californica nuclear polyhedrosis virus (AcMNPV).
Materials and methods Cell culture The insect Sf9 cells (S. frugiperda) were cultured at 28 1C in SF900 II media (Life Technologies, Gaithersburg, MD, USA) supplemented with 50 U/ml penicillin and 50 U/ml streptomycin.
cDNA synthesis and cloning Total RNA was purified from Sf9 cells or third-instar larvae of Drosophila melanogaster using the RNAzol B kit (Biotecx,
815
Friendswood, TX, USA) following the manufacturer’s instructions. The first-strand cDNA synthesis was primed with oligo-(dT) linker–primer and random primers, and was transcribed using moloney murine leukemia virus reverse transcriptase (MMLV-RT) (Life Technologies). The synthesized cDNA was used as template in a subsequent polymerase chain reaction (PCR) [36]. To clone the Sf-STAT gene, degenerate primers were designed and synthesized based on two protein regions 347 QPPQVMK and FTFWEWFF580 found in Dm-STAT, which are conserved among insect STATs [28]. Their sequences were sense 50 -CA(AG) CCN CCN CA(AG) GTN ATG AA-30 and antisense 50 -AA (A/G) AAC CA(T/C) TCC CA(A/G) AAN GT(A/G) AA-30 . A PCR product of 600 bp was obtained using these degenerate primers, with the template being first cDNA from Sf9 cells. The PCR conditions were initial denaturation at 94 1C for 2 min followed by 40 cycles of 94 1C for 30 s (denaturation), 45 1C for 30 s (annealing), 72 1C for 45 s (extension) and then a final extension of 5 min at 72 1C. Amplified DNA fragments were then purified and ligated into pGEM-T (Promega, Madison, WI, USA). Each clone was sequenced using AmpliTaq DNA polymerase and fluorescent dideoxynucleotides according to the manufacturer’s protocols (Applied Biosystems, CA, USA); the reaction products were then electrophoresed and analyzed on an automated DNA sequencer (Applied Biosystems model 310).
Rapid amplification of cDNA ends (RACE) The 50 and 30 ends of the Sf-STAT mRNA were obtained by the RACE technique using the Marathon cDNA amplification kit (Clontech, Palo Alto, CA, USA) according to the manufacturer’s instructions. Briefly, total RNA was isolated from Sf9 cells, and poly (A)+ RNA was prepared. The first-strand cDNA was synthesized using a modified poly-T primer and 1 mg of poly (A)+ RNA. The second-strand cDNA was obtained using an enzyme cocktail-containing RNase H, DNA polymerase and DNA ligase. Asymmetric adaptor primers (AP primers) were then ligated to both ends of the double-stranded cDNA. An aliquot of this cDNA collection was diluted 1:100 and subjected to two different anchored PCRs. The 50 RACE was performed with a 27mer sense primer (AP1) specific for the adaptor and anti-sense primer for Sf-STAT (50 -GGAACAACAAGCCCAATTGCT TC-30 ), whereas the second round of PCR was carried out with a nested 23mer sense primer (AP2) and a nested anti-sense primer (50 -GCTACTGTCCGTTTACTGGTCG G-30 ). Primers corresponding to the adaptor sequence AP1 (external) and AP2 (internal) were supplied with the Marathon kit. For 30 RACE, cDNA was first amplified with AP1 primer and Sf-STAT primer (50 -CGACCTCTCCGAAGATAA CCTGAG-30 ), and then reamplified with AP2 and a nested anti-sense primer (50 -ACCA GTCTCCCATTGAACAACATCG-30 ). The PCR products were cloned into pGEM-T vector (Promega) and sequenced.
Phylogenetic analysis Phylogenetic trees were constructed by the maximumparsimony method and by the neighbor-joining (NJ) method based on a p value that represents the uncorrected proportion of amino acid difference. The validity of the
ARTICLE IN PRESS 816 various branches of the trees was tested by bootstrapping using 100 replicates [37]. Using this approach, we constructed a phylogeny of the published invertebrate STAT and human STAT sequences using the distance analysis. The DNAbinding domain, linker domain and SH2 domain of STAT family were used to construct the phylogenetic trees. In addition to Sf-STAT, ten other STAT family members were analyzed and their accession numbers are Anopheles gambiae (Ag-STAT, AJ010299); Caenorhabditis elegans (Ce-STAT, Z70754); D. melanogaster (Dm-STAT, Q24151); human STAT1 (P42224); STAT2 (P526301); STAT3 (P40763); STAT4 (Q14765); STAT5a (P42229); STAT5b (U48730) and STAT6 (P42226).
Isolation of genomic DNA from Sf9 cells Genomic DNA was prepared from Sf9 cells with DNAzol reagent (Life Technologies, Gaithersburg, MD). The genomic DNA was precipitated by the addition of 100% ethanol and then removed by spooling onto a pipette tip. After washing and drying, the DNA was dissolved in TE buffer (10 mM Tris HCl, 1 mM EDTA, pH 8.0).
Amplification of genomic DNA by PCR Specific primers (forward, 50 -ACGACGTCTTCTCCAAGTATTACACT-30 and reverse, 50 -AGGCTCGA ATCTGCTCGAACAGTTCG-30 ) were designed according to the cDNA sequences. With these primers and Sf9 genomic DNA as the template, PCR was performed to isolate a partial fragment of the Sf-STAT gene directly from the genomic DNA. This was then cloned into pGEM-T and sequenced as described above.
RT-PCR The abundance of long-form and short-form Sf-STAT mRNA was examined by RT-PCR with one primer pair (forward, 50 -CTACTTC AGTGCGGCTACACCGGCCC-30 and reverse, 50 -TATCTTGTTGTCATCTTACTTC ATGC-30 ) for the long form and another primer pair (forward, 50 -GTACATGATTGATTTCTGAGTTT CTT-30 and reverse, 50 -CTGTGTCGAAATGTCAGTTCATCTTC-30 ) for the short form. The expected sizes of the PCR products for short-form and long-form STAT were 72 and 144 bp, respectively. Similarly, one primer pair (forward, 50 -ACCCTAGCGACCGCAATGCGAGTC-30 and reverse, 50 -CTACAAACGTGAACATGCAATGTGCTC-30 ) was used for RT-PCR to examine the presence of two isoforms in fly larvae. The expected sizes of the PCR products for short-form and longform Drosphola STAT were 121 and 142 bp, respectively.
Expression and purification of recombinant Sf-STAT proteins The full-length cDNA encoding Sf-STAT was cloned into the Not I site of the baculovirus transfer vector pAcSG (PharMingen, San Diego, CA, USA). The integrity of the construct was confirmed by automated DNA sequencing. The recombinant baculovirus was generated by transfecting Sf9 cells with the pAcSG constructs using the BacVector-1000 Transfection kit (Novagen, Darmstadt, Germany) according
M.-S. Yeh et al. to the manufacturer’s protocols and our previous reports [38,39]. Recombinant proteins were expressed in Sf9 cells that were grown in suspension in Sf900 II medium (Life Technologies). Cells were infected with recombinant baculovirus at a multiplicity of infection of 5 and harvested at 72 h post-infection. The cells (5 107) were lysed in 10 ml lysis buffer containing 20 mM HEPES (pH 9), 420 mM NaCl, 0.1% NP-40, 15% glycerol, 2 mM b-mercaptoethanol, 1 mM PMSF, 1 mM NaF, 1 mM Na3VO4, 30 mM imidazol and 1 mM b-glycerophosphate. After centrifugation at 13,000 rpm for 30 min, the supernatant was added to 0.5 ml of packed Ni2+NTA agarose (Qiagen) and incubated at 4 1C for 2 h with constant rotation. The slurry was transferred to a disposable plastic column, washed with 20 volumes of lysis buffer containing 30 mM imidazol, followed by 20 volumes of lysis buffer containing 50 mM imidazol. The Sf-STAT proteins were eluted with lysis buffer supplemented with 100, 150 and 250 mM imidazol, respectively. The protein concentration of the purified Sf-STAT was determined by the Bradford method.
Antibody preparation Part of the Sf-STAT cDNA (nucleotides 1115–1613; amino acids 351–488) was recovered by PCR and cloned into the His-Tag expression vector pQE30 (Qiagene, Hilden, Germany). The fusion proteins were expressed in Escherichia coli and purified using Ni-NTA agarose (Qiagene) under denaturing condition (1.5% sarcosine in PBS) according to our previous procedures [39]. The purified protein was used to immunize New Zealand white rabbits by the intrasplenic immunization method [40].
Western blot analysis Total cell lysates of recombinant baculovirus-infected cells or purified proteins were separated on 10% SDS-polyacrylamide gels and transferred to nitrocellulose membranes. The membrane was blocked with 5% skim milk in PBS for 1 h at 4 1C and then incubated for 16 h at 4 1C with anti-sera against Sf-STAT (1:1000 dilution) or anti-phosphotyrosine antibodies, PY99 (1:2000 dilution; Santa Cruz, CA, USA) in PBS containing 5% skim milk. The membrane was washed twice in PBS plus 0.2% Tween 20 and probed with appropriate secondary antibodies for 1 h at 4 1C. After another 15 min wash with PBST, the membrane was treated with enhanced chemiluminescence detection solutions (NEN, Boston, MA, USA) and exposed to film.
Electrophoretic mobility shift assay (EMSA) Several commercially available mammalian DNA-binding motifs for STATs (Santa Cruz) were used in this study. The upper strand sequences of the normal and the corresponding mutant oligonucleotides are listed in Table 1. The probes were prepared by annealing complementary oligonucleotides, followed by end labelling with [a-32P] dCTP or [a-32P] dGTP using Klenow fill-in (Boehringer Mannheim, Mannheim, Germany). The reaction mixtures (15 ml) contained 2 mg of nuclear extracts from Sf9 cells or baculovirus-infected Sf9 cells,
ARTICLE IN PRESS Expression and characterization of two STAT isoforms from Sf9 cells various amounts of recombinant Sf-STAT, labeled probes (30,000 cpm, 0.1–0.2 ng) and 1.5 mg of poly (dI-dC) in 10 mM Tris HCl (pH 7.5), 10 mM HEPES, 1 mM EDTA, 100 mM NaCl, 1 mM dithiothreitol and 15% glycerol. After the mixtures had been incubated on ice for 30 min, the DNA–protein complexes were analyzed on a non-denaturing 5% polyacrylamide gel in Tris-borate buffer at 150 V for 2.5 h at room temperature. Dried gels were analyzed using a Fuji PhosphorImager BAS 2000 (Japan). For the competition experiments, 50 ng of non-labeled or mutant oligonucleotides were mixed with the labeled probes before the protein was added. For the supershift experiments, anti-serum against Sf-STAT was added to the binding reaction mixtures and incubated with the labeled DNA probe.
Plasmid construction The expression vector, pIZ/V5-Sf-STATs, was constructed by inserting the full-length Sf-STAT cDNA into the Hind III and Not I sites of pIZ/V5 vector, which has an OpIE2 promoter (Invitrogen, CA, USA). The integrity of the constructs was confirmed by automated DNA sequencing. The reporter plasmids, DrafSTATwt-luc, 2XDrafSTATWT-luc and 2XDrafSTATmut1-TATA-luc, were kindly provided by Yamaguchi [41].
Transactivation assay Transfections were performed in 12-well plates. Briefly, 0.2 mg of reporter constructs such as 2XDrafSTATWT-luc and 2XDrafSTATmut1-TATA-luc were co-transfected with 0.1, 0.5 or 1.0 mg of the expression plasmid pIZ/V5-Sf-STATs. Transfection of the various DNA mixtures into Sf9 cells was performed using the Eufectin Transfection Reagent (Novagen, Germany). At 48 h post-transfection, the cells were harvested and assayed for luciferase activities using a luciferase assay kit, FireLite, purchased from Packard (Groningen, The Netherlands). Firefly luciferase activities were normalized to protein amounts as determined by a Bio-Rad protein assay. Similarly, at 48 h post-transfection, the cells were harvested and subjected to Western blot analysis using a polyclonal antibody against Sf-STAT or antiphosphotyrosine monoclonal antibodies.
Preparation of nuclear extracts The Sf9 cells (5 106) were plated on a 10 cm Petri dish and cultured for 16 h. The Sf9 cells were infected with AcMNPV at a multiplicity of infection of 5. The titer of the AcMNPV was determined by the plaque assay [42]. Sf9 cells were harvested at 12, 24 and 48 h post-infection. Nuclear extracts of the normal Sf9 cells and the baculovirus-infected cells were prepared using a previously described minipreparation method [43]. The nuclear extracts were preserved at 70 1C until use. The protein concentration of the nuclear extracts was determined by a Bio-Rad protein assay.
817
Table 1 Oligonucleotide probes used to determine DNA-binding specificity of Sf-STAT. Probe
Sequence
STAT1 Mut. STAT1 STAT3 Mut. STAT3 STAT4 Mut. STAT4 STAT5 Mut. STAT5 STAT6 Mut. STAT6 GAS Mut. GAS SIE Mut. SIE D-raf Mut. D-raf
CATGTTATGCATATTCCTGTAAGTG CATGTTATGCATATTGGAGTAAGTG GATCCTTCTGGGAATTCCTAGATC GATCCTTCTGGGCCGTCCTAGATC GAGCCTGATTTCCCCGAAATGATGAGC GAGCCTGATTTCTTTGAAATGATGAGC AGATTTCTAGGAATTCAATCC AGATTTAGTTTAATTCAATCC CCGCTGTTGCTCAATCGACTTCCCAAGAACA CCGCTGTTGCTCAATCGACTAGCCAAGAACA AAGTACTTTCAGTTTCATATTACTCTA AAGTACTTTCAGTGGTCTATTACTCTA GTGCATTTCCCGTAAATCTTGTCTACA GTGCATCCACCGTAAATCTTGTCTACA AAATGTAGTAAAATTCGCGGAAAGTAAATAAA AAATGTAGTAAAATGCGCGCAAAGTAAATAAA
The consensus sequences and mutated bases are underlined.
Results Isolation of Sf-STAT A 600 bp DNA fragment of Sf-STAT was first isolated by PCR using degenerate primers from two protein regions that are conserved between Drosophila and other invertebrate STATs (black arrows in Figure 1A). The deduced amino acid sequences of the PCR product showed high similarity to other STAT family members. Other regions of Sf-STAT beyond the above DNA segment were cloned by 50 - and 30 -RACE, respectively. Two products were obtained from the 30 -RACE. Finally, the full-length cDNA of Sf-STAT was assembled and reamplified by PCR directly from first-stranded cDNA prepared from Sf9 cells. Interestingly, two forms of Sf-STAT transcripts were found. Their deduced amino acid sequences are shown in Figure 1A. The long form and short form of Sf-STAT cDNAs contain an open reading frame of 2304 and 2193 bp encoding proteins of 768 and 731 amino acids, respectively. The C-terminal 42 amino acid residues of the long form are different from the last 5 amino acid residues of the short form. The complete sequences have been deposited in GenBank with the accession numbers AF329946 and AF329947.
Sequence comparison and phylogenetic tree analysis The deduced amino acid sequences of long-form and shortform Sf-STATs were aligned with those of D. melanogaster STAT (Dm-STAT), A. gambiae STAT (Ag-STAT) and human STAT5a (Figure 1A). The comparison reveals that the major functional domains in the known STAT family, such as the DNA-binding domain and the SH2 domain, are also found in these Sf-STATs (Figure 1A). The DNA-binding domain of Sf-STAT shows 55%, 46% and 63% identity to that of Dm-STAT, Ag-STAT and human STAT5a, respectively.
ARTICLE IN PRESS 818 However, the N-terminal region and the C-terminal transactivation domain of Sf-STATs are different from those of other STATs. When the entire amino acid sequences
M.-S. Yeh et al. are compared, Sf-STAT shows 41%, 32% and 30% identity to human STAT5a, Dm-STAT and Ag-STAT (Figure 1A), respectively.
ARTICLE IN PRESS Expression and characterization of two STAT isoforms from Sf9 cells
819
the genomic DNA of Sf9 cells (GenBank accession number AF436838). From the three sequences, we found that the long- and short-form Sf-STATs are derived from alternative splicing (Figure 2A). Therefore, the encoded protein has different C-terminal end of 5 and 42 amino acid residues for the short and long form, respectively. The identified exon–intron boundaries conform to the GT/AG splice donor/acceptor rule. The abundance of long-form and short-form Sf-STAT mRNAs was further examined by RT-PCR using long-form and short-form specific primers as described in the Materials and methods section. As shown in Figure 2C, the long form is more abundant than the short form in Sf9 cells. The PCR product for b-actin was used as an internal control for normalization. In addition to the presence of two STAT isoforms in Sf9 cells, several isoforms of Drosophila STAT protein have been found in the databank. Two isoforms with only seven amino acid differences are generated by usage of different acceptor sites (Figure 2B). The expression of these two isoforms was analyzed by RT-PCR and shown in Figure 2D. The expression level of the long form (142 bp) and the short form (121 bp) is similar. Moreover, we recently cloned a long form of shrimp STAT, which is slightly different from that of the published one [48]. These two shrimp STATs differ in amino acid sequences at their C-termini, 37 residues for the long form and 21 residues for the short form. Taker together, our data suggest that it is general for the presence of two isoforms in the STAT family from insect, fly and shrimp.
Figure 1
(Continued)
To investigate the evolutionary relationship between Sf-STAT and other STAT family members, the amino acid sequences in the DNA-binding domain, linker region and SH2 domain of Sf-STAT were used to perform phylogenetic tree analysis. As illustrated in Figure 1B, Sf-STAT, Ag-STAT, Dm-STAT, human STAT5a/5b and STAT6 are closely related to each other (38–52% identity in the aligned region) and constitute a proposed ancient class within the STAT family. The C. elegans STAT is only distantly related to the insect and vertebrate STATs (15% identity).
Alternative splicing and RT-PCR In order to investigate whether the long and short forms of Sf-STAT are derived from alternative splicing, we used PCR to amplify a DNA fragment containing 3761 bp directly from
Purification of recombinant Sf-STATs produced in insect cells To study the expression and phosphorylation status of the Sf-STATs, recombinant baculovirus containing the long and the short form of the Sf-STAT genes were generated as described previously [39]. Then, the recombinant proteins were purified from the insect cells infected with the recombinant baculovirus. These proteins were tagged at its N-termini with six histidine residues to facilitate purification. The expression and purification of the long form and short form of Sf-STAT are shown in Figure 3. After the cells were lysed with 0.1% NP40, expressed Sf-STATs were present in both the supernatant and the pellet of total cell lysate, respectively (Figure 3A, lanes 2, 3, 6 and 7). The soluble Sf-STATs were further purified by Ni2+-NTA agarose. The long form is about 88 kDa (Figure 3C, lane 1), while the short form is 84 kDa (Figure 3C, lane 2). Interestingly, both proteins were already tyrosine phosphorylated (Figure 3B, lanes 4 and 8).
Figure 1 Amino acid sequence alignment and phylogenetic tree analysis of Sf-STATs: (A) alignment of the amino acid sequence of the Sf-STATs (Sf-STAT-L and Sf-STAT-S) with Drsophila melanogaster STAT (Dm-STAT), Anopheles gambiae Ag-STAT (Ag-STAT) and human STAT5a (STAT5a). Four or five identical residues are shown in white on a black ground. The star indicated the putative tyrosine phosphorylation site. The six different domains are also shown. (B) Phylogenetic analysis of 11 STAT proteins. The amino acid sequences of DNA-binding domain, linker domain and SH2 domain of selected STAT proteins were used for the construction of the tree by a NJ program with bootstrapping using 1000 replicates. The bootstrap values are shown on each internal node. The p value represents the uncorrected proportion of amino acid difference. GeneBank accession numbers of the sequences used are follows: Anopheles gambiae (Ag-STAT, AJ010299); C. elegans (Ce-STAT, Z70754); Drosophila melanogaster (Dm-STAT, Q24151); human STAT1 (P42224); STAT2 (P526301); STAT3 (P40763); STAT4 (Q14765); STAT5a (P42229); STAT5b (U48730) and STAT6 (P42226).
ARTICLE IN PRESS 820
M.-S. Yeh et al.
Figure 2 Alternative splicing and expression of Sf-STAT transcripts in Sf9 cells and Drosophila STATs in third-instar larvae: (A) Partial genomic organization of the 30 region of the Sf-STAT gene (AF436838). The exons are in closed boxes, while 30 -untranslated regions are in open boxes. Intron–exon boundaries were determined by sequencing. The splice donor (gt) and acceptor (ag) sites are underlined. Use of different acceptor sites resulted in a short form and a long form of Sf-STAT proteins with different C-terminal ends. (B) Two isoforms of Drosophila STATs are also generated by alternative splicing by using different acceptor sites. The intron 5 of long form is 43 bp in length and it is 64 bp in length for short form. (C) RT-PCR of Sf-STAT mRNAs. RT-PCR was performed with specific primers to distinguish the short-form and long-form STAT RNAs (see Material and methods section). The PCR products were analyzed on a 1.5% agarose gel. The expected sizes of the PCR products for the short-form and the long-form STAT are 72 and 144 bp, respectively. b-Actin bands were used to normalize the amount of cDNA used in each RT-PCR. (D) RT-PCR of Drosophila STAT mRNAs. RT-PCR was performed with one primer pair and a 270 bp fragment of a-tubulin was used as a control.
The two isoforms of the Sf-STAT protein showed similar DNA-binding properties with various STAT-binding motifs
ble the consensus sequence described for human STAT5 (TTCT/CNA/GGAA) [44] and for Dm-STAT (TTCCCGGAA) [45].
In order to define the DNA-binding specificity of the recombinant Sf-STATs, several commercially-available mammalian DNA-binding motifs for STATs (Santa Cruz) were used and their sequences are listed in Table 1. By EMSA analyses, the long-form and short-form Sf-STAT displayed specific and strong binding to the STAT3, STAT4 and STAT5 probes (Figure 4), but no binding to the GAS, STAT1, STAT6 and SIE probes (data not shown). The binding specificity of probe STAT3 was further confirmed by the addition of anti-Sf-STAT antibodies and the mobility shift of the DNA–protein complex was shown in lanes 7 and 17. The core sequences of STAT3 and STAT5 are TTCT(A/G)GGAA, whereas the core sequence of STAT4 is TTCCCCGAA. These sequences resem-
The long form and short forms of the Sf-STAT protein displayed similar transactivation ability toward a fly Raf promoter in Sf9 cells To test the transactivation activity of these two isoforms, their coding regions were first cloned into the pIZ/V5-His expression vector, which has a promoter that is functional in insect cells. Recently, the Drosophila raf proto-oncogene has been shown to be activated by Drosophila STAT during an immune response [41]. Using EMSA, it was possible to show that both the nuclear extracts of Sf9 cells and purified longform Sf-STAT can specifically bind to the Draf-STAT-binding motifs, TTCGCGGAA (data not shown). Therefore, the Sf9
ARTICLE IN PRESS Expression and characterization of two STAT isoforms from Sf9 cells
821
Figure 4 Electrophoretic mobility shift assay (EMSA) of purified long form and short form of the Sf-STAT proteins. Ten STAT-binding motifs were used and only four probes are shown (see Materials and methods section for details). Binding is completely abolished by the addition of cold competitor in 50fold molar excess (lanes 5, 9, 12, 15, 19 and 22). Specific bindings were observed when mutant probes were added in 50fold molar excess (lanes 6, 10, 13, 16, 20 and 23). The binding specificity of probe STAT3 was further confirmed by the addition of anti-Sf-STAT antibodies and the mobility shift of the DNA–protein complex was shown as indicated by stars (lanes 7 and 17).
Figure 3 Purification and characterization of Sf-STAT proteins. Baculovirus expressing Sf-STATs were used to infect Sf9 cells. (A) Western blot of total cell lysates of recombinant baculovirusinfected cells (lanes 1 and 5), supernatant (lanes 2 and 6), pellet (lanes 3 and 7) and the purified Sf-STATs (lanes 4 and 8) using antibodies against Sf-STAT. (B) The same blot probed with anti-phosphotyrosine antibodies (PY99). (C) SDS-PAGE of purified long form and short form of Sf-STAT proteins stained with Coomassie brilliant blue.
cells were co-transfected with pIZ/V5-Sf-STATs and 2XDrafSTATwt-TATA-luc or 2XDrafSTATmut1-TATA-luc [41] to investigate the transactivation ability of these two isoforms in Sf9 cells. As shown in Figure 5A, the luciferase activities were proportional to the amount of pIZ/V5-Sf-STAT added to the transfection. The luciferase activity of pIZ/V5-Sf-STAT (long form) was slightly higher than that of the short form (lanes 1–3). A low level of luciferase activity resulting from the endogenous STAT protein in Sf9 cells was also observed (control), which is consistent with the observation that SfSTATs were activated during culture as described previously [33]. As a negative control, both the long-form and shortform Sf-STAT could not elicit the luciferase activity with the
2XDrafSTATmut1-TATA-luc reporter construct (data not shown). In order to compare the expression level of these two isoforms, western blot analysis was performed. A polyclonal antibody against Sf-STAT and a monoclonal antibody against phospho-tyrosine were used for the detection. As shown in Figure 5B, the produced amount of the long form is larger than that of the short form. Therefore, there is no significant difference in trans-activating activity between these two isoforms.
AcMNPV infection did not increase the binding of nuclear extracts of Sf9 cells to STAT5 probe The nuclear extracts of Sf9 cells with or without AcMNPV infection over different time courses were prepared and subjected to EMSA (Figure 6A). Equal loading of nuclear extract proteins in each well was monitored by Coomassie brilliant blue staining (Figure 6B). In the control cells, the binding of the nuclear extracts to the STAT5 probe increased with the time course of the cell culture (Figure 6A, lanes 1–4) and nuclear extract from Sf9 cells at 48 h gave the highest STAT5-binding activity. In AcMNPV-infected Sf9 cells, binding of the nuclear extracts to STAT5 probe increased at 12 h post-infection (hpi) and then reached the highest at 24 hpi (lanes 6 and 7). In contrast to the uninfected cells, the binding of nuclear extracts of AcMNPV-infected cells at 48 hpi decreased significantly (lane 8), possibly due to cell cycle arrest induced by the AcMNPV infection [46,47]. Although the gel shift bands are slightly
ARTICLE IN PRESS 822
M.-S. Yeh et al.
Relative luciferase activity
1400
short long
1200 1000 800 600 400 200 0
control
1 0.2 0.2
2 0.5 0.2
3 1.0 0.2
sh ort for m lon gf orm Mo ck
0 Sf-STAT (ug) 2XDraf STAT wt (ug) 0.2
kDa M 170 130 95
1
2
3 α-Sf-STAT
72 55 α-PY α-β-Actin
Figure 5 Effect of the expression of long form and short form Sf-STAT on the promoter activity of the D-raf reporter gene: (A) The reporter plasmids 2xDrafSTATwt-TATA-luc and 2xDrafSTATmut1-TATA-luc were co-transfected into Sf9 cells with the indicated amount of Sf-STAT expression plasmids. Cells were harvested at 48 h after transfection and assayed for luciferase and b-galactosidase activity using a kit from Promega Corporation. The luciferase activity was normalized for b-galactosidase activity in the cell lysate and expressed as an average of three independent experiments. (B) Western blot analysis of total cell lysates from cells transfected with short form (lane 1), long form (lane2) and mock as a negative control (lane 3). The same blot was detected using polyclonal antibodies against Sf-STAT, then stripped and re-probed with monoclonal anti-phosphotyrosine antibodies (-PY) or antibodies against beta-actin.
stronger in the virus-infected cells than in the controls at 12 and 24 h, the effect seems to be small because another stronger gel shift band was seen in the uninfected cells at 48 h. These data suggest that activation of the Sf-STAT protein in Sf9 cells upon baculovirus AcMNPV infection is not obvious.
Discussion In this study, we isolated and characterized a new STAT gene from Sf9 cells. Two STAT transcripts are generated by alternative splicing and encode two isoforms, the long form and the short form, with different C-terminal regions. These two isoforms were produced in Sf9 cells using the recombi-
Figure 6 The binding of nuclear extracts of Sf9 cells to STAT5 probe did not increase upon baculovirus infection: (A) electrophoretic mobility shift assay of nuclear extracts from uninfected (lanes 1–4) and AcMNPV-infected Sf9 cells (lanes 5–8) at different times. The binding probe STAT5 was used. (B) Loading of the nuclear extracts in all gels was assessed using Coomassie blue staining.
nant baculovirus technology [39]. Both purified isoforms were shown to have similar DNA-binding activity as well as transactivation potential toward a Drosophila promoter that includes a STAT-binding motif. No significant activation of the Sf-STAT protein in Sf9 cells was found on infection with wild-type baculovirus AcMNPV. Thus, in addition to the known Drosophila STAT [12,13], Ag-STAT [28], two mosquito STATs [29] and shrimp STAT [48], this is another new member of the arthropod STAT family. In Drosophila, two STAT cDNA clones were isolated. The long form has an additional seven amino acids residues inserted at residue 698 near the carboxyl end of the SH2 domain [13]. However, the binding ability and transactivation potential of this isoform has not been characterized. In mammals, two isoforms, a long a form and a short b form, are found for STATs 1, 3, 4 and 5. For STATs 1, 3 and 4, they are generated by alternative splicing [49], while the a and b forms of STAT5 are formed due to protein processing [50].
ARTICLE IN PRESS Expression and characterization of two STAT isoforms from Sf9 cells The b form of the STAT 5 protein lacks the transactivation domain and becomes a naturally occurring dominantnegative regulator. In this study, we compared the partial genomic sequences from Sf9 cells with the sequences of two STAT transcripts and this indicated that they are generated by alternative splicing and encode two isoforms (Figure 2A). The unique C-terminal end of the short-form and long-form Sf-STAT contains 5 and 42 amino acid residues, respectively. We further provided evidence to show that they had similar DNA-binding ability toward mammalian STAT-binding motifs including the STAT3, STAT4 and STAT5 probes (Figure 4) and similar transactivation potential toward a Drosophila promoter containing a STAT-binding motif (Figure 5). Taken together, this is the first report to demonstrate the presence of two functional STAT transcripts in Sf9 cells. Both the isoforms of Sf-STAT were expressed using the baculovirus expression system, and the purified Sf-STATs are about 88 and 84 kDa, respectively, which is similar to the molecular masses predicted from the cDNA sequences (Figure 3C and F). Interestingly, the recombinant Sf-STATs are already tyrosine phosphorylated (Figure 3B and E). Similar results have been reported when the Sf9 cells are used as host cells for the baculovirus expression of vertebrate STATs. The expressed STATs were already tyrosine phosphorylated no matter whether coinfected with recombinant baculovirus encoding JAK kinases or not [19,35]. It is possible that a Sf9 homolog of the JAK kinase or other tyrosine kinase may be activated during baculovirus infection. The tyrosine phosphorylation of STATs has been shown to be essential for DNA-binding activity and the critical tyrosine phosphorylation sites of each mammalian STAT have been determined [51,52]. The sequence of the putative tyrosine phosphorylation site of Sf-STAT (689NGYVKP) is similar to that of human STAT5a (692DGYVKP) (Figure 1). The EMSA data showed that the Sf-STATs indeed bind to probes STAT3, STAT4 and STAT5 (Figure 4). The core sequences of these probes are TTCTGGGAA, TTCCCCGAA and TTCTAGGAA, respectively. These sequences resemble the consensus sequence described for human STAT5a and STAT5b, TTC(T/C)N(A/G)GAA, [44] and for Dm-STAT (TTCCCGGAA) [13]. In invertebrates, activation of the JAK–STAT pathway has been reported in an anti-microbial response of flies and mosquitoes upon bacterial infection [28,29,41]. Moreover, this pathway has been demonstrated to be required for an anti-viral response in Drosophila [30]. In the present study, we provided evidence to show that in AcMNPV-infected Sf9 cells, the binding of nuclear extracts to STAT5 probe was increased at 12 hpi and reached a maximum at 24 hpi (Figure 6). These results suggested that such an activation of Sf-STAT may be responsible for the anti-viral response in Sf9 cells. Such a conclusion has been made in Drosophila when the global transcriptional response in flies to infection with Drosophila C virus (DCV) was investigated [30]. A novel gene in Drosophila with an unknown function, virus-induced RNA 1 (vir-1), was up-regulated by DCV infection. A virusresponsive element in the vir-1 promoter has been identified to contain the STAT-binding motif, TTCTAAGAA. Mutation of this motif or use of a strain of Drosophila mutated in the JAK–STAT pathway significantly reduced the activity of vir-1 promoter upon DCV infection. The presence of vir-1 homolog in the genome of Sf9 cells and the existence of putative
823
STAT-binding motif in the promoter region of this gene needs further investigation.
Acknowledgments This research was supported by grants from the National Science Council, Taiwan, Republic of China. We are grateful to Dr. M. Yamaguchi for D-raf gene promoter plasmid constructs.
References [1] Kimbrell DA, Beutler B. The evolution and genetics of innate immunity. Nat Rev Genet 2001;2:256–67. [2] Iwanaga S, Lee BL. Recent advances in the innate immunity of invertebrate animals. J Biochem Mol Biol 2005;38:128–50. [3] Leclerc V, Reichhart JM. The immune response of Drosophila melanogaster. Immunol Rev 2004;198:59–71. [4] Kaneko T, Silverman N. Bacterial recognition and signalling by the Drosophila IMD pathway. Cell Microbiol 2005;7:461–9. [5] Hultmark D. Drosophila immunity: paths and patterns. Curr Opin Immunol 2003;15:12–9. [6] Khush RS, Leulier F, Lemaitre B. Drosophila immunity: two paths to NF-kappaB. Trends Immunol 2001;22:260–4. [7] Lemaitre B, Reichhart JM, Hoffmann JA. Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proc Natl Acad Sci USA 1997;94:14614–9. [8] Silverman N, Maniatis T. NF-kappaB signaling pathways in mammalian and insect innate immunity. Genes Dev 2001;15: 2321–42. [9] Tzou P, De Gregorio E, Lemaitre B. How Drosophila combats microbial infection: a model to study innate immunity and host–pathogen interactions. Curr Opin Microbiol 2002;5: 102–10. [10] Agaisse H, Petersen UM, Boutros M, Mathey-Prevot B, Perrimon N. Signaling role of hemocytes in Drosophila JAK/STATdependent response to septic injury. Dev Cell 2003;5:441–50. [11] Binari R, Perrimon N. Stripe-specific regulation of pair-rule genes by hopscotch, a putative Jak family tyrosine kinase in Drosophila. Genes Dev 1994;8:300–12. [12] Hou XS, Melnick MB, Perrimon N. Marelle acts downstream of the Drosophila HOP/JAK kinase and encodes a protein similar to the mammalian STATs. Cell 1996;84:411–9. [13] Yan R, Small S, Desplan C, Dearolf CR, Darnell JEJ. Identification of a Stat gene that functions in Drosophila development. Cell 1996;84:421–30. [14] Harrison DA, McCoon PE, Binari R, Gilman M, Perrimon N. Drosophila unpaired encodes a secreted protein that activates the JAK signaling pathway. Genes Dev 1998;12:3252–63. [15] Brown S, Hu N, Hombria JC. Identification of the first invertebrate interleukin JAK/STAT receptor, the Drosophila gene domeless. Curr Biol 2001;11:1700–5. [16] Karsten P, Hader S, Zeidler MP. Cloning and expression of Drosophila SOCS36E and its potential regulation by the JAK/ STAT pathway. Mech Dev 2002;117:343–6. [17] Rawlings JS, Rosler KM, Harrison DA. The JAK/STAT signaling pathway. J Cell Sci 2004;117:1281–3. [18] Betz A, Lampen N, Martinek S, Young MW, Darnell JEJ. A Drosophila PIAS homologue negatively regulates stat92E. Proc Natl Acad Sci USA 2001;98:9563–8. [19] Schindler C, Darnell JEJ. Transcriptional responses to polypeptide ligands: the JAK–STAT pathway. Annu Rev Biochem 1995; 64:621–51. [20] Ihle JN, Kerr IM. Jaks and Stats in signaling by the cytokine receptor superfamily. Trends Genet 1995;11:69–74.
ARTICLE IN PRESS 824 [21] Zeidler MP, Bach EA, Perrimon N. The roles of the Drosophila JAK/STAT pathway. Oncogene 2000;19:2598–606. [22] Kiger AA, Jones DL, Schulz C, Rogers MB, Fuller MT. Stem cell self-renewal specified by JAK–STAT activation in response to a support cell cue. Science 2001;294:2542–5. [23] Tulina N, Matunis E. Control of stem cell self-renewal in Drosophila spermatogenesis by JAK–STAT signaling. Science 2001;294:2546–9. [24] Hou SX, Zheng Z, Chen X, Perrimon N. The Jak/STAT pathway in model organisms: emerging roles in cell movement. Dev Cell 2002;3:765–78. [25] Hombria JC, Brown S. The fertile field of Drosophila Jak/STAT signalling. Curr Biol 2002;12:R569–75. [26] Wawersik M, Milutinovich A, Casper AL, Matunis E, Williams B, Van Doren M. Somatic control of germline sexual development is mediated by the JAK/STAT pathway. Nature 2005;436: 563–7. [27] Arbouzova NI, Zeidler MP. JAK/STAT signalling in Drosophila: insights into conserved regulatory and cellular functions. Development 2006;133:2605–16. [28] Barillas-Mury C, Han YS, Seeley D, Kafatos FC. Anopheles gambiae Ag-STAT, a new insect member of the STAT family, is activated in response to bacterial infection. EMBO J 1999;18: 959–67. [29] Lin CC, Chou CM, Hsu YL, Lien JC, Wang YM, Chen ST, et al. Characterization of two mosquito STATs, AaSTAT and CtSTAT. Differential regulation of tyrosine phosphorylation and DNA binding activity by lipopolysaccharide treatment and by Japanese encephalitis virus infection. J Biol Chem 2004;279: 3308–17. [30] Dostert C, Jouanguy E, Irving P, Troxler L, Galiana-Arnoux D, Hetru C, et al. The JAK–STAT signaling pathway is required but not sufficient for the antiviral response of Drosophila. Nat Immunol 2005;6:946–53. [31] Smith GE, Summers MD, Fraser MJ. Production of human beta interferon in insect cells infected with a baculovirus expression vector. Mol Cell Biol 1983;3:2156–65. [32] Cameron IR, Possee RD. Conservation of polyhedrin gene promoter function between Autographa californica and Mamestra brassicae nuclear polyhedrosis viruses. Virus Res 1989; 12:183–99. [33] Sliva D, Haldosen LA. STAT-like DNA-binding activity in Spodoptera frugiperda cells. Biochem Biophys Res Commun 1996;225:562–9. [34] Schindler U, Wu P, Rothe M, Brasseur M, McKnight SL. Components of a Stat recognition code: evidence for two layers of molecular selectivity. Immunity 1995;2:689–97. [35] John S, Vinkemeier U, Soldaini E, Darnell JEJ, Leonard WJ. The significance of tetramerization in promoter recruitment by Stat5. Mol Cell Biol 1999;19:1910–8. [36] Mullis KB, Faloona FA. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 1987; 155:335–50.
M.-S. Yeh et al. [37] Rogers JS, Swofford DL. A fast method for approximating maximum likelihoods of phylogenetic trees from nucleotide sequences. Syst Biol 1998;47:77–89. [38] Huang CJ, Huang FL, Chang GD, Chang YS, Lo TB. Studies on the structure and function of the carp gonadotropin alpha subunit by site-directed mutagenesis. Int J Pept Protein Res 1995;46:209–13. [39] Chang MS, Chang GD, Leu JH, Huang FL, Chou CK, Huang CJ, et al. Expression, characterization, and genomic structure of carp JAK1 kinase gene. DNA Cell Biol 1996;15:827–44. [40] Hong TH, Chen ST, Tang TK, Wang SC, Chang TH. The production of polyclonal and monoclonal antibodies in mice using novel immunization methods. J Immunol Methods 1989;120:151–7. [41] Kwon EJ, Park HS, Kim YS, Oh EJ, Nishida Y, Matsukage A, et al. Transcriptional regulation of the Drosophila raf proto-oncogene by Drosophila STAT during development and in immune response. J Biol Chem 2000;275:19824–30. [42] Weitzman MD, Possee RD, King LA. Characterization of two variants of Panolis flammea multiple nucleocapsid nuclear polyhedrosis virus. J Gen Virol 1992;73:1881–6. [43] Deryckere F, Gannon F. A one-hour minipreparation technique for extraction of DNA-binding proteins from animal tissues. Biotechniques 1994;16:405. [44] Ehret GB, Reichenbach P, Schindler U, Horvath CM, Fritz S, Nabholz M, et al. DNA binding specificity of different STAT proteins. Comparison of in vitro specificity with natural target sites. J Biol Chem 2001;276:6675–88. [45] Yan R, Luo H, Darnell JEJ, Dearolf CR. A JAK–STAT pathway regulates wing vein formation in Drosophila. Proc Natl Acad Sci USA 1996;93:5842–7. [46] Clarke TE, Clem RJ. Insect defenses against virus infection: the role of apoptosis. Int Rev Immunol 2003;22:401–24. [47] Clem RJ. The role of apoptosis in defense against baculovirus infection in insects. Curr Top Microbiol Immunol 2005;289: 113–29. [48] Liu WJ, Chang YS, Wang AH, Kou GH, Lo CF. White spot syndrome virus annexes a shrimp STAT to enhance expression of the immediate-early gene ie1. J Virol 2007;81:1461–71. [49] Bromberg J, Chen X. STAT proteins: signal tranducers and activators of transcription. Methods Enzymol 2001;333:138–51. [50] Azam M, Lee C, Strehlow I, Schindler C. Functionally distinct isoforms of STAT5 are generated by protein processing. Immunity 1997;6:691–701. [51] Gouilleux F, Wakao H, Mundt M, Groner B. Prolactin induces phosphorylation of Tyr694 of Stat5 (MGF), a prerequisite for DNA binding and induction of transcription. EMBO J 1994;13: 4361–9. [52] Quelle FW, Thierfelder W, Witthuhn BA, Tang B, Cohen S, Ihle JN. Phosphorylation and activation of the DNA binding activity of purified Stat1 by the Janus protein-tyrosine kinases and the epidermal growth factor receptor. J Biol Chem 1995;270: 20775–80.
Available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/dci
Expression and characterization of two STAT isoforms from Sf9 cells$ Maw-Sheng Yeha,1, Chia-Hsiung Chengb,1, Chih-Ming Chouc, Ya-Li Hsud, Cheng-Ying Chub, Gen-Der Chenb, Shui-Tsung Chenb, Guang-Chao Chenb, Chang-Jen Huangb,d, a
Department of Food and Nutrition, Hung-Kuang University, Taichung, Taiwan Institute of Biological Chemistry, Academia Sinica, 128, Sec 2, Academia Road, Taipei 115, Taiwan c Department of Biochemistry, Taipei Medical University, Taipei, Taiwan d Institute of Cellular and Organismic Biology, Academia Sinica, Taipei, Taiwan b
Received 21 November 2007; accepted 3 December 2007 Available online 26 December 2007
KEYWORDS STAT; DNA binding; Baculovirus; Insect Sf9 cells
Summary In invertebrates, the JAK–STAT signaling pathway is involved in the anti-bacterial response and is part of an anti-viral response in Drosophila. In this study, we show that two STAT transcripts are generated by alternative splicing and encode two isoforms of Sf-STAT with different C-terminal ends. These two isoforms were produced and purified using the recombinant baculovirus technology. Both purified isoforms showed similar DNA-binding activity and displayed weak but significant transactivation potential toward a Drosophila promoter that contained a STAT-binding motif. No significant activation of the Sf-STAT protein in Sf9 cells was found by infection with baculovirus AcMNPV. & 2007 Elsevier Ltd. All rights reserved.
Introduction Innate immunity is an ancestrally common defense system for insects and mammals to defend themselves from
$ The sequence data in this paper has been submitted to the EMBL/GenBank Data Libraries under the accession number AF329946, AF329947 and AF436838. Corresponding author. Tel.: +886 2 2785 5696; fax: +886 2 2788 9759. E-mail address: [email protected] (C.-J. Huang). 1 These authors contributed equally to this work.
0145-305X/$ - see front matter & 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2007.12.001
invading bacterial, fungal and viral pathogens. This defense system has been demonstrated to be conserved as an intracellular signaling pathway that can rapidly respond to infection by transcriptional regulation [1,2]. In Drosophila, there are three distinct pathways that make up the innate immune system. Two pathways are activated by different bacterial peptidoglycans (PGNs). Diaminopimelic acid-containing PGN activates the Imd pathway, while lysinecontaining PGN activates the Toll pathway [3,4]. These two pathways cause the expression of genes via distinct NFkB-like transcription factors [5–7]. The mammalian Toll-like receptor and TNF cascade pathways that regulate NF-kB activity are similar to these two pathways in insect [8,9].
ARTICLE IN PRESS Expression and characterization of two STAT isoforms from Sf9 cells In addition to the Toll/Imd pathways, the JAK–STAT pathway has been associated with septic injury [10]. Among invertebrates, the Drosophila JAK–STAT pathway has been intensively studied. Initially, a single JAK homolog, hopscotch [11], and a STAT protein (STAT92E) were identified [12,13]. Then, a secreted glycoprotein, Unpaired, was identified as a ligand [14] that binds to the receptor Domeless [15]. Moreover, negative regulators such as the SOCS proteins [16,17] and a PIAS homolog [18] have also been found in Drosophila. Thus, the Drosophila JAK–STAT pathway is similar to mammalian JAK–STAT pathway [19,20]. In Drosophila, the JAK–STAT pathway was first identified to be involved in embryonic segmentation [11] and was later shown to control a number of developmental events, such as eye formation, spermatogenesis and oogenesis, somatic control of male germline sexual development, tracheal morphogenesis and gut morphogenesis [21–27]. However, activation of the JAK–STAT pathway in response to bacterial infection has also been reported in mosquito [28,29]. Recently, the Drosophila JAK–STAT pathway has been shown to be required for anti-viral response [30]. Taken together, these results indicate that the JAK/STAT pathway could directly participate in the immune response of insects. The Sf9 cell line is derived from the pupal ovarian tissue of the fall army worm (Spodoptera frugiperda) [31] and is usually used as host cells for the production of heterologous proteins in the baculovirus expression system [32]. It has been reported that the nuclear extracts from Sf9 cells have STAT-binding activity with or without serum in the culture medium [33]. In addition, the recombinant mammalian STAT proteins produced in Sf9 cells are tyrosine phosphorylated [34,35]. This suggests that an active protein tyrosine kinase is present in Sf9 cells under normal growth condition or infection with recombinant baculovirus. Tyrosine kinase that can activate endogeneous or recombinant STAT proteins has not been characterized. In this study, we isolated and characterized the endogenous STAT gene from Sf9 cells. Interestingly, we found that there are two STAT transcripts derived by alternative splicing, and this leads to the generation of two isoforms of the protein, the long form and the short form. The DNA-binding ability and transactivation ability of these two isoforms were compared, and both isoforms were found to have similar transactivation potential toward a Drosophila promoter that contained a STAT-binding motif. The possible function of these STAT proteins in insect cells was investigated using infection by a wild-type baculovirus, Autographa californica nuclear polyhedrosis virus (AcMNPV).
Materials and methods Cell culture The insect Sf9 cells (S. frugiperda) were cultured at 28 1C in SF900 II media (Life Technologies, Gaithersburg, MD, USA) supplemented with 50 U/ml penicillin and 50 U/ml streptomycin.
cDNA synthesis and cloning Total RNA was purified from Sf9 cells or third-instar larvae of Drosophila melanogaster using the RNAzol B kit (Biotecx,
815
Friendswood, TX, USA) following the manufacturer’s instructions. The first-strand cDNA synthesis was primed with oligo-(dT) linker–primer and random primers, and was transcribed using moloney murine leukemia virus reverse transcriptase (MMLV-RT) (Life Technologies). The synthesized cDNA was used as template in a subsequent polymerase chain reaction (PCR) [36]. To clone the Sf-STAT gene, degenerate primers were designed and synthesized based on two protein regions 347 QPPQVMK and FTFWEWFF580 found in Dm-STAT, which are conserved among insect STATs [28]. Their sequences were sense 50 -CA(AG) CCN CCN CA(AG) GTN ATG AA-30 and antisense 50 -AA (A/G) AAC CA(T/C) TCC CA(A/G) AAN GT(A/G) AA-30 . A PCR product of 600 bp was obtained using these degenerate primers, with the template being first cDNA from Sf9 cells. The PCR conditions were initial denaturation at 94 1C for 2 min followed by 40 cycles of 94 1C for 30 s (denaturation), 45 1C for 30 s (annealing), 72 1C for 45 s (extension) and then a final extension of 5 min at 72 1C. Amplified DNA fragments were then purified and ligated into pGEM-T (Promega, Madison, WI, USA). Each clone was sequenced using AmpliTaq DNA polymerase and fluorescent dideoxynucleotides according to the manufacturer’s protocols (Applied Biosystems, CA, USA); the reaction products were then electrophoresed and analyzed on an automated DNA sequencer (Applied Biosystems model 310).
Rapid amplification of cDNA ends (RACE) The 50 and 30 ends of the Sf-STAT mRNA were obtained by the RACE technique using the Marathon cDNA amplification kit (Clontech, Palo Alto, CA, USA) according to the manufacturer’s instructions. Briefly, total RNA was isolated from Sf9 cells, and poly (A)+ RNA was prepared. The first-strand cDNA was synthesized using a modified poly-T primer and 1 mg of poly (A)+ RNA. The second-strand cDNA was obtained using an enzyme cocktail-containing RNase H, DNA polymerase and DNA ligase. Asymmetric adaptor primers (AP primers) were then ligated to both ends of the double-stranded cDNA. An aliquot of this cDNA collection was diluted 1:100 and subjected to two different anchored PCRs. The 50 RACE was performed with a 27mer sense primer (AP1) specific for the adaptor and anti-sense primer for Sf-STAT (50 -GGAACAACAAGCCCAATTGCT TC-30 ), whereas the second round of PCR was carried out with a nested 23mer sense primer (AP2) and a nested anti-sense primer (50 -GCTACTGTCCGTTTACTGGTCG G-30 ). Primers corresponding to the adaptor sequence AP1 (external) and AP2 (internal) were supplied with the Marathon kit. For 30 RACE, cDNA was first amplified with AP1 primer and Sf-STAT primer (50 -CGACCTCTCCGAAGATAA CCTGAG-30 ), and then reamplified with AP2 and a nested anti-sense primer (50 -ACCA GTCTCCCATTGAACAACATCG-30 ). The PCR products were cloned into pGEM-T vector (Promega) and sequenced.
Phylogenetic analysis Phylogenetic trees were constructed by the maximumparsimony method and by the neighbor-joining (NJ) method based on a p value that represents the uncorrected proportion of amino acid difference. The validity of the
ARTICLE IN PRESS 816 various branches of the trees was tested by bootstrapping using 100 replicates [37]. Using this approach, we constructed a phylogeny of the published invertebrate STAT and human STAT sequences using the distance analysis. The DNAbinding domain, linker domain and SH2 domain of STAT family were used to construct the phylogenetic trees. In addition to Sf-STAT, ten other STAT family members were analyzed and their accession numbers are Anopheles gambiae (Ag-STAT, AJ010299); Caenorhabditis elegans (Ce-STAT, Z70754); D. melanogaster (Dm-STAT, Q24151); human STAT1 (P42224); STAT2 (P526301); STAT3 (P40763); STAT4 (Q14765); STAT5a (P42229); STAT5b (U48730) and STAT6 (P42226).
Isolation of genomic DNA from Sf9 cells Genomic DNA was prepared from Sf9 cells with DNAzol reagent (Life Technologies, Gaithersburg, MD). The genomic DNA was precipitated by the addition of 100% ethanol and then removed by spooling onto a pipette tip. After washing and drying, the DNA was dissolved in TE buffer (10 mM Tris HCl, 1 mM EDTA, pH 8.0).
Amplification of genomic DNA by PCR Specific primers (forward, 50 -ACGACGTCTTCTCCAAGTATTACACT-30 and reverse, 50 -AGGCTCGA ATCTGCTCGAACAGTTCG-30 ) were designed according to the cDNA sequences. With these primers and Sf9 genomic DNA as the template, PCR was performed to isolate a partial fragment of the Sf-STAT gene directly from the genomic DNA. This was then cloned into pGEM-T and sequenced as described above.
RT-PCR The abundance of long-form and short-form Sf-STAT mRNA was examined by RT-PCR with one primer pair (forward, 50 -CTACTTC AGTGCGGCTACACCGGCCC-30 and reverse, 50 -TATCTTGTTGTCATCTTACTTC ATGC-30 ) for the long form and another primer pair (forward, 50 -GTACATGATTGATTTCTGAGTTT CTT-30 and reverse, 50 -CTGTGTCGAAATGTCAGTTCATCTTC-30 ) for the short form. The expected sizes of the PCR products for short-form and long-form STAT were 72 and 144 bp, respectively. Similarly, one primer pair (forward, 50 -ACCCTAGCGACCGCAATGCGAGTC-30 and reverse, 50 -CTACAAACGTGAACATGCAATGTGCTC-30 ) was used for RT-PCR to examine the presence of two isoforms in fly larvae. The expected sizes of the PCR products for short-form and longform Drosphola STAT were 121 and 142 bp, respectively.
Expression and purification of recombinant Sf-STAT proteins The full-length cDNA encoding Sf-STAT was cloned into the Not I site of the baculovirus transfer vector pAcSG (PharMingen, San Diego, CA, USA). The integrity of the construct was confirmed by automated DNA sequencing. The recombinant baculovirus was generated by transfecting Sf9 cells with the pAcSG constructs using the BacVector-1000 Transfection kit (Novagen, Darmstadt, Germany) according
M.-S. Yeh et al. to the manufacturer’s protocols and our previous reports [38,39]. Recombinant proteins were expressed in Sf9 cells that were grown in suspension in Sf900 II medium (Life Technologies). Cells were infected with recombinant baculovirus at a multiplicity of infection of 5 and harvested at 72 h post-infection. The cells (5 107) were lysed in 10 ml lysis buffer containing 20 mM HEPES (pH 9), 420 mM NaCl, 0.1% NP-40, 15% glycerol, 2 mM b-mercaptoethanol, 1 mM PMSF, 1 mM NaF, 1 mM Na3VO4, 30 mM imidazol and 1 mM b-glycerophosphate. After centrifugation at 13,000 rpm for 30 min, the supernatant was added to 0.5 ml of packed Ni2+NTA agarose (Qiagen) and incubated at 4 1C for 2 h with constant rotation. The slurry was transferred to a disposable plastic column, washed with 20 volumes of lysis buffer containing 30 mM imidazol, followed by 20 volumes of lysis buffer containing 50 mM imidazol. The Sf-STAT proteins were eluted with lysis buffer supplemented with 100, 150 and 250 mM imidazol, respectively. The protein concentration of the purified Sf-STAT was determined by the Bradford method.
Antibody preparation Part of the Sf-STAT cDNA (nucleotides 1115–1613; amino acids 351–488) was recovered by PCR and cloned into the His-Tag expression vector pQE30 (Qiagene, Hilden, Germany). The fusion proteins were expressed in Escherichia coli and purified using Ni-NTA agarose (Qiagene) under denaturing condition (1.5% sarcosine in PBS) according to our previous procedures [39]. The purified protein was used to immunize New Zealand white rabbits by the intrasplenic immunization method [40].
Western blot analysis Total cell lysates of recombinant baculovirus-infected cells or purified proteins were separated on 10% SDS-polyacrylamide gels and transferred to nitrocellulose membranes. The membrane was blocked with 5% skim milk in PBS for 1 h at 4 1C and then incubated for 16 h at 4 1C with anti-sera against Sf-STAT (1:1000 dilution) or anti-phosphotyrosine antibodies, PY99 (1:2000 dilution; Santa Cruz, CA, USA) in PBS containing 5% skim milk. The membrane was washed twice in PBS plus 0.2% Tween 20 and probed with appropriate secondary antibodies for 1 h at 4 1C. After another 15 min wash with PBST, the membrane was treated with enhanced chemiluminescence detection solutions (NEN, Boston, MA, USA) and exposed to film.
Electrophoretic mobility shift assay (EMSA) Several commercially available mammalian DNA-binding motifs for STATs (Santa Cruz) were used in this study. The upper strand sequences of the normal and the corresponding mutant oligonucleotides are listed in Table 1. The probes were prepared by annealing complementary oligonucleotides, followed by end labelling with [a-32P] dCTP or [a-32P] dGTP using Klenow fill-in (Boehringer Mannheim, Mannheim, Germany). The reaction mixtures (15 ml) contained 2 mg of nuclear extracts from Sf9 cells or baculovirus-infected Sf9 cells,
ARTICLE IN PRESS Expression and characterization of two STAT isoforms from Sf9 cells various amounts of recombinant Sf-STAT, labeled probes (30,000 cpm, 0.1–0.2 ng) and 1.5 mg of poly (dI-dC) in 10 mM Tris HCl (pH 7.5), 10 mM HEPES, 1 mM EDTA, 100 mM NaCl, 1 mM dithiothreitol and 15% glycerol. After the mixtures had been incubated on ice for 30 min, the DNA–protein complexes were analyzed on a non-denaturing 5% polyacrylamide gel in Tris-borate buffer at 150 V for 2.5 h at room temperature. Dried gels were analyzed using a Fuji PhosphorImager BAS 2000 (Japan). For the competition experiments, 50 ng of non-labeled or mutant oligonucleotides were mixed with the labeled probes before the protein was added. For the supershift experiments, anti-serum against Sf-STAT was added to the binding reaction mixtures and incubated with the labeled DNA probe.
Plasmid construction The expression vector, pIZ/V5-Sf-STATs, was constructed by inserting the full-length Sf-STAT cDNA into the Hind III and Not I sites of pIZ/V5 vector, which has an OpIE2 promoter (Invitrogen, CA, USA). The integrity of the constructs was confirmed by automated DNA sequencing. The reporter plasmids, DrafSTATwt-luc, 2XDrafSTATWT-luc and 2XDrafSTATmut1-TATA-luc, were kindly provided by Yamaguchi [41].
Transactivation assay Transfections were performed in 12-well plates. Briefly, 0.2 mg of reporter constructs such as 2XDrafSTATWT-luc and 2XDrafSTATmut1-TATA-luc were co-transfected with 0.1, 0.5 or 1.0 mg of the expression plasmid pIZ/V5-Sf-STATs. Transfection of the various DNA mixtures into Sf9 cells was performed using the Eufectin Transfection Reagent (Novagen, Germany). At 48 h post-transfection, the cells were harvested and assayed for luciferase activities using a luciferase assay kit, FireLite, purchased from Packard (Groningen, The Netherlands). Firefly luciferase activities were normalized to protein amounts as determined by a Bio-Rad protein assay. Similarly, at 48 h post-transfection, the cells were harvested and subjected to Western blot analysis using a polyclonal antibody against Sf-STAT or antiphosphotyrosine monoclonal antibodies.
Preparation of nuclear extracts The Sf9 cells (5 106) were plated on a 10 cm Petri dish and cultured for 16 h. The Sf9 cells were infected with AcMNPV at a multiplicity of infection of 5. The titer of the AcMNPV was determined by the plaque assay [42]. Sf9 cells were harvested at 12, 24 and 48 h post-infection. Nuclear extracts of the normal Sf9 cells and the baculovirus-infected cells were prepared using a previously described minipreparation method [43]. The nuclear extracts were preserved at 70 1C until use. The protein concentration of the nuclear extracts was determined by a Bio-Rad protein assay.
817
Table 1 Oligonucleotide probes used to determine DNA-binding specificity of Sf-STAT. Probe
Sequence
STAT1 Mut. STAT1 STAT3 Mut. STAT3 STAT4 Mut. STAT4 STAT5 Mut. STAT5 STAT6 Mut. STAT6 GAS Mut. GAS SIE Mut. SIE D-raf Mut. D-raf
CATGTTATGCATATTCCTGTAAGTG CATGTTATGCATATTGGAGTAAGTG GATCCTTCTGGGAATTCCTAGATC GATCCTTCTGGGCCGTCCTAGATC GAGCCTGATTTCCCCGAAATGATGAGC GAGCCTGATTTCTTTGAAATGATGAGC AGATTTCTAGGAATTCAATCC AGATTTAGTTTAATTCAATCC CCGCTGTTGCTCAATCGACTTCCCAAGAACA CCGCTGTTGCTCAATCGACTAGCCAAGAACA AAGTACTTTCAGTTTCATATTACTCTA AAGTACTTTCAGTGGTCTATTACTCTA GTGCATTTCCCGTAAATCTTGTCTACA GTGCATCCACCGTAAATCTTGTCTACA AAATGTAGTAAAATTCGCGGAAAGTAAATAAA AAATGTAGTAAAATGCGCGCAAAGTAAATAAA
The consensus sequences and mutated bases are underlined.
Results Isolation of Sf-STAT A 600 bp DNA fragment of Sf-STAT was first isolated by PCR using degenerate primers from two protein regions that are conserved between Drosophila and other invertebrate STATs (black arrows in Figure 1A). The deduced amino acid sequences of the PCR product showed high similarity to other STAT family members. Other regions of Sf-STAT beyond the above DNA segment were cloned by 50 - and 30 -RACE, respectively. Two products were obtained from the 30 -RACE. Finally, the full-length cDNA of Sf-STAT was assembled and reamplified by PCR directly from first-stranded cDNA prepared from Sf9 cells. Interestingly, two forms of Sf-STAT transcripts were found. Their deduced amino acid sequences are shown in Figure 1A. The long form and short form of Sf-STAT cDNAs contain an open reading frame of 2304 and 2193 bp encoding proteins of 768 and 731 amino acids, respectively. The C-terminal 42 amino acid residues of the long form are different from the last 5 amino acid residues of the short form. The complete sequences have been deposited in GenBank with the accession numbers AF329946 and AF329947.
Sequence comparison and phylogenetic tree analysis The deduced amino acid sequences of long-form and shortform Sf-STATs were aligned with those of D. melanogaster STAT (Dm-STAT), A. gambiae STAT (Ag-STAT) and human STAT5a (Figure 1A). The comparison reveals that the major functional domains in the known STAT family, such as the DNA-binding domain and the SH2 domain, are also found in these Sf-STATs (Figure 1A). The DNA-binding domain of Sf-STAT shows 55%, 46% and 63% identity to that of Dm-STAT, Ag-STAT and human STAT5a, respectively.
ARTICLE IN PRESS 818 However, the N-terminal region and the C-terminal transactivation domain of Sf-STATs are different from those of other STATs. When the entire amino acid sequences
M.-S. Yeh et al. are compared, Sf-STAT shows 41%, 32% and 30% identity to human STAT5a, Dm-STAT and Ag-STAT (Figure 1A), respectively.
ARTICLE IN PRESS Expression and characterization of two STAT isoforms from Sf9 cells
819
the genomic DNA of Sf9 cells (GenBank accession number AF436838). From the three sequences, we found that the long- and short-form Sf-STATs are derived from alternative splicing (Figure 2A). Therefore, the encoded protein has different C-terminal end of 5 and 42 amino acid residues for the short and long form, respectively. The identified exon–intron boundaries conform to the GT/AG splice donor/acceptor rule. The abundance of long-form and short-form Sf-STAT mRNAs was further examined by RT-PCR using long-form and short-form specific primers as described in the Materials and methods section. As shown in Figure 2C, the long form is more abundant than the short form in Sf9 cells. The PCR product for b-actin was used as an internal control for normalization. In addition to the presence of two STAT isoforms in Sf9 cells, several isoforms of Drosophila STAT protein have been found in the databank. Two isoforms with only seven amino acid differences are generated by usage of different acceptor sites (Figure 2B). The expression of these two isoforms was analyzed by RT-PCR and shown in Figure 2D. The expression level of the long form (142 bp) and the short form (121 bp) is similar. Moreover, we recently cloned a long form of shrimp STAT, which is slightly different from that of the published one [48]. These two shrimp STATs differ in amino acid sequences at their C-termini, 37 residues for the long form and 21 residues for the short form. Taker together, our data suggest that it is general for the presence of two isoforms in the STAT family from insect, fly and shrimp.
Figure 1
(Continued)
To investigate the evolutionary relationship between Sf-STAT and other STAT family members, the amino acid sequences in the DNA-binding domain, linker region and SH2 domain of Sf-STAT were used to perform phylogenetic tree analysis. As illustrated in Figure 1B, Sf-STAT, Ag-STAT, Dm-STAT, human STAT5a/5b and STAT6 are closely related to each other (38–52% identity in the aligned region) and constitute a proposed ancient class within the STAT family. The C. elegans STAT is only distantly related to the insect and vertebrate STATs (15% identity).
Alternative splicing and RT-PCR In order to investigate whether the long and short forms of Sf-STAT are derived from alternative splicing, we used PCR to amplify a DNA fragment containing 3761 bp directly from
Purification of recombinant Sf-STATs produced in insect cells To study the expression and phosphorylation status of the Sf-STATs, recombinant baculovirus containing the long and the short form of the Sf-STAT genes were generated as described previously [39]. Then, the recombinant proteins were purified from the insect cells infected with the recombinant baculovirus. These proteins were tagged at its N-termini with six histidine residues to facilitate purification. The expression and purification of the long form and short form of Sf-STAT are shown in Figure 3. After the cells were lysed with 0.1% NP40, expressed Sf-STATs were present in both the supernatant and the pellet of total cell lysate, respectively (Figure 3A, lanes 2, 3, 6 and 7). The soluble Sf-STATs were further purified by Ni2+-NTA agarose. The long form is about 88 kDa (Figure 3C, lane 1), while the short form is 84 kDa (Figure 3C, lane 2). Interestingly, both proteins were already tyrosine phosphorylated (Figure 3B, lanes 4 and 8).
Figure 1 Amino acid sequence alignment and phylogenetic tree analysis of Sf-STATs: (A) alignment of the amino acid sequence of the Sf-STATs (Sf-STAT-L and Sf-STAT-S) with Drsophila melanogaster STAT (Dm-STAT), Anopheles gambiae Ag-STAT (Ag-STAT) and human STAT5a (STAT5a). Four or five identical residues are shown in white on a black ground. The star indicated the putative tyrosine phosphorylation site. The six different domains are also shown. (B) Phylogenetic analysis of 11 STAT proteins. The amino acid sequences of DNA-binding domain, linker domain and SH2 domain of selected STAT proteins were used for the construction of the tree by a NJ program with bootstrapping using 1000 replicates. The bootstrap values are shown on each internal node. The p value represents the uncorrected proportion of amino acid difference. GeneBank accession numbers of the sequences used are follows: Anopheles gambiae (Ag-STAT, AJ010299); C. elegans (Ce-STAT, Z70754); Drosophila melanogaster (Dm-STAT, Q24151); human STAT1 (P42224); STAT2 (P526301); STAT3 (P40763); STAT4 (Q14765); STAT5a (P42229); STAT5b (U48730) and STAT6 (P42226).
ARTICLE IN PRESS 820
M.-S. Yeh et al.
Figure 2 Alternative splicing and expression of Sf-STAT transcripts in Sf9 cells and Drosophila STATs in third-instar larvae: (A) Partial genomic organization of the 30 region of the Sf-STAT gene (AF436838). The exons are in closed boxes, while 30 -untranslated regions are in open boxes. Intron–exon boundaries were determined by sequencing. The splice donor (gt) and acceptor (ag) sites are underlined. Use of different acceptor sites resulted in a short form and a long form of Sf-STAT proteins with different C-terminal ends. (B) Two isoforms of Drosophila STATs are also generated by alternative splicing by using different acceptor sites. The intron 5 of long form is 43 bp in length and it is 64 bp in length for short form. (C) RT-PCR of Sf-STAT mRNAs. RT-PCR was performed with specific primers to distinguish the short-form and long-form STAT RNAs (see Material and methods section). The PCR products were analyzed on a 1.5% agarose gel. The expected sizes of the PCR products for the short-form and the long-form STAT are 72 and 144 bp, respectively. b-Actin bands were used to normalize the amount of cDNA used in each RT-PCR. (D) RT-PCR of Drosophila STAT mRNAs. RT-PCR was performed with one primer pair and a 270 bp fragment of a-tubulin was used as a control.
The two isoforms of the Sf-STAT protein showed similar DNA-binding properties with various STAT-binding motifs
ble the consensus sequence described for human STAT5 (TTCT/CNA/GGAA) [44] and for Dm-STAT (TTCCCGGAA) [45].
In order to define the DNA-binding specificity of the recombinant Sf-STATs, several commercially-available mammalian DNA-binding motifs for STATs (Santa Cruz) were used and their sequences are listed in Table 1. By EMSA analyses, the long-form and short-form Sf-STAT displayed specific and strong binding to the STAT3, STAT4 and STAT5 probes (Figure 4), but no binding to the GAS, STAT1, STAT6 and SIE probes (data not shown). The binding specificity of probe STAT3 was further confirmed by the addition of anti-Sf-STAT antibodies and the mobility shift of the DNA–protein complex was shown in lanes 7 and 17. The core sequences of STAT3 and STAT5 are TTCT(A/G)GGAA, whereas the core sequence of STAT4 is TTCCCCGAA. These sequences resem-
The long form and short forms of the Sf-STAT protein displayed similar transactivation ability toward a fly Raf promoter in Sf9 cells To test the transactivation activity of these two isoforms, their coding regions were first cloned into the pIZ/V5-His expression vector, which has a promoter that is functional in insect cells. Recently, the Drosophila raf proto-oncogene has been shown to be activated by Drosophila STAT during an immune response [41]. Using EMSA, it was possible to show that both the nuclear extracts of Sf9 cells and purified longform Sf-STAT can specifically bind to the Draf-STAT-binding motifs, TTCGCGGAA (data not shown). Therefore, the Sf9
ARTICLE IN PRESS Expression and characterization of two STAT isoforms from Sf9 cells
821
Figure 4 Electrophoretic mobility shift assay (EMSA) of purified long form and short form of the Sf-STAT proteins. Ten STAT-binding motifs were used and only four probes are shown (see Materials and methods section for details). Binding is completely abolished by the addition of cold competitor in 50fold molar excess (lanes 5, 9, 12, 15, 19 and 22). Specific bindings were observed when mutant probes were added in 50fold molar excess (lanes 6, 10, 13, 16, 20 and 23). The binding specificity of probe STAT3 was further confirmed by the addition of anti-Sf-STAT antibodies and the mobility shift of the DNA–protein complex was shown as indicated by stars (lanes 7 and 17).
Figure 3 Purification and characterization of Sf-STAT proteins. Baculovirus expressing Sf-STATs were used to infect Sf9 cells. (A) Western blot of total cell lysates of recombinant baculovirusinfected cells (lanes 1 and 5), supernatant (lanes 2 and 6), pellet (lanes 3 and 7) and the purified Sf-STATs (lanes 4 and 8) using antibodies against Sf-STAT. (B) The same blot probed with anti-phosphotyrosine antibodies (PY99). (C) SDS-PAGE of purified long form and short form of Sf-STAT proteins stained with Coomassie brilliant blue.
cells were co-transfected with pIZ/V5-Sf-STATs and 2XDrafSTATwt-TATA-luc or 2XDrafSTATmut1-TATA-luc [41] to investigate the transactivation ability of these two isoforms in Sf9 cells. As shown in Figure 5A, the luciferase activities were proportional to the amount of pIZ/V5-Sf-STAT added to the transfection. The luciferase activity of pIZ/V5-Sf-STAT (long form) was slightly higher than that of the short form (lanes 1–3). A low level of luciferase activity resulting from the endogenous STAT protein in Sf9 cells was also observed (control), which is consistent with the observation that SfSTATs were activated during culture as described previously [33]. As a negative control, both the long-form and shortform Sf-STAT could not elicit the luciferase activity with the
2XDrafSTATmut1-TATA-luc reporter construct (data not shown). In order to compare the expression level of these two isoforms, western blot analysis was performed. A polyclonal antibody against Sf-STAT and a monoclonal antibody against phospho-tyrosine were used for the detection. As shown in Figure 5B, the produced amount of the long form is larger than that of the short form. Therefore, there is no significant difference in trans-activating activity between these two isoforms.
AcMNPV infection did not increase the binding of nuclear extracts of Sf9 cells to STAT5 probe The nuclear extracts of Sf9 cells with or without AcMNPV infection over different time courses were prepared and subjected to EMSA (Figure 6A). Equal loading of nuclear extract proteins in each well was monitored by Coomassie brilliant blue staining (Figure 6B). In the control cells, the binding of the nuclear extracts to the STAT5 probe increased with the time course of the cell culture (Figure 6A, lanes 1–4) and nuclear extract from Sf9 cells at 48 h gave the highest STAT5-binding activity. In AcMNPV-infected Sf9 cells, binding of the nuclear extracts to STAT5 probe increased at 12 h post-infection (hpi) and then reached the highest at 24 hpi (lanes 6 and 7). In contrast to the uninfected cells, the binding of nuclear extracts of AcMNPV-infected cells at 48 hpi decreased significantly (lane 8), possibly due to cell cycle arrest induced by the AcMNPV infection [46,47]. Although the gel shift bands are slightly
ARTICLE IN PRESS 822
M.-S. Yeh et al.
Relative luciferase activity
1400
short long
1200 1000 800 600 400 200 0
control
1 0.2 0.2
2 0.5 0.2
3 1.0 0.2
sh ort for m lon gf orm Mo ck
0 Sf-STAT (ug) 2XDraf STAT wt (ug) 0.2
kDa M 170 130 95
1
2
3 α-Sf-STAT
72 55 α-PY α-β-Actin
Figure 5 Effect of the expression of long form and short form Sf-STAT on the promoter activity of the D-raf reporter gene: (A) The reporter plasmids 2xDrafSTATwt-TATA-luc and 2xDrafSTATmut1-TATA-luc were co-transfected into Sf9 cells with the indicated amount of Sf-STAT expression plasmids. Cells were harvested at 48 h after transfection and assayed for luciferase and b-galactosidase activity using a kit from Promega Corporation. The luciferase activity was normalized for b-galactosidase activity in the cell lysate and expressed as an average of three independent experiments. (B) Western blot analysis of total cell lysates from cells transfected with short form (lane 1), long form (lane2) and mock as a negative control (lane 3). The same blot was detected using polyclonal antibodies against Sf-STAT, then stripped and re-probed with monoclonal anti-phosphotyrosine antibodies (-PY) or antibodies against beta-actin.
stronger in the virus-infected cells than in the controls at 12 and 24 h, the effect seems to be small because another stronger gel shift band was seen in the uninfected cells at 48 h. These data suggest that activation of the Sf-STAT protein in Sf9 cells upon baculovirus AcMNPV infection is not obvious.
Discussion In this study, we isolated and characterized a new STAT gene from Sf9 cells. Two STAT transcripts are generated by alternative splicing and encode two isoforms, the long form and the short form, with different C-terminal regions. These two isoforms were produced in Sf9 cells using the recombi-
Figure 6 The binding of nuclear extracts of Sf9 cells to STAT5 probe did not increase upon baculovirus infection: (A) electrophoretic mobility shift assay of nuclear extracts from uninfected (lanes 1–4) and AcMNPV-infected Sf9 cells (lanes 5–8) at different times. The binding probe STAT5 was used. (B) Loading of the nuclear extracts in all gels was assessed using Coomassie blue staining.
nant baculovirus technology [39]. Both purified isoforms were shown to have similar DNA-binding activity as well as transactivation potential toward a Drosophila promoter that includes a STAT-binding motif. No significant activation of the Sf-STAT protein in Sf9 cells was found on infection with wild-type baculovirus AcMNPV. Thus, in addition to the known Drosophila STAT [12,13], Ag-STAT [28], two mosquito STATs [29] and shrimp STAT [48], this is another new member of the arthropod STAT family. In Drosophila, two STAT cDNA clones were isolated. The long form has an additional seven amino acids residues inserted at residue 698 near the carboxyl end of the SH2 domain [13]. However, the binding ability and transactivation potential of this isoform has not been characterized. In mammals, two isoforms, a long a form and a short b form, are found for STATs 1, 3, 4 and 5. For STATs 1, 3 and 4, they are generated by alternative splicing [49], while the a and b forms of STAT5 are formed due to protein processing [50].
ARTICLE IN PRESS Expression and characterization of two STAT isoforms from Sf9 cells The b form of the STAT 5 protein lacks the transactivation domain and becomes a naturally occurring dominantnegative regulator. In this study, we compared the partial genomic sequences from Sf9 cells with the sequences of two STAT transcripts and this indicated that they are generated by alternative splicing and encode two isoforms (Figure 2A). The unique C-terminal end of the short-form and long-form Sf-STAT contains 5 and 42 amino acid residues, respectively. We further provided evidence to show that they had similar DNA-binding ability toward mammalian STAT-binding motifs including the STAT3, STAT4 and STAT5 probes (Figure 4) and similar transactivation potential toward a Drosophila promoter containing a STAT-binding motif (Figure 5). Taken together, this is the first report to demonstrate the presence of two functional STAT transcripts in Sf9 cells. Both the isoforms of Sf-STAT were expressed using the baculovirus expression system, and the purified Sf-STATs are about 88 and 84 kDa, respectively, which is similar to the molecular masses predicted from the cDNA sequences (Figure 3C and F). Interestingly, the recombinant Sf-STATs are already tyrosine phosphorylated (Figure 3B and E). Similar results have been reported when the Sf9 cells are used as host cells for the baculovirus expression of vertebrate STATs. The expressed STATs were already tyrosine phosphorylated no matter whether coinfected with recombinant baculovirus encoding JAK kinases or not [19,35]. It is possible that a Sf9 homolog of the JAK kinase or other tyrosine kinase may be activated during baculovirus infection. The tyrosine phosphorylation of STATs has been shown to be essential for DNA-binding activity and the critical tyrosine phosphorylation sites of each mammalian STAT have been determined [51,52]. The sequence of the putative tyrosine phosphorylation site of Sf-STAT (689NGYVKP) is similar to that of human STAT5a (692DGYVKP) (Figure 1). The EMSA data showed that the Sf-STATs indeed bind to probes STAT3, STAT4 and STAT5 (Figure 4). The core sequences of these probes are TTCTGGGAA, TTCCCCGAA and TTCTAGGAA, respectively. These sequences resemble the consensus sequence described for human STAT5a and STAT5b, TTC(T/C)N(A/G)GAA, [44] and for Dm-STAT (TTCCCGGAA) [13]. In invertebrates, activation of the JAK–STAT pathway has been reported in an anti-microbial response of flies and mosquitoes upon bacterial infection [28,29,41]. Moreover, this pathway has been demonstrated to be required for an anti-viral response in Drosophila [30]. In the present study, we provided evidence to show that in AcMNPV-infected Sf9 cells, the binding of nuclear extracts to STAT5 probe was increased at 12 hpi and reached a maximum at 24 hpi (Figure 6). These results suggested that such an activation of Sf-STAT may be responsible for the anti-viral response in Sf9 cells. Such a conclusion has been made in Drosophila when the global transcriptional response in flies to infection with Drosophila C virus (DCV) was investigated [30]. A novel gene in Drosophila with an unknown function, virus-induced RNA 1 (vir-1), was up-regulated by DCV infection. A virusresponsive element in the vir-1 promoter has been identified to contain the STAT-binding motif, TTCTAAGAA. Mutation of this motif or use of a strain of Drosophila mutated in the JAK–STAT pathway significantly reduced the activity of vir-1 promoter upon DCV infection. The presence of vir-1 homolog in the genome of Sf9 cells and the existence of putative
823
STAT-binding motif in the promoter region of this gene needs further investigation.
Acknowledgments This research was supported by grants from the National Science Council, Taiwan, Republic of China. We are grateful to Dr. M. Yamaguchi for D-raf gene promoter plasmid constructs.
References [1] Kimbrell DA, Beutler B. The evolution and genetics of innate immunity. Nat Rev Genet 2001;2:256–67. [2] Iwanaga S, Lee BL. Recent advances in the innate immunity of invertebrate animals. J Biochem Mol Biol 2005;38:128–50. [3] Leclerc V, Reichhart JM. The immune response of Drosophila melanogaster. Immunol Rev 2004;198:59–71. [4] Kaneko T, Silverman N. Bacterial recognition and signalling by the Drosophila IMD pathway. Cell Microbiol 2005;7:461–9. [5] Hultmark D. Drosophila immunity: paths and patterns. Curr Opin Immunol 2003;15:12–9. [6] Khush RS, Leulier F, Lemaitre B. Drosophila immunity: two paths to NF-kappaB. Trends Immunol 2001;22:260–4. [7] Lemaitre B, Reichhart JM, Hoffmann JA. Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proc Natl Acad Sci USA 1997;94:14614–9. [8] Silverman N, Maniatis T. NF-kappaB signaling pathways in mammalian and insect innate immunity. Genes Dev 2001;15: 2321–42. [9] Tzou P, De Gregorio E, Lemaitre B. How Drosophila combats microbial infection: a model to study innate immunity and host–pathogen interactions. Curr Opin Microbiol 2002;5: 102–10. [10] Agaisse H, Petersen UM, Boutros M, Mathey-Prevot B, Perrimon N. Signaling role of hemocytes in Drosophila JAK/STATdependent response to septic injury. Dev Cell 2003;5:441–50. [11] Binari R, Perrimon N. Stripe-specific regulation of pair-rule genes by hopscotch, a putative Jak family tyrosine kinase in Drosophila. Genes Dev 1994;8:300–12. [12] Hou XS, Melnick MB, Perrimon N. Marelle acts downstream of the Drosophila HOP/JAK kinase and encodes a protein similar to the mammalian STATs. Cell 1996;84:411–9. [13] Yan R, Small S, Desplan C, Dearolf CR, Darnell JEJ. Identification of a Stat gene that functions in Drosophila development. Cell 1996;84:421–30. [14] Harrison DA, McCoon PE, Binari R, Gilman M, Perrimon N. Drosophila unpaired encodes a secreted protein that activates the JAK signaling pathway. Genes Dev 1998;12:3252–63. [15] Brown S, Hu N, Hombria JC. Identification of the first invertebrate interleukin JAK/STAT receptor, the Drosophila gene domeless. Curr Biol 2001;11:1700–5. [16] Karsten P, Hader S, Zeidler MP. Cloning and expression of Drosophila SOCS36E and its potential regulation by the JAK/ STAT pathway. Mech Dev 2002;117:343–6. [17] Rawlings JS, Rosler KM, Harrison DA. The JAK/STAT signaling pathway. J Cell Sci 2004;117:1281–3. [18] Betz A, Lampen N, Martinek S, Young MW, Darnell JEJ. A Drosophila PIAS homologue negatively regulates stat92E. Proc Natl Acad Sci USA 2001;98:9563–8. [19] Schindler C, Darnell JEJ. Transcriptional responses to polypeptide ligands: the JAK–STAT pathway. Annu Rev Biochem 1995; 64:621–51. [20] Ihle JN, Kerr IM. Jaks and Stats in signaling by the cytokine receptor superfamily. Trends Genet 1995;11:69–74.
ARTICLE IN PRESS 824 [21] Zeidler MP, Bach EA, Perrimon N. The roles of the Drosophila JAK/STAT pathway. Oncogene 2000;19:2598–606. [22] Kiger AA, Jones DL, Schulz C, Rogers MB, Fuller MT. Stem cell self-renewal specified by JAK–STAT activation in response to a support cell cue. Science 2001;294:2542–5. [23] Tulina N, Matunis E. Control of stem cell self-renewal in Drosophila spermatogenesis by JAK–STAT signaling. Science 2001;294:2546–9. [24] Hou SX, Zheng Z, Chen X, Perrimon N. The Jak/STAT pathway in model organisms: emerging roles in cell movement. Dev Cell 2002;3:765–78. [25] Hombria JC, Brown S. The fertile field of Drosophila Jak/STAT signalling. Curr Biol 2002;12:R569–75. [26] Wawersik M, Milutinovich A, Casper AL, Matunis E, Williams B, Van Doren M. Somatic control of germline sexual development is mediated by the JAK/STAT pathway. Nature 2005;436: 563–7. [27] Arbouzova NI, Zeidler MP. JAK/STAT signalling in Drosophila: insights into conserved regulatory and cellular functions. Development 2006;133:2605–16. [28] Barillas-Mury C, Han YS, Seeley D, Kafatos FC. Anopheles gambiae Ag-STAT, a new insect member of the STAT family, is activated in response to bacterial infection. EMBO J 1999;18: 959–67. [29] Lin CC, Chou CM, Hsu YL, Lien JC, Wang YM, Chen ST, et al. Characterization of two mosquito STATs, AaSTAT and CtSTAT. Differential regulation of tyrosine phosphorylation and DNA binding activity by lipopolysaccharide treatment and by Japanese encephalitis virus infection. J Biol Chem 2004;279: 3308–17. [30] Dostert C, Jouanguy E, Irving P, Troxler L, Galiana-Arnoux D, Hetru C, et al. The JAK–STAT signaling pathway is required but not sufficient for the antiviral response of Drosophila. Nat Immunol 2005;6:946–53. [31] Smith GE, Summers MD, Fraser MJ. Production of human beta interferon in insect cells infected with a baculovirus expression vector. Mol Cell Biol 1983;3:2156–65. [32] Cameron IR, Possee RD. Conservation of polyhedrin gene promoter function between Autographa californica and Mamestra brassicae nuclear polyhedrosis viruses. Virus Res 1989; 12:183–99. [33] Sliva D, Haldosen LA. STAT-like DNA-binding activity in Spodoptera frugiperda cells. Biochem Biophys Res Commun 1996;225:562–9. [34] Schindler U, Wu P, Rothe M, Brasseur M, McKnight SL. Components of a Stat recognition code: evidence for two layers of molecular selectivity. Immunity 1995;2:689–97. [35] John S, Vinkemeier U, Soldaini E, Darnell JEJ, Leonard WJ. The significance of tetramerization in promoter recruitment by Stat5. Mol Cell Biol 1999;19:1910–8. [36] Mullis KB, Faloona FA. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 1987; 155:335–50.
M.-S. Yeh et al. [37] Rogers JS, Swofford DL. A fast method for approximating maximum likelihoods of phylogenetic trees from nucleotide sequences. Syst Biol 1998;47:77–89. [38] Huang CJ, Huang FL, Chang GD, Chang YS, Lo TB. Studies on the structure and function of the carp gonadotropin alpha subunit by site-directed mutagenesis. Int J Pept Protein Res 1995;46:209–13. [39] Chang MS, Chang GD, Leu JH, Huang FL, Chou CK, Huang CJ, et al. Expression, characterization, and genomic structure of carp JAK1 kinase gene. DNA Cell Biol 1996;15:827–44. [40] Hong TH, Chen ST, Tang TK, Wang SC, Chang TH. The production of polyclonal and monoclonal antibodies in mice using novel immunization methods. J Immunol Methods 1989;120:151–7. [41] Kwon EJ, Park HS, Kim YS, Oh EJ, Nishida Y, Matsukage A, et al. Transcriptional regulation of the Drosophila raf proto-oncogene by Drosophila STAT during development and in immune response. J Biol Chem 2000;275:19824–30. [42] Weitzman MD, Possee RD, King LA. Characterization of two variants of Panolis flammea multiple nucleocapsid nuclear polyhedrosis virus. J Gen Virol 1992;73:1881–6. [43] Deryckere F, Gannon F. A one-hour minipreparation technique for extraction of DNA-binding proteins from animal tissues. Biotechniques 1994;16:405. [44] Ehret GB, Reichenbach P, Schindler U, Horvath CM, Fritz S, Nabholz M, et al. DNA binding specificity of different STAT proteins. Comparison of in vitro specificity with natural target sites. J Biol Chem 2001;276:6675–88. [45] Yan R, Luo H, Darnell JEJ, Dearolf CR. A JAK–STAT pathway regulates wing vein formation in Drosophila. Proc Natl Acad Sci USA 1996;93:5842–7. [46] Clarke TE, Clem RJ. Insect defenses against virus infection: the role of apoptosis. Int Rev Immunol 2003;22:401–24. [47] Clem RJ. The role of apoptosis in defense against baculovirus infection in insects. Curr Top Microbiol Immunol 2005;289: 113–29. [48] Liu WJ, Chang YS, Wang AH, Kou GH, Lo CF. White spot syndrome virus annexes a shrimp STAT to enhance expression of the immediate-early gene ie1. J Virol 2007;81:1461–71. [49] Bromberg J, Chen X. STAT proteins: signal tranducers and activators of transcription. Methods Enzymol 2001;333:138–51. [50] Azam M, Lee C, Strehlow I, Schindler C. Functionally distinct isoforms of STAT5 are generated by protein processing. Immunity 1997;6:691–701. [51] Gouilleux F, Wakao H, Mundt M, Groner B. Prolactin induces phosphorylation of Tyr694 of Stat5 (MGF), a prerequisite for DNA binding and induction of transcription. EMBO J 1994;13: 4361–9. [52] Quelle FW, Thierfelder W, Witthuhn BA, Tang B, Cohen S, Ihle JN. Phosphorylation and activation of the DNA binding activity of purified Stat1 by the Janus protein-tyrosine kinases and the epidermal growth factor receptor. J Biol Chem 1995;270: 20775–80.