- Email: [email protected]
Expression and evolutionary conservation of the tescalcin gene during development
Gene Expression Patterns 9 (2009) 273–281
Contents lists available at ScienceDirect
Gene Expression Patterns journal homepage: www.elsevier.com/locate/gep
Expression and evolutionary conservation of the tescalcin gene during development Yong Bao a,*, Quanah J. Hudson b, Erasmo M. Perera a, Leonardo Akan a, Stuart A. Tobet c, Craig A. Smith b, Andrew H. Sinclair b, Gary D. Berkovitz a a
Division of Pediatric Endocrinology, Department of Pediatrics, Miller School of Medicine, University of Miami, 1601 NW 12th Ave., Suite 3044A, Miami, FL 33136, USA Murdoch Children’s Research Institute and Department of Paediatrics, University of Melbourne, Royal Children’s Hospital, Parkville, Vic., Australia c Department of Biomedical Sciences, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, CO, USA b
a r t i c l e
i n f o
Article history: Received 30 April 2008 Received in revised form 20 March 2009 Accepted 25 March 2009 Available online 2 April 2009 Keywords: Tescalcin EF-hand calcium binding protein Mouse Embryogenesis Organogenesis Evolution Sex differentiation
a b s t r a c t The tescalcin gene (Tesc) encodes an EF-hand calcium-binding protein that interacts with the sodium/ hydrogen exchanger, NHE1. Previous studies indicated that Tesc was expressed in mouse embryonic testis, but not in ovary, during the critical period of testis and ovary determination. In this paper we compared the expression of Tesc in embryonic tissues of chicken and mouse. Tesc expression was sexually dimorphic in the embryonic gonads of both mouse and chicken. Tescalcin (TESC) was detected in both Sertoli cells and germ cells. In the embryonic brain of both mouse and chicken, Tesc was highly expressed in the nasal placode and in fibers extending from the olfactory epithelium to the primordial olfactory bulb. Tesc was expressed in the embryonic heart of both chicken and mouse. In mouse Tesc expression was also detected in embryonic adrenal. These studies indicate very specific expression of Tesc in various tissues in chicken and mouse during embryologic development, and conservation of Tesc expression in both species. Ó 2009 Elsevier B.V. All rights reserved.
1. Results and discussion The tescalcin gene (Tesc) encodes an EF-hand calcium binding protein that interacts with the Na+/H+ exchanger, NHE-1 (Mailander et al., 2001; Li et al., 2003, 2004; Zaun et al., 2008). Our previous work indicated that Tesc was expressed in embryonic testis during the critical period of testis determination, but was not present at any time in embryonic ovary (Perera et al., 2001). In this paper, we present evidence for evolutionary conservation of the Tesc gene, and compare the expression of Tesc during embryologic development in chicken and mouse. 1.1. Evolutionary conservation of the Tesc gene To investigate the evolutionary conservation of the Tesc gene, we identified the chicken orthologue by searching UMIST chicken EST database with the mouse Tesc sequence. Alignment analysis of TESC proteins from the human, mouse, cow, chicken, frog, and zebrafish indicated that the various orthologues of TESC are highly similar, with 44% of all residues being fully conserved in all sequences analyzed (Fig. 1). The similarity increased in pairwise analysis, never being less than 51% (chicken vs. zebrafish). As expected, the closest similarity was among mammalian TESCs (P96%) and the lowest between zebrafish TESC and TESC of other * Corresponding author. Tel.: +1 305 243 2920; fax: +1 305 243 6309. E-mail address: [email protected] (Y. Bao). 1567-133X/$ - see front matter Ó 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.gep.2009.03.004
species (51–56%). The amino acid sequences with the highest identity were those of human and cow (97% identity) (Table 1). The amino acid sequence of mouse TESC was very similar to human (96% identity), cow (96% identity), chicken (69% identity), frog (70% identity), and zebrafish (54% identity). The majority of all amino acid substitutions that have occurred in TESC orthologues have been conservative substitutions. Most TESCs have 214 amino acids except for zebrafish, which has 216 amino acids. An adjacent insertion of two amino acids (arginine–threonine) has occurred close to the N-terminal end in zebrafish. All TESCs analyzed conserve the N-terminal myristoylation motif as well as the consensus EF-hand domain (Kawasaki and Kretsinger, 1994). Within the EF-hand, all the critical residues involved in Ca2+ coordination have been conserved. A region of TESC close to the C-terminal end, amino acids 175–210, shows the highest degree of conservation (Fig. 1). 1.2. Expression of Tesc in the embryonic testis of mouse and chicken In mice, the primordial gonads of both sexes appear identical, and are termed the bipotential gonads. In eutherian mammals, testis determination is initiated by expression of the Sex-Determining Region Y (Sry) gene in the pre-Sertoli cells (Gubbay et al., 1990; Sinclair et al., 1990; Koopman et al., 1991) specifically at 10.5 days post-coitum (dpc) in the mouse (Koopman et al., 1990). Sertoli cell differentiation occurs between 11.5 dpc and 12.5 dpc (Karl and Capel, 1998; Schmahl et al., 2000), organizing into testis cords
274
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
Fig. 1. Cross-species TESC protein sequence alignment. Six TESCs from human to fish are aligned using DIALIGN. The GenBank accession numbers for tescalcins are: Mus musculus (NP_067319); Homo sapiens (AAH15221); Bos taurus (XP_586833); Xenopus laevis (AAH84830); Danio rerio (XP_684710); Gallus gallus (CAL64631). Positions that have a single, fully conserved residue are indicated by ‘’ below. The N-myristoylation (MGxxxS/T) and EF-hand (En**nn**nX*Y*ZG#Ix**zn**nn**n) consensus sequences (Kawasaki and Kretsinger, 1994) are aligned with TESC sequence counterparts. The double lines indicate the region of highest conservation. An EF-hand consensus sequence consists of 29 amino acids, which form a helix-loop-helix chain. Within the consensus there are six Ca2+ -coordinating residues represented by X, Y, Z, #, x, and z. The most common amino acids found in the positions designated by X, Y, Z, x, and z are serine (S), aspartate (D), asparagine (N), glutamate (E), and threonine (T), respectively. Position # can be any amino acid, that provides a carbonyl oxygen to coordinate the Ca2+ ion. The glycine (G) allows a bend in the EF-hand loop. Isoleucine (I) can be replaced by other hydrophobic residues, such as leucine (L) or valine (V). The two adjacent a-helices contain alternating hydrophobic (n) and hydrophilic () residues. The six Ca2+-coordinating residues have been conserved among all species.
surrounding the germ cells (Koopman et al., 1991). This coincides with the onset of anti-Mullerian hormone (AMH) expression in the pre-Sertoli cells (Munsterberg and Lovell-Badge, 1991). By 13.5 dpc testis cord formation is complete, and germ cell division has been arrested in mitosis (McLaren, 1988) (for review: Morrish and Sinclair, 2002; Ross and Capel, 2005). The bipotential gonad in chicken begins to form at embryonic day (E) 3.5 (Hamburger–Hamilton stage 20), and has two distinct regions: cortex (outer layer) and medulla (inner layer). The beginning of Amh expression in the medulla at E 5.5 (stage 28) may indicate the onset of Sertoli cell differentiation. Testis cord formation first becomes apparent at E 6.5 (stage 30) and is complete by E 7.5 (stage 32). By that time, the cortex has regressed to a thin layer of cells. By contrast, ovarian determination is characterized by proliferation of the cortex and regression of the medulla (Smith and Sinclair, 2004). In previous studies of mouse embryonic testis, we reported that Tesc expression began at 11.5 dpc, peaked at 14.5 dpc, declined
slightly by 15.5 dpc, and was constant thereafter (Perera et al., 2001). Using in situ hybridization we reported that Tesc expression was restricted to cells within testis cords. In the current study we investigated further the cellular localization of TESC in embryonic testis using immunocytochemistry. TESC was present in testis cords, but not in the myoid cells which form the outer layer of the cords (Fig. 2). Double staining of TESC and AMH indicated presence in both Sertoli cells and germ cells (Fig. 2A). When cells were counter stained with 40 ,60 -diamidino-2-phenylindole (DAPI), tescalcin appeared to be located primarily in cytoplasm (Fig. 2B). In studies of chicken embryonic gonad, we used whole mount in situ hybridization and immunocytochemistry to investigate cellular localization of TESC. At E 4.5, in situ hybridization studies indicated that Tesc mRNA was already present in the bipotential gonad (Fig. 3A and F). At E 5.5, Tesc expression was present in both the testis and ovary, but was higher in the testis (Fig. 3B and G). Tesc expression in the testis increased progressively from E 5.5 to E 7.5. Although Tesc mRNA was present in the ovary at these times,
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
Human (214 aa)
Cow (214 aa)
Chicken (214 aa)
Frog (214 aa)
Zebrafish (216 aa)
chicken, whereas it was not expressed in mouse until after testis determination. Tesc was also expressed to some extend in chicken embryonic ovary, but was not expressed in mouse embryonic ovary.
0.996 96%
0.989 96%
0.666 69%
0.677 70%
0.457 54%
1.3. Tesc expression in whole mouse and chicken embryos
1 97%
0.68 70%
0.696 71%
0.453 54%
0.668 69%
0.708 72%
0.452 53%
0.561 59%
0.422 51%
Table 1 Pairwise amino acid similarities of TESC from six different species.
Mouse (214 aa) Human (214 aa) Cow (214 aa) Chicken (214 aa) Frog (214 aa)
275
0.451 56%
Note: For each pairwise alignment, the similarity (relative to the maximum similarity) is indicated above and the number of identical amino acids (in % of shorter sequence) is indicated below. Similarity value 1.000 indicates the two most similar sequences, but does not necessarily means that these sequences are identical. The GenBank accession numbers for tescalcins are: Mouse [Mus musculus (NP_067319)]; Human [Homo sapiens (AAH15221)]; Cow [Bos taurus (XP_586833)]; Chicken [Gallus gallus (CAL64631)]; Frog [Xenopus laevis (AAH84830)]; Zebrafish [Danio rerio (XP_684710)]. Parentheses indicate the number of amino acids in TESC protein sequence.
Tesc expression in ovary was much less than in testis (Fig. 3C, D, H, and I). Tesc expression in the testis at E 8.5 was lower than it was at E 7.5, however expression in the testis continued to be greater than in the ovary (Fig. 3E and J). We performed immunocytochemistry of TESC in chicken embryonic testis and ovary at E 6.5 (Fig. 4A and C) and at E 9.5 (Fig. 4B and D). TESC was detected in testis cords (Fig. 4A and B). However at E 9.5 TESC was also detected at low levels in the interstitium in testis (Fig. 4B). At the subcellular level, TESC localized to both the nucleus and cytoplasm in the embryonic testis. In the ovary, TESC was present mostly in ovarian cortex (Fig. 4C and D), but was also detected in the medulla at E 9.5 (Fig. 4D). These data indicate sexually dimorphic expression of Tesc in the embryonic gonads of both mouse and chicken but with some notable differences. Tesc mRNA was present in the bipotential gonad in
Whole mount in situ hybridization of mouse embryo at 10.5 dpc (Fig. 5A) and 11.5 dpc (Fig. 5B) indicated Tesc expression in the brain, otic vesicle, and nasal placode. The expression was seen in the mesencephalon and nasal placode at 10.5 dpc (Fig. 5A), and by 11.5 dpc, the expression was throughout the head with strong signals in telencephalic and mesencephalic vesicles (Fig. 5B). The signals in the nasal placode and the region between the olfactory placode and the primordial olfactory bulb became intense at 11.5 dpc (Fig. 5B). Tesc expression was detected in the heart at both 10.5 dpc (Fig. 5A) and 11.5 dpc (Fig. 5B). In addition, signals were also detected in limb buds, and in a region inferior to the liver, that appeared to be the lumen of stomach at 11.5 dpc (Fig. 5B). Whole mount in situ hybridization in chicken at E 2.5 (Hamburger–Hamilton stage 17), E 3.0 (stage 19) and E 3.5 (stage 21) (Fig. 6) indicated expression of Tesc throughout the head, the signal being extremely intense in the region between the nasal placode and the olfactory bulb. Tesc expression was also apparent in the mesencephalon at E 2.5 (Fig. 6A), and by E 3.0 in the telencephalic vesicles as well (Fig. 6B). At E 3.5, the pattern of Tesc expression in the head was similar to that detected at E 3.0, except that the signal in the mesencephalon was absent, and a new signal was detected in the diencephalon (Fig. 6C). Whole mount in situ hybridization also indicated robust expression of Tesc in the heart and in the tail. Tesc mRNA was detected in the heart at E 2.5, E 3.0, and E 3.5. At E 3.0 and E 3.5, a signal was also detected in the branchial arches. With respect to expression of Tesc in the tail, it was evident in the tip of the tail at E 2.5 and at E 3.0, but was somewhat lower at E 3.5. The stage of gonadal development at 10.5 dpc in mouse embryo is very close to the stage of gonadal development in the chicken embryo at E 3.5. Both mouse and chicken embryos shared a significant similarity of the expression pattern of Tesc at this stage.
Fig. 2. Expression of Tesc in mouse embryonic testis and co-localization of TESC with AMH. Immunofluorescent analysis was performed on tissue sections from embryonic testis at 14.5 dpc. (A) Cross-section of a single testicular cord demonstrating that TESC (in green) co-localized with AMH (in red) in Sertoli cells. TESC was also present in germ cells. Myoid cells (non-visualized) were surrounding the cord and were not stained by TESC and AMH antibodies. The unstained space was the interstitium. (B) Cross-section of another testicular cord demonstrating that Tesc was expressed predominantly in cytoplasm when the nuclei were counter stained with DAPI (in blue). Myoid cell nuclei were visualized by DAPI staining (arrow heads).
276
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
Fig. 3. Expression of Tesc in chicken embryonic gonads. Whole mount in situ hybridization of chicken embryonic gonads was performed. The expression of Tesc was first seen at E 4.5 in both sexes (A and F). At E 5.5, Tesc was expressed with higher level in testis than in ovary (B and G). The high level of expression continued in testis at E 6.5 and 7.5 (C and D) and remained in low level in ovary (H and I). At E 8.5, the expression in testis was lower than in the previous days but still higher than in ovary (E and J). There is asymmetry of gonadal development in chicken. The left gonad is larger than the right gonad in both sexes at the onset of somatic differentiation. This difference is more prominent in female, in which only the left gonad develops into a functional ovary. This asymmetry is noted in the images of the right and left gonads of both sexes. The asymmetry is particularly notable in the female. Hamburger–Hamilton stages are shown in parentheses; g = gonad; scale bar = 500 lm.
Fig. 4. Immunofluorescent analysis of TESC on chicken embryonic gonads. TESC was detected in the testis cords (white arrowhead) at E 6.5 (A) and E 9.5 (B). There was a low level of expression in the interstitium (white hollow arrowhead) at E 9.5 (B). At the subcellular level, TESC was localized to both the nucleus and cytoplasm in the embryonic testis. In the chicken embryonic left ovary TESC was localized to the cortex (yellow arrowhead) at E 6.5 (C). Yellow hollow arrowhead indicates the medulla (C). At E 9.5 TESC was still mostly in the ovarian cortex (yellow arrowhead), with a few positive cells in the medulla (yellow hollow arrowhead) (D). Hamburger–Hamilton stages are shown in parentheses; scale bar = 100 lm.
1.4. Additional studies of Tesc expression in embryonic mouse Semi-quantitative RT-PCR of RNA from embryonic tissues of mice at 16.5 dpc indicated expression of Tesc in brain, heart, adrenal, kidney and lung, but not in liver or gut (Fig. 7). Using immunolabeling of TESC in sections of the whole mouse embryo at 12.5 dpc and 14.5 dpc (Fig. 8), the strongest signal was detected in testis (Fig. 8B and E). TESC was present in the brain,
notably in the olfactory epithelium and in olfactory fibers extending from the nasal placode to the primordial olfactory bulb (Fig. 8C and F). It was also detected in other areas of brain, particularly in the region of ventricular formation (Fig. 8F). To define further the expression of Tesc in brain, we used immunolabeling of TESC in vibratome sections (50 lm) at 14.5 dpc. Fibers that contained TESC projected to the primordial main and accessory olfactory bulbs (Fig. 9). Whereas there were a small
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
277
Fig. 5. Tesc expression in mouse embryos at 10.5 dpc and 11.5 dpc. Whole mount in situ hybridization analysis was performed on mouse embryos at 10.5 dpc (A) and 11.5 dpc (B). At 10.5 dpc, the expression was seen at low level in mesencephalic vesicle (MV) and nasal placode (NP) (A). At 11.5 dpc, the expression was detected throughout the head. The signals became more intense in the nasal placode (NP), fibers (arrowhead) between the nasal placode and primordial olfactory bulb (POB), and MV. The signals were also intense in telencephalic vesicle (TV), and the fourth ventricle (Hindbrain: HB) at this stage (B). The expression was also detected in the heart and the otic vesicle (OV) at both 10.5 dpc and 11.5 dpc, but only in forelimbs (FL), hindlimbs (HL), and the lumen of stomach (ST) at 11.5 dpc.
Fig. 6. Tesc expression during chicken embryogenesis. Whole mount in situ hybridization analysis was performed at Hamburger–Hamilton stage 17 (E 2.5), 19 (E 3.0) and 21 (E 3.5). A. At stage 17, the expression was detected at the tip of the tail (t), the heart (h) and throughout the head. There was an intense site of expression between the nasal placode and the primordial olfactory bulb (hollow arrow). B. At stage 19, the expression at the tip of the tail decreased (t). The expression in the heart (h) and between the nasal placode and olfactory bulb (hollow arrow) continued. There was an increased intensity at the telencephalic vesicles (tl). Staining was also seen at the branchial arches (b). C. At stage 21, expression in the head was still wide spread with a high level in the telencephalic vesicle (tl) and between the nasal placode and the olfactory bulb (hollow arrow). The mesencephalon (m) had lost the signal but a new signal was present at the diencephalon (d). The expression in the branchial arches and heart were still present. Embryonic days correspondent to the Hamburger–Hamilton stages are shown in parentheses; scale bar = 500 lm.
number of cells containing immunoreactive TESC in the basal forebrain caudal to the olfactory bulbs as well as in some cells in the anterior pituitary, there was no immunoreactive TESC in cells that synthesize gonadotropin-releasing hormone (GnRH) (data not shown). Tesc expression in the nasal compartment was in fibers that may guide GnRH neurons through the nasal compartment, but not along olfactory fiber projections that turn caudal in the forebrain to guide GnRH neurons to their final destinations (Tobet and Schwarting, 2006). The results of the semi-quantitative RT-PCR indicated that Tesc was expressed in the embryonic heart at 16.5 dpc (Fig. 7). Tesc expression was detected by whole mount in situ hybridization at
10.5 dpc and 11.5 dpc (Fig. 5). A signal was also detected in the embryonic heart at the 12.5 dpc and 14.5 dpc by anti-TESC antibody (Fig. 8D and G). Hence, Tesc mRNA was present in heart. However, we could not demonstrate unequivocally that heart contained TESC protein by immunocytochemistry because the signal could not be blocked by the purified recombinant TESC. Possible explanations are: (1) the expression in heart was sufficiently strong that could not be blocked by recombinant TESC, (2) an unknown protein very similar to TESC was present in the heart, (3) a non-specific binding. In time course studies in embryonic heart, Tesc expression was detected at the earliest time studied (10.5 dpc), with higher level at 12.5 dpc and thereafter (Fig. 10). As embryogenesis
278
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
A low level of Tesc expression in kidney was detected by RT-PCR at 16.5 dpc (Fig. 7). A signal was noticed at the pelvis region of kidney in the whole mount in situ hybridization studies (Fig. 11B) at 14.5 dpc and 15.5 dpc. However, this signal was not detected by immunocytochemistry indicating that the signal seen in the whole mount in situ hybridization studies was due to accumulation of dye within the lumen of the kidney pelvis. The lack of significant expression by immunocytochemistry suggested that TESC might not have a significant role in kidney. 2. Experimental procedures Fig. 7. Expression of Tesc in embryonic tissues in mouse. Semi-quantitative RT-PCR analysis of embryonic tissues at 16.5 dcp showed that Tesc was highly expressed in testis and adrenal gland. It was also in a low level in the heart, kidney, brain and lung, but not in liver or gut. GAPDH served as internal control. The RT-PCR was performed with (+) and without () reverse transcriptase (RT).
of heart begins at 8.5 dpc in mouse, and the right and left auricular appendages of the common atrial chamber are present by 10.5 dpc (Kaufman, 1992), our studies did not permit us to investigate whether Tesc was also expressed in the heart at the earliest stages of its development. The primordial adrenal is apparent at 11.0 dpc. Neural crest cells enter the adrenal gland at 12.0 dpc and form the adrenal medulla. Adrenal encapsulation occurs at 14.0 dpc (Keegan and Hammer, 2002). In time course studies of embryonic adrenal using semi-quantitative RT-PCR, Tesc expression was first detected at 14.5 dpc, and remained at constantly high levels in the embryonic adrenal thereafter (Fig. 11A). Whole mount in situ hybridization studies of the entire urogenital ridge confirmed the appearance of Tesc in the adrenal gland at 14.5 dpc (Fig. 11B). A strong signal was also detected in the adrenal gland at 14.5 dpc by immunocytochemistry (Fig. 11C). TESC was predominantly present in the cortex of the embryonic adrenal gland (Fig. 11C). These data indicate that Tesc expression is not present in the adrenal during the initial phases of differentiation, but rather begins late in development.
2.1. Animals Male and female CD1 outbred mice (Harlan Sprague Dawley Inc., Indianapolis, IN) were mated and noon on the day with the appearance of vaginal mucus plug was counted as 0.5 dpc. Embryos were collected between 10.5 dpc and 17.5 dpc. The sex of the embryos younger than 13.5 dpc was determined by PCR amplification of Sry. The PCR reactions were performed using standard condition with Sry specific primers (Y11A and Y11B) previously described by Jeske et al. (1995). Fertilized chicken eggs from an outbred strain produced from White Leghorn, Rhode Island Red and Australorp (Research Poultry Farm, Victoria, Australia) were incubated at 37.8 °C in a humidified incubator. The age of the embryo in embryonic days (E) was determined from the time they were placed in the incubator (E 0). Precise embryonic age was determined by staging according to Hamburger and Hamilton (1951). Embryos were collected between E 2.5 and E 8.5. The sex of embryos was determined by PCR using female-specific primers (Xho-1 and Xho-2) together with GAPDH control primers (GAP-1 and GAP-2) as described in Smith et al. (2003). 2.2. Cloning of chicken tescalcin cDNA A full-length chicken cDNA sequence (BX931037) with homology to mammalian Tesc was detected by a BLAST search of the
Fig. 8. Tesc expression in mouse embryo at 12.5 dpc and 14.5 dpc. Immunocytochemical analysis of TESC was performed on whole mouse embryos at 12.5 dpc (A) and 14.5 dpc (E, F, and G). A strong signal was detected in testis (B and E). TESC was present in the olfactory fibers extending from the nasal placode to the primordial olfactory bulb (black arrowhead in C and F). It was also detected in other areas of brain, particularly in the region of ventricular formation (yellow arrowhead in F). A signal was detected in the heart (D and G). However, the signal could not be blocked by purified recombinant TESC, suggesting the possibilities of strong expression of TESC, a TESC similar protein in the heart, or a non-specific binding. HB: hindbrain. LA: left atrium. Li: liver. Lu: lung. LV: left ventricle. Me: mesonephros. MV: mesencephalic vesicle. NC: nasal compartment. OB: olfactory bulb. OV: otic vesicle. ST: stomach. Te: testis. TV: telencephalic vesicle.
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
279
2.4. In situ hybridization Whole mount in situ hybridization experiments for mouse and chicken were performed as previously described by Perera et al. (2001) and Andrews et al. (1997). Mouse embryos were collected at 10.5 dpc and 11.5 dpc. The gonadal ridges attached with mesonephros were dissected from mouse embryos at 12.5 dpc and gonad, adrenal and kidney complexes were dissected at 13.5 dpc, 14.5 dpc, and 15.5 dpc. Chicken embryos and isolated urogenital systems were collected from E 2.5 to 8.6. The tissues were fixed in 4% paraformaldehyde in phosphate buffered saline (PBS) at 4 °C overnight and dehydrated in a series of ascending concentrations of methanol to final 100%. The samples were stored in 100% methanol at 20 °C before use. The digoxigenin-labeled antisense and sense riboprobes were generated from the mouse and the chicken full length Tesc cDNA clones using a DIG RNA labeling kit (SP6/T7) (Roche). The sense riboprobe was used for negative control. Fig. 9. Expression of Tesc in the olfactory fibers in mouse. Immunocytochemistry was performed on vibratome sections of 14.5 dpc mouse head. TESC appeared in the olfactory fibers that ended at the olfactory bulb. The black arrowheads indicate the TESC positive fibers in the nasal compartment. The red arrowheads indicate the TESC positive fibers converging on olfactory bulb. The yellow arrowheads indicate the fibers ending at the olfactory bulb without turning caudally in the forebrain. FB = forebrain; OB = olfactory bulb; NC = nasal compartment.
2.5. RNA extraction and semi-quantitative RT-PCR analysis Urogenital ridges, gonads, adrenal glands, kidney, liver, gut, heart and brain were dissected at different embryonic stages from mice. Total cellular RNA was extracted using TRIzol reagent (Invitrogen). The RNA was treated with RNase free DNase (Promega) to ensure that RNA was free of DNA contamination. Semi-quantitative RT-PCR was performed as previously described (Perera et al., 2001) using Tesc cDNA primers [C9-1F (50 -AGCCGACTCCTTTTCAAT GTGAG-30 ) and C9-1R (50 -CCTGACTATCATGTCCTACTTCC-30 )] and GAPDH primers [GAPDH50 (50 -ACCACAGTCCATGCCATCAC-30 ) and GAPDH30 (50 -TCCACCACCCTGTTGCTGTA-30 )]. 2.6. Immunocytochemistry
Fig. 10. Temporal expression of Tesc in embryonic heart in mouse. The time course was determined by semi-quantitative RT-PCR analysis. The expression was detected at the earliest time studied (10.5 dpc), peaked at 12.5 dpc and continued thereafter. The RT-PCR was performed with (+) and without () reverse transcriptase (RT). GAPDH served as internal control.
UMIST chicken EST database (Boardman et al., 2002). No other sequences with significant homology to Tesc were detected in the chicken genome, while the predicted chicken protein showed 69% identity and 85% similarity to mouse TESC suggesting that it is the orthologue of mouse TESC. The entire chicken Tesc coding sequence was PCR amplified from embryonic gonad chicken cDNA using sense primer cTesF (ATGGGCTCCGCGCAGTCC) and antisense primer cTesR (TCAGTAGCAGTGCGCGATGGC). The PCR product was cloned into pGEM-T Easy following the manufacturer’s instructions (Promega) and sequenced to confirm identity. 2.3. Cross-species TESC protein sequence analysis Multiple protein sequence alignments were performed using DIALIGN program (http://www.genomatix.de). Amino acid sequence of TESC from six different species: Mus musculus (NP_067319); Homo sapiens (AAH15221); Bos taurus (XP_586833); Gallus gallus (CAL64631); Xenopus laevis (AAH84830) and Danio rerio (XP_684710) were obtained from the National Center for Biotechnology Information (NCBI) protein database (http://www.ncbi.nlm. nih.gov/).
The whole mouse embryos and dissected organs were fixed in 4% paraformaldehyde in 0.1 M PBS at 4 °C overnight. The embryos and tissues were dehydrated in ethanol, paraffin embedded, and sectioned on Microtome (Leica Corp. Deerfield, IL) at 5 lm thickness. The paraffin sections were processed for immunocytochemistry using polyclonal TESC antibody. The polyclonal rabbit anti-mouse TESC antibody was raised against mouse recombinant TESC. The antibody was affinity-purified and tested for specificity by Western blot (Gutierrez-Ford et al., 2003). The paraffin sections were first deparaffinized, followed by preincubation with 5% normal goat serum in 2% (wt/vol) milk in PBS. The antibody against TESC was diluted 1:500 and incubated with the sections at 4 °C overnight. After the incubation, the sections were rinsed in PBS and subsequently incubated with biotinylated goat anti-rabbit IgG (Vector Lab). The sections were then treated with either streptavidin–biotin-alkaline phosphatase complex (DAKO Corp) or streptavidin–biotin-peroxidase complex (Vector Lab). The alkaline phosphatase activity was developed with Vector Red substrates (Vector Lab). The peroxidase activity was developed with Vector NovaRED substrates (Vector Lab). The endogenous alkaline phosphatase activity was inhibited by levamizole during the addition of Vector Red substrate and the endogenous peroxidase activity was inhibited by treatment with hydrogen peroxide prior to the incubation of primary antibody. In each experiment, negative control sections were incubated with TESC antibody neutralized by purified recombinant TESC protein. Immunocytochemistry of chicken embryonic gonads was performed using the polyclonal rabbit anti-mouse TESC antibody. To co-localize TESC and AMH, immunofluorescent double-labeling was performed in testis sections. The goat anti-human AMH antibody [MIS (C-20)] was obtained from Santa Cruz Biotechnology, Inc.
280
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
Fig. 11. Expression of Tesc in the embryonic adrenal gland in mouse. (A) Semi-quantitative RT-PCR analysis showed that Tesc is first detected at 14.5 dpc in adrenal gland and remained at constant high levels thereafter. The RT-PCR was performed with (+) and without () reverse transcriptase (RT). GAPDH served as internal control. (B) Whole mount in situ hybridization studies of the urogenital ridges confirmed the findings by RT-PCR. (C) Immunocytochemical analysis of TESC on the embryonic adrenal gland at 14.5 dpc indicated that TESC is predominantly localized in the cortex. A = adrenal; G = gonad; K = kidney; M = mesonephros.
The paraffin sections were deparaffinized and microwaved three times for 5 min in 0.01 M citric buffer, pH 6.0. After pretreatment with 5% goat and donkey serum in 2% (wt/vol) milk in PBS, the sections were incubated with the AMH antibody and TESC antibody at 4 °C overnight. After the incubation, the sections were rinsed in PBS followed by incubation with fluorescent labeled secondary antibodies. The Alexa Fluor 594 labeled donkey anti-goat IgG antibody (Molecular Probes, Inc.) was used for detection of AMH immunoreactive cells (red) and the Alexa Fluor 488 labeled goat anti-rabbit IgG antibody (Molecular Probes, Inc.) was used for detection of TESC immunoreactive cells (green). The nuclei of cells were counterstained with DAPI. In each experiment, negative controls were conducted using neutralized TESC antibody with purified recombinant TESC protein, and neutralized AMH antibody with the peptide used for raising the antibody. For the study of olfactory fibers, mouse embryos at 14.5 dpc were transcardially perfused with 4% paraformaldehyde in 0.1 M PBS. The heads and brains were postfixed in the same fixative for 6–24 h at 4 °C and then kept in 0.1 M PBS at 4 °C before sectioning. After they were embedded in 5% agarose, they were sectioned at 50-lm using a vibratome (VT1000S, Leica Corp., Deerfield, IL). The free floating immunocytochemistry experiments were performed as previously described (Heger et al., 2003). The final peroxidase activity was developed with 0.025% 3,30 -diaminobenzidine (DAB) enhanced by 0.2% nickel ammonium sulfate. Acknowledgements This work was supported by the Department of Pediatrics, Miller School of Medicine at University of Miami and the Murdoch Children’s Research Institute, Royal Children’s Hospital, Melbourne, Australia. References Andrews, J.E., Smith, C.A., Sinclair, A.H., 1997. Sites of estrogen receptor and aromatase expression in the chicken embryo. Gen. Comp. Endocrinol. 108, 182– 190.
Boardman, P.E., Sanz-Ezquerro, J., Overton, I.M., Burt, D.W., Bosch, E., Fong, W.T., Tickle, C., Brown, W.R.A., Wilson, S.A., Hubbard, S.J., 2002. A comprehensive collection of chicken cDNAs. Curr. Biol. 12, 1965–1969. Gubbay, J., Collignon, J., Koopman, P., Capel, B., Economou, A., Munsterberg, A., Vivian, N., Goodfellow, P., Lovell-Badge, R., 1990. A gene mapping to the sexdetermining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346, 245–250. Gutierrez-Ford, C., Levay, K., Gomes, A.V., Perera, E.M., Som, T., Kim, Y.-M., Benovic, J.L., Berkovitz, G.D., Slepak, V.Z., 2003. Characterization of tescalcin, a novel EFhand protein with a single Ca2+-binding site: metal-binding properties, localization in tissues and cells, and effect on calcineurin. Biochemistry 42, 14553–14565. Hamburger, V., Hamilton, H.L., 1951. A series of normal stages in the development of the chick embryo. J. Morphol. 88, 49–92. Heger, S., Seney, M., Bless, E., Schwarting, G.A., Bilger, M., Mungenast, A., Ojeda, S.R., Tobet, S.A., 2003. Overexpression of glutamic acid decarboxylase-67 (GAD-67) in gonadotropin-releasing hormone neurons disrupts migratory fate and female reproductive function in mice. Endocrinology 144, 2566–2579. Jeske, Y.W.A., Bowles, J., Greenfield, A., Koopman, P., 1995. Expression of a linear Sry transcript in the mouse genital ridge. Nature 10, 480–482. Karl, J., Capel, B., 1998. Sertoli cells of the mouse testis originate from the coelomic epithelium. Dev. Biol. 203, 323–333. Kaufman, M.H., 1992. The Atlas of Mouse Development. Academic Press, San Diego, CA. Kawasaki, H., Kretsinger, R.H., 1994. Calcium-binding proteins. I. EF-hands. Protein Profile 1, 343–517. Keegan, C.E., Hammer, G.D., 2002. Recent insights into organogenesis of the adrenal cortex. Trends Endocrinol. Metab. 13, 200–208. Koopman, P., Munsterberg, A., Capel, B., Vivian, N., Lovell-Badge, R., 1990. Expression of a candidate sex-determining gene during mouse testis differentiation. Nature 348, 450–452. Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P., Lovell-Badge, R., 1991. Male development of chromosomally female mice transgenic for Sry. Nature 351, 117–121. Li, X., Liu, Y., Kay, C.M., Muller-Esterl, W., Fliegel, L., 2003. The Na+/H+ exchanger cytoplasmic tail: structure, function, and interactions with tescalcin. Biochemistry 42, 7448–7456. Li, X., Ding, J., Liu, Y., Brix, B.J., Fliegel, L., 2004. Functional analysis of acidic amino acids in the cytosolic tail of the Na+/H+ exchanger. Biochemistry 43, 16477– 16486. Mailander, J., Muller-Esterl, W., Dedio, J., 2001. Human homolog of mouse tescalcin associates with Na(+)/H(+) exchanger type-1. FEBS Lett. 507, 331–335. McLaren, A., 1988. Somatic and germ-cell sex in mammals. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 322, 3–9. Morrish, B.C., Sinclair, A.H., 2002. Vertebrate sex determination: many means to an end. Reproduction 124, 447–457. Munsterberg, A., Lovell-Badge, R., 1991. Expression of the mouse anti-Mullerian hormone gene suggests a role in both male and female sexual differentiation. Development 113, 613–624.
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281 Perera, E.M., Martin, H., Seeherunvong, T., Kos, L., Hughes, I.A., Hawkins, J.R., Berkovitz, G.D., 2001. Tescalcin, a novel gene encoding a putative EF-hand Ca(2+)-binding protein, Col9a3, and renin are expressed in the mouse testis during the early stages of gonadal differentiation. Endocrinology 142, 455–463. Ross, A.J., Capel, B., 2005. Signaling at the crossroads of gonad development. Trends Endocrinol. Metab. 16, 19–25. Schmahl, J., Eicher, E.M., Washburn, L.L., Capel, B., 2000. Sry induces cell proliferation in the mouse gonad. Development 127, 65–73. Sinclair, A.H., Berta, P., Palmer, M.S., Hawkins, J.R., Griffiths, B.L., Smith, M.J., Foster, J.W., Frischauf, A.M., Lovell-Badge, R., Goodfellow, P.N., 1990. A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 346, 240–245.
281
Smith, C.A., Katz, M., Sinclair, A.H., 2003. DMRT1 is upregulated in the gonads during female-to-male sex reversal in ZW chicken embryos. Biol. Reprod. 68, 560–570. Smith, C.A., Sinclair, A.H., 2004. Sex determination: insights from the chicken. Bioassays 26, 120–132. Tobet, S.A., Schwarting, G.A., 2006. Minireview: recent progress in gonadotropin-releasing hormone neuronal migration. Endocrinology 147, 1159–1165. Zaun, H.C., Shrier, A., Orlowski, J., 2008. Calcineurin B-homologues protein 3 promotes the biosynthetic maturation, cell surface stability and optimal transport of Na+/H+ exchanger NHE1 isoform. J. Biol. Chem. 283, 12456– 12467.
Contents lists available at ScienceDirect
Gene Expression Patterns journal homepage: www.elsevier.com/locate/gep
Expression and evolutionary conservation of the tescalcin gene during development Yong Bao a,*, Quanah J. Hudson b, Erasmo M. Perera a, Leonardo Akan a, Stuart A. Tobet c, Craig A. Smith b, Andrew H. Sinclair b, Gary D. Berkovitz a a
Division of Pediatric Endocrinology, Department of Pediatrics, Miller School of Medicine, University of Miami, 1601 NW 12th Ave., Suite 3044A, Miami, FL 33136, USA Murdoch Children’s Research Institute and Department of Paediatrics, University of Melbourne, Royal Children’s Hospital, Parkville, Vic., Australia c Department of Biomedical Sciences, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, CO, USA b
a r t i c l e
i n f o
Article history: Received 30 April 2008 Received in revised form 20 March 2009 Accepted 25 March 2009 Available online 2 April 2009 Keywords: Tescalcin EF-hand calcium binding protein Mouse Embryogenesis Organogenesis Evolution Sex differentiation
a b s t r a c t The tescalcin gene (Tesc) encodes an EF-hand calcium-binding protein that interacts with the sodium/ hydrogen exchanger, NHE1. Previous studies indicated that Tesc was expressed in mouse embryonic testis, but not in ovary, during the critical period of testis and ovary determination. In this paper we compared the expression of Tesc in embryonic tissues of chicken and mouse. Tesc expression was sexually dimorphic in the embryonic gonads of both mouse and chicken. Tescalcin (TESC) was detected in both Sertoli cells and germ cells. In the embryonic brain of both mouse and chicken, Tesc was highly expressed in the nasal placode and in fibers extending from the olfactory epithelium to the primordial olfactory bulb. Tesc was expressed in the embryonic heart of both chicken and mouse. In mouse Tesc expression was also detected in embryonic adrenal. These studies indicate very specific expression of Tesc in various tissues in chicken and mouse during embryologic development, and conservation of Tesc expression in both species. Ó 2009 Elsevier B.V. All rights reserved.
1. Results and discussion The tescalcin gene (Tesc) encodes an EF-hand calcium binding protein that interacts with the Na+/H+ exchanger, NHE-1 (Mailander et al., 2001; Li et al., 2003, 2004; Zaun et al., 2008). Our previous work indicated that Tesc was expressed in embryonic testis during the critical period of testis determination, but was not present at any time in embryonic ovary (Perera et al., 2001). In this paper, we present evidence for evolutionary conservation of the Tesc gene, and compare the expression of Tesc during embryologic development in chicken and mouse. 1.1. Evolutionary conservation of the Tesc gene To investigate the evolutionary conservation of the Tesc gene, we identified the chicken orthologue by searching UMIST chicken EST database with the mouse Tesc sequence. Alignment analysis of TESC proteins from the human, mouse, cow, chicken, frog, and zebrafish indicated that the various orthologues of TESC are highly similar, with 44% of all residues being fully conserved in all sequences analyzed (Fig. 1). The similarity increased in pairwise analysis, never being less than 51% (chicken vs. zebrafish). As expected, the closest similarity was among mammalian TESCs (P96%) and the lowest between zebrafish TESC and TESC of other * Corresponding author. Tel.: +1 305 243 2920; fax: +1 305 243 6309. E-mail address: [email protected] (Y. Bao). 1567-133X/$ - see front matter Ó 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.gep.2009.03.004
species (51–56%). The amino acid sequences with the highest identity were those of human and cow (97% identity) (Table 1). The amino acid sequence of mouse TESC was very similar to human (96% identity), cow (96% identity), chicken (69% identity), frog (70% identity), and zebrafish (54% identity). The majority of all amino acid substitutions that have occurred in TESC orthologues have been conservative substitutions. Most TESCs have 214 amino acids except for zebrafish, which has 216 amino acids. An adjacent insertion of two amino acids (arginine–threonine) has occurred close to the N-terminal end in zebrafish. All TESCs analyzed conserve the N-terminal myristoylation motif as well as the consensus EF-hand domain (Kawasaki and Kretsinger, 1994). Within the EF-hand, all the critical residues involved in Ca2+ coordination have been conserved. A region of TESC close to the C-terminal end, amino acids 175–210, shows the highest degree of conservation (Fig. 1). 1.2. Expression of Tesc in the embryonic testis of mouse and chicken In mice, the primordial gonads of both sexes appear identical, and are termed the bipotential gonads. In eutherian mammals, testis determination is initiated by expression of the Sex-Determining Region Y (Sry) gene in the pre-Sertoli cells (Gubbay et al., 1990; Sinclair et al., 1990; Koopman et al., 1991) specifically at 10.5 days post-coitum (dpc) in the mouse (Koopman et al., 1990). Sertoli cell differentiation occurs between 11.5 dpc and 12.5 dpc (Karl and Capel, 1998; Schmahl et al., 2000), organizing into testis cords
274
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
Fig. 1. Cross-species TESC protein sequence alignment. Six TESCs from human to fish are aligned using DIALIGN. The GenBank accession numbers for tescalcins are: Mus musculus (NP_067319); Homo sapiens (AAH15221); Bos taurus (XP_586833); Xenopus laevis (AAH84830); Danio rerio (XP_684710); Gallus gallus (CAL64631). Positions that have a single, fully conserved residue are indicated by ‘’ below. The N-myristoylation (MGxxxS/T) and EF-hand (En**nn**nX*Y*ZG#Ix**zn**nn**n) consensus sequences (Kawasaki and Kretsinger, 1994) are aligned with TESC sequence counterparts. The double lines indicate the region of highest conservation. An EF-hand consensus sequence consists of 29 amino acids, which form a helix-loop-helix chain. Within the consensus there are six Ca2+ -coordinating residues represented by X, Y, Z, #, x, and z. The most common amino acids found in the positions designated by X, Y, Z, x, and z are serine (S), aspartate (D), asparagine (N), glutamate (E), and threonine (T), respectively. Position # can be any amino acid, that provides a carbonyl oxygen to coordinate the Ca2+ ion. The glycine (G) allows a bend in the EF-hand loop. Isoleucine (I) can be replaced by other hydrophobic residues, such as leucine (L) or valine (V). The two adjacent a-helices contain alternating hydrophobic (n) and hydrophilic () residues. The six Ca2+-coordinating residues have been conserved among all species.
surrounding the germ cells (Koopman et al., 1991). This coincides with the onset of anti-Mullerian hormone (AMH) expression in the pre-Sertoli cells (Munsterberg and Lovell-Badge, 1991). By 13.5 dpc testis cord formation is complete, and germ cell division has been arrested in mitosis (McLaren, 1988) (for review: Morrish and Sinclair, 2002; Ross and Capel, 2005). The bipotential gonad in chicken begins to form at embryonic day (E) 3.5 (Hamburger–Hamilton stage 20), and has two distinct regions: cortex (outer layer) and medulla (inner layer). The beginning of Amh expression in the medulla at E 5.5 (stage 28) may indicate the onset of Sertoli cell differentiation. Testis cord formation first becomes apparent at E 6.5 (stage 30) and is complete by E 7.5 (stage 32). By that time, the cortex has regressed to a thin layer of cells. By contrast, ovarian determination is characterized by proliferation of the cortex and regression of the medulla (Smith and Sinclair, 2004). In previous studies of mouse embryonic testis, we reported that Tesc expression began at 11.5 dpc, peaked at 14.5 dpc, declined
slightly by 15.5 dpc, and was constant thereafter (Perera et al., 2001). Using in situ hybridization we reported that Tesc expression was restricted to cells within testis cords. In the current study we investigated further the cellular localization of TESC in embryonic testis using immunocytochemistry. TESC was present in testis cords, but not in the myoid cells which form the outer layer of the cords (Fig. 2). Double staining of TESC and AMH indicated presence in both Sertoli cells and germ cells (Fig. 2A). When cells were counter stained with 40 ,60 -diamidino-2-phenylindole (DAPI), tescalcin appeared to be located primarily in cytoplasm (Fig. 2B). In studies of chicken embryonic gonad, we used whole mount in situ hybridization and immunocytochemistry to investigate cellular localization of TESC. At E 4.5, in situ hybridization studies indicated that Tesc mRNA was already present in the bipotential gonad (Fig. 3A and F). At E 5.5, Tesc expression was present in both the testis and ovary, but was higher in the testis (Fig. 3B and G). Tesc expression in the testis increased progressively from E 5.5 to E 7.5. Although Tesc mRNA was present in the ovary at these times,
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
Human (214 aa)
Cow (214 aa)
Chicken (214 aa)
Frog (214 aa)
Zebrafish (216 aa)
chicken, whereas it was not expressed in mouse until after testis determination. Tesc was also expressed to some extend in chicken embryonic ovary, but was not expressed in mouse embryonic ovary.
0.996 96%
0.989 96%
0.666 69%
0.677 70%
0.457 54%
1.3. Tesc expression in whole mouse and chicken embryos
1 97%
0.68 70%
0.696 71%
0.453 54%
0.668 69%
0.708 72%
0.452 53%
0.561 59%
0.422 51%
Table 1 Pairwise amino acid similarities of TESC from six different species.
Mouse (214 aa) Human (214 aa) Cow (214 aa) Chicken (214 aa) Frog (214 aa)
275
0.451 56%
Note: For each pairwise alignment, the similarity (relative to the maximum similarity) is indicated above and the number of identical amino acids (in % of shorter sequence) is indicated below. Similarity value 1.000 indicates the two most similar sequences, but does not necessarily means that these sequences are identical. The GenBank accession numbers for tescalcins are: Mouse [Mus musculus (NP_067319)]; Human [Homo sapiens (AAH15221)]; Cow [Bos taurus (XP_586833)]; Chicken [Gallus gallus (CAL64631)]; Frog [Xenopus laevis (AAH84830)]; Zebrafish [Danio rerio (XP_684710)]. Parentheses indicate the number of amino acids in TESC protein sequence.
Tesc expression in ovary was much less than in testis (Fig. 3C, D, H, and I). Tesc expression in the testis at E 8.5 was lower than it was at E 7.5, however expression in the testis continued to be greater than in the ovary (Fig. 3E and J). We performed immunocytochemistry of TESC in chicken embryonic testis and ovary at E 6.5 (Fig. 4A and C) and at E 9.5 (Fig. 4B and D). TESC was detected in testis cords (Fig. 4A and B). However at E 9.5 TESC was also detected at low levels in the interstitium in testis (Fig. 4B). At the subcellular level, TESC localized to both the nucleus and cytoplasm in the embryonic testis. In the ovary, TESC was present mostly in ovarian cortex (Fig. 4C and D), but was also detected in the medulla at E 9.5 (Fig. 4D). These data indicate sexually dimorphic expression of Tesc in the embryonic gonads of both mouse and chicken but with some notable differences. Tesc mRNA was present in the bipotential gonad in
Whole mount in situ hybridization of mouse embryo at 10.5 dpc (Fig. 5A) and 11.5 dpc (Fig. 5B) indicated Tesc expression in the brain, otic vesicle, and nasal placode. The expression was seen in the mesencephalon and nasal placode at 10.5 dpc (Fig. 5A), and by 11.5 dpc, the expression was throughout the head with strong signals in telencephalic and mesencephalic vesicles (Fig. 5B). The signals in the nasal placode and the region between the olfactory placode and the primordial olfactory bulb became intense at 11.5 dpc (Fig. 5B). Tesc expression was detected in the heart at both 10.5 dpc (Fig. 5A) and 11.5 dpc (Fig. 5B). In addition, signals were also detected in limb buds, and in a region inferior to the liver, that appeared to be the lumen of stomach at 11.5 dpc (Fig. 5B). Whole mount in situ hybridization in chicken at E 2.5 (Hamburger–Hamilton stage 17), E 3.0 (stage 19) and E 3.5 (stage 21) (Fig. 6) indicated expression of Tesc throughout the head, the signal being extremely intense in the region between the nasal placode and the olfactory bulb. Tesc expression was also apparent in the mesencephalon at E 2.5 (Fig. 6A), and by E 3.0 in the telencephalic vesicles as well (Fig. 6B). At E 3.5, the pattern of Tesc expression in the head was similar to that detected at E 3.0, except that the signal in the mesencephalon was absent, and a new signal was detected in the diencephalon (Fig. 6C). Whole mount in situ hybridization also indicated robust expression of Tesc in the heart and in the tail. Tesc mRNA was detected in the heart at E 2.5, E 3.0, and E 3.5. At E 3.0 and E 3.5, a signal was also detected in the branchial arches. With respect to expression of Tesc in the tail, it was evident in the tip of the tail at E 2.5 and at E 3.0, but was somewhat lower at E 3.5. The stage of gonadal development at 10.5 dpc in mouse embryo is very close to the stage of gonadal development in the chicken embryo at E 3.5. Both mouse and chicken embryos shared a significant similarity of the expression pattern of Tesc at this stage.
Fig. 2. Expression of Tesc in mouse embryonic testis and co-localization of TESC with AMH. Immunofluorescent analysis was performed on tissue sections from embryonic testis at 14.5 dpc. (A) Cross-section of a single testicular cord demonstrating that TESC (in green) co-localized with AMH (in red) in Sertoli cells. TESC was also present in germ cells. Myoid cells (non-visualized) were surrounding the cord and were not stained by TESC and AMH antibodies. The unstained space was the interstitium. (B) Cross-section of another testicular cord demonstrating that Tesc was expressed predominantly in cytoplasm when the nuclei were counter stained with DAPI (in blue). Myoid cell nuclei were visualized by DAPI staining (arrow heads).
276
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
Fig. 3. Expression of Tesc in chicken embryonic gonads. Whole mount in situ hybridization of chicken embryonic gonads was performed. The expression of Tesc was first seen at E 4.5 in both sexes (A and F). At E 5.5, Tesc was expressed with higher level in testis than in ovary (B and G). The high level of expression continued in testis at E 6.5 and 7.5 (C and D) and remained in low level in ovary (H and I). At E 8.5, the expression in testis was lower than in the previous days but still higher than in ovary (E and J). There is asymmetry of gonadal development in chicken. The left gonad is larger than the right gonad in both sexes at the onset of somatic differentiation. This difference is more prominent in female, in which only the left gonad develops into a functional ovary. This asymmetry is noted in the images of the right and left gonads of both sexes. The asymmetry is particularly notable in the female. Hamburger–Hamilton stages are shown in parentheses; g = gonad; scale bar = 500 lm.
Fig. 4. Immunofluorescent analysis of TESC on chicken embryonic gonads. TESC was detected in the testis cords (white arrowhead) at E 6.5 (A) and E 9.5 (B). There was a low level of expression in the interstitium (white hollow arrowhead) at E 9.5 (B). At the subcellular level, TESC was localized to both the nucleus and cytoplasm in the embryonic testis. In the chicken embryonic left ovary TESC was localized to the cortex (yellow arrowhead) at E 6.5 (C). Yellow hollow arrowhead indicates the medulla (C). At E 9.5 TESC was still mostly in the ovarian cortex (yellow arrowhead), with a few positive cells in the medulla (yellow hollow arrowhead) (D). Hamburger–Hamilton stages are shown in parentheses; scale bar = 100 lm.
1.4. Additional studies of Tesc expression in embryonic mouse Semi-quantitative RT-PCR of RNA from embryonic tissues of mice at 16.5 dpc indicated expression of Tesc in brain, heart, adrenal, kidney and lung, but not in liver or gut (Fig. 7). Using immunolabeling of TESC in sections of the whole mouse embryo at 12.5 dpc and 14.5 dpc (Fig. 8), the strongest signal was detected in testis (Fig. 8B and E). TESC was present in the brain,
notably in the olfactory epithelium and in olfactory fibers extending from the nasal placode to the primordial olfactory bulb (Fig. 8C and F). It was also detected in other areas of brain, particularly in the region of ventricular formation (Fig. 8F). To define further the expression of Tesc in brain, we used immunolabeling of TESC in vibratome sections (50 lm) at 14.5 dpc. Fibers that contained TESC projected to the primordial main and accessory olfactory bulbs (Fig. 9). Whereas there were a small
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
277
Fig. 5. Tesc expression in mouse embryos at 10.5 dpc and 11.5 dpc. Whole mount in situ hybridization analysis was performed on mouse embryos at 10.5 dpc (A) and 11.5 dpc (B). At 10.5 dpc, the expression was seen at low level in mesencephalic vesicle (MV) and nasal placode (NP) (A). At 11.5 dpc, the expression was detected throughout the head. The signals became more intense in the nasal placode (NP), fibers (arrowhead) between the nasal placode and primordial olfactory bulb (POB), and MV. The signals were also intense in telencephalic vesicle (TV), and the fourth ventricle (Hindbrain: HB) at this stage (B). The expression was also detected in the heart and the otic vesicle (OV) at both 10.5 dpc and 11.5 dpc, but only in forelimbs (FL), hindlimbs (HL), and the lumen of stomach (ST) at 11.5 dpc.
Fig. 6. Tesc expression during chicken embryogenesis. Whole mount in situ hybridization analysis was performed at Hamburger–Hamilton stage 17 (E 2.5), 19 (E 3.0) and 21 (E 3.5). A. At stage 17, the expression was detected at the tip of the tail (t), the heart (h) and throughout the head. There was an intense site of expression between the nasal placode and the primordial olfactory bulb (hollow arrow). B. At stage 19, the expression at the tip of the tail decreased (t). The expression in the heart (h) and between the nasal placode and olfactory bulb (hollow arrow) continued. There was an increased intensity at the telencephalic vesicles (tl). Staining was also seen at the branchial arches (b). C. At stage 21, expression in the head was still wide spread with a high level in the telencephalic vesicle (tl) and between the nasal placode and the olfactory bulb (hollow arrow). The mesencephalon (m) had lost the signal but a new signal was present at the diencephalon (d). The expression in the branchial arches and heart were still present. Embryonic days correspondent to the Hamburger–Hamilton stages are shown in parentheses; scale bar = 500 lm.
number of cells containing immunoreactive TESC in the basal forebrain caudal to the olfactory bulbs as well as in some cells in the anterior pituitary, there was no immunoreactive TESC in cells that synthesize gonadotropin-releasing hormone (GnRH) (data not shown). Tesc expression in the nasal compartment was in fibers that may guide GnRH neurons through the nasal compartment, but not along olfactory fiber projections that turn caudal in the forebrain to guide GnRH neurons to their final destinations (Tobet and Schwarting, 2006). The results of the semi-quantitative RT-PCR indicated that Tesc was expressed in the embryonic heart at 16.5 dpc (Fig. 7). Tesc expression was detected by whole mount in situ hybridization at
10.5 dpc and 11.5 dpc (Fig. 5). A signal was also detected in the embryonic heart at the 12.5 dpc and 14.5 dpc by anti-TESC antibody (Fig. 8D and G). Hence, Tesc mRNA was present in heart. However, we could not demonstrate unequivocally that heart contained TESC protein by immunocytochemistry because the signal could not be blocked by the purified recombinant TESC. Possible explanations are: (1) the expression in heart was sufficiently strong that could not be blocked by recombinant TESC, (2) an unknown protein very similar to TESC was present in the heart, (3) a non-specific binding. In time course studies in embryonic heart, Tesc expression was detected at the earliest time studied (10.5 dpc), with higher level at 12.5 dpc and thereafter (Fig. 10). As embryogenesis
278
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
A low level of Tesc expression in kidney was detected by RT-PCR at 16.5 dpc (Fig. 7). A signal was noticed at the pelvis region of kidney in the whole mount in situ hybridization studies (Fig. 11B) at 14.5 dpc and 15.5 dpc. However, this signal was not detected by immunocytochemistry indicating that the signal seen in the whole mount in situ hybridization studies was due to accumulation of dye within the lumen of the kidney pelvis. The lack of significant expression by immunocytochemistry suggested that TESC might not have a significant role in kidney. 2. Experimental procedures Fig. 7. Expression of Tesc in embryonic tissues in mouse. Semi-quantitative RT-PCR analysis of embryonic tissues at 16.5 dcp showed that Tesc was highly expressed in testis and adrenal gland. It was also in a low level in the heart, kidney, brain and lung, but not in liver or gut. GAPDH served as internal control. The RT-PCR was performed with (+) and without () reverse transcriptase (RT).
of heart begins at 8.5 dpc in mouse, and the right and left auricular appendages of the common atrial chamber are present by 10.5 dpc (Kaufman, 1992), our studies did not permit us to investigate whether Tesc was also expressed in the heart at the earliest stages of its development. The primordial adrenal is apparent at 11.0 dpc. Neural crest cells enter the adrenal gland at 12.0 dpc and form the adrenal medulla. Adrenal encapsulation occurs at 14.0 dpc (Keegan and Hammer, 2002). In time course studies of embryonic adrenal using semi-quantitative RT-PCR, Tesc expression was first detected at 14.5 dpc, and remained at constantly high levels in the embryonic adrenal thereafter (Fig. 11A). Whole mount in situ hybridization studies of the entire urogenital ridge confirmed the appearance of Tesc in the adrenal gland at 14.5 dpc (Fig. 11B). A strong signal was also detected in the adrenal gland at 14.5 dpc by immunocytochemistry (Fig. 11C). TESC was predominantly present in the cortex of the embryonic adrenal gland (Fig. 11C). These data indicate that Tesc expression is not present in the adrenal during the initial phases of differentiation, but rather begins late in development.
2.1. Animals Male and female CD1 outbred mice (Harlan Sprague Dawley Inc., Indianapolis, IN) were mated and noon on the day with the appearance of vaginal mucus plug was counted as 0.5 dpc. Embryos were collected between 10.5 dpc and 17.5 dpc. The sex of the embryos younger than 13.5 dpc was determined by PCR amplification of Sry. The PCR reactions were performed using standard condition with Sry specific primers (Y11A and Y11B) previously described by Jeske et al. (1995). Fertilized chicken eggs from an outbred strain produced from White Leghorn, Rhode Island Red and Australorp (Research Poultry Farm, Victoria, Australia) were incubated at 37.8 °C in a humidified incubator. The age of the embryo in embryonic days (E) was determined from the time they were placed in the incubator (E 0). Precise embryonic age was determined by staging according to Hamburger and Hamilton (1951). Embryos were collected between E 2.5 and E 8.5. The sex of embryos was determined by PCR using female-specific primers (Xho-1 and Xho-2) together with GAPDH control primers (GAP-1 and GAP-2) as described in Smith et al. (2003). 2.2. Cloning of chicken tescalcin cDNA A full-length chicken cDNA sequence (BX931037) with homology to mammalian Tesc was detected by a BLAST search of the
Fig. 8. Tesc expression in mouse embryo at 12.5 dpc and 14.5 dpc. Immunocytochemical analysis of TESC was performed on whole mouse embryos at 12.5 dpc (A) and 14.5 dpc (E, F, and G). A strong signal was detected in testis (B and E). TESC was present in the olfactory fibers extending from the nasal placode to the primordial olfactory bulb (black arrowhead in C and F). It was also detected in other areas of brain, particularly in the region of ventricular formation (yellow arrowhead in F). A signal was detected in the heart (D and G). However, the signal could not be blocked by purified recombinant TESC, suggesting the possibilities of strong expression of TESC, a TESC similar protein in the heart, or a non-specific binding. HB: hindbrain. LA: left atrium. Li: liver. Lu: lung. LV: left ventricle. Me: mesonephros. MV: mesencephalic vesicle. NC: nasal compartment. OB: olfactory bulb. OV: otic vesicle. ST: stomach. Te: testis. TV: telencephalic vesicle.
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
279
2.4. In situ hybridization Whole mount in situ hybridization experiments for mouse and chicken were performed as previously described by Perera et al. (2001) and Andrews et al. (1997). Mouse embryos were collected at 10.5 dpc and 11.5 dpc. The gonadal ridges attached with mesonephros were dissected from mouse embryos at 12.5 dpc and gonad, adrenal and kidney complexes were dissected at 13.5 dpc, 14.5 dpc, and 15.5 dpc. Chicken embryos and isolated urogenital systems were collected from E 2.5 to 8.6. The tissues were fixed in 4% paraformaldehyde in phosphate buffered saline (PBS) at 4 °C overnight and dehydrated in a series of ascending concentrations of methanol to final 100%. The samples were stored in 100% methanol at 20 °C before use. The digoxigenin-labeled antisense and sense riboprobes were generated from the mouse and the chicken full length Tesc cDNA clones using a DIG RNA labeling kit (SP6/T7) (Roche). The sense riboprobe was used for negative control. Fig. 9. Expression of Tesc in the olfactory fibers in mouse. Immunocytochemistry was performed on vibratome sections of 14.5 dpc mouse head. TESC appeared in the olfactory fibers that ended at the olfactory bulb. The black arrowheads indicate the TESC positive fibers in the nasal compartment. The red arrowheads indicate the TESC positive fibers converging on olfactory bulb. The yellow arrowheads indicate the fibers ending at the olfactory bulb without turning caudally in the forebrain. FB = forebrain; OB = olfactory bulb; NC = nasal compartment.
2.5. RNA extraction and semi-quantitative RT-PCR analysis Urogenital ridges, gonads, adrenal glands, kidney, liver, gut, heart and brain were dissected at different embryonic stages from mice. Total cellular RNA was extracted using TRIzol reagent (Invitrogen). The RNA was treated with RNase free DNase (Promega) to ensure that RNA was free of DNA contamination. Semi-quantitative RT-PCR was performed as previously described (Perera et al., 2001) using Tesc cDNA primers [C9-1F (50 -AGCCGACTCCTTTTCAAT GTGAG-30 ) and C9-1R (50 -CCTGACTATCATGTCCTACTTCC-30 )] and GAPDH primers [GAPDH50 (50 -ACCACAGTCCATGCCATCAC-30 ) and GAPDH30 (50 -TCCACCACCCTGTTGCTGTA-30 )]. 2.6. Immunocytochemistry
Fig. 10. Temporal expression of Tesc in embryonic heart in mouse. The time course was determined by semi-quantitative RT-PCR analysis. The expression was detected at the earliest time studied (10.5 dpc), peaked at 12.5 dpc and continued thereafter. The RT-PCR was performed with (+) and without () reverse transcriptase (RT). GAPDH served as internal control.
UMIST chicken EST database (Boardman et al., 2002). No other sequences with significant homology to Tesc were detected in the chicken genome, while the predicted chicken protein showed 69% identity and 85% similarity to mouse TESC suggesting that it is the orthologue of mouse TESC. The entire chicken Tesc coding sequence was PCR amplified from embryonic gonad chicken cDNA using sense primer cTesF (ATGGGCTCCGCGCAGTCC) and antisense primer cTesR (TCAGTAGCAGTGCGCGATGGC). The PCR product was cloned into pGEM-T Easy following the manufacturer’s instructions (Promega) and sequenced to confirm identity. 2.3. Cross-species TESC protein sequence analysis Multiple protein sequence alignments were performed using DIALIGN program (http://www.genomatix.de). Amino acid sequence of TESC from six different species: Mus musculus (NP_067319); Homo sapiens (AAH15221); Bos taurus (XP_586833); Gallus gallus (CAL64631); Xenopus laevis (AAH84830) and Danio rerio (XP_684710) were obtained from the National Center for Biotechnology Information (NCBI) protein database (http://www.ncbi.nlm. nih.gov/).
The whole mouse embryos and dissected organs were fixed in 4% paraformaldehyde in 0.1 M PBS at 4 °C overnight. The embryos and tissues were dehydrated in ethanol, paraffin embedded, and sectioned on Microtome (Leica Corp. Deerfield, IL) at 5 lm thickness. The paraffin sections were processed for immunocytochemistry using polyclonal TESC antibody. The polyclonal rabbit anti-mouse TESC antibody was raised against mouse recombinant TESC. The antibody was affinity-purified and tested for specificity by Western blot (Gutierrez-Ford et al., 2003). The paraffin sections were first deparaffinized, followed by preincubation with 5% normal goat serum in 2% (wt/vol) milk in PBS. The antibody against TESC was diluted 1:500 and incubated with the sections at 4 °C overnight. After the incubation, the sections were rinsed in PBS and subsequently incubated with biotinylated goat anti-rabbit IgG (Vector Lab). The sections were then treated with either streptavidin–biotin-alkaline phosphatase complex (DAKO Corp) or streptavidin–biotin-peroxidase complex (Vector Lab). The alkaline phosphatase activity was developed with Vector Red substrates (Vector Lab). The peroxidase activity was developed with Vector NovaRED substrates (Vector Lab). The endogenous alkaline phosphatase activity was inhibited by levamizole during the addition of Vector Red substrate and the endogenous peroxidase activity was inhibited by treatment with hydrogen peroxide prior to the incubation of primary antibody. In each experiment, negative control sections were incubated with TESC antibody neutralized by purified recombinant TESC protein. Immunocytochemistry of chicken embryonic gonads was performed using the polyclonal rabbit anti-mouse TESC antibody. To co-localize TESC and AMH, immunofluorescent double-labeling was performed in testis sections. The goat anti-human AMH antibody [MIS (C-20)] was obtained from Santa Cruz Biotechnology, Inc.
280
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281
Fig. 11. Expression of Tesc in the embryonic adrenal gland in mouse. (A) Semi-quantitative RT-PCR analysis showed that Tesc is first detected at 14.5 dpc in adrenal gland and remained at constant high levels thereafter. The RT-PCR was performed with (+) and without () reverse transcriptase (RT). GAPDH served as internal control. (B) Whole mount in situ hybridization studies of the urogenital ridges confirmed the findings by RT-PCR. (C) Immunocytochemical analysis of TESC on the embryonic adrenal gland at 14.5 dpc indicated that TESC is predominantly localized in the cortex. A = adrenal; G = gonad; K = kidney; M = mesonephros.
The paraffin sections were deparaffinized and microwaved three times for 5 min in 0.01 M citric buffer, pH 6.0. After pretreatment with 5% goat and donkey serum in 2% (wt/vol) milk in PBS, the sections were incubated with the AMH antibody and TESC antibody at 4 °C overnight. After the incubation, the sections were rinsed in PBS followed by incubation with fluorescent labeled secondary antibodies. The Alexa Fluor 594 labeled donkey anti-goat IgG antibody (Molecular Probes, Inc.) was used for detection of AMH immunoreactive cells (red) and the Alexa Fluor 488 labeled goat anti-rabbit IgG antibody (Molecular Probes, Inc.) was used for detection of TESC immunoreactive cells (green). The nuclei of cells were counterstained with DAPI. In each experiment, negative controls were conducted using neutralized TESC antibody with purified recombinant TESC protein, and neutralized AMH antibody with the peptide used for raising the antibody. For the study of olfactory fibers, mouse embryos at 14.5 dpc were transcardially perfused with 4% paraformaldehyde in 0.1 M PBS. The heads and brains were postfixed in the same fixative for 6–24 h at 4 °C and then kept in 0.1 M PBS at 4 °C before sectioning. After they were embedded in 5% agarose, they were sectioned at 50-lm using a vibratome (VT1000S, Leica Corp., Deerfield, IL). The free floating immunocytochemistry experiments were performed as previously described (Heger et al., 2003). The final peroxidase activity was developed with 0.025% 3,30 -diaminobenzidine (DAB) enhanced by 0.2% nickel ammonium sulfate. Acknowledgements This work was supported by the Department of Pediatrics, Miller School of Medicine at University of Miami and the Murdoch Children’s Research Institute, Royal Children’s Hospital, Melbourne, Australia. References Andrews, J.E., Smith, C.A., Sinclair, A.H., 1997. Sites of estrogen receptor and aromatase expression in the chicken embryo. Gen. Comp. Endocrinol. 108, 182– 190.
Boardman, P.E., Sanz-Ezquerro, J., Overton, I.M., Burt, D.W., Bosch, E., Fong, W.T., Tickle, C., Brown, W.R.A., Wilson, S.A., Hubbard, S.J., 2002. A comprehensive collection of chicken cDNAs. Curr. Biol. 12, 1965–1969. Gubbay, J., Collignon, J., Koopman, P., Capel, B., Economou, A., Munsterberg, A., Vivian, N., Goodfellow, P., Lovell-Badge, R., 1990. A gene mapping to the sexdetermining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346, 245–250. Gutierrez-Ford, C., Levay, K., Gomes, A.V., Perera, E.M., Som, T., Kim, Y.-M., Benovic, J.L., Berkovitz, G.D., Slepak, V.Z., 2003. Characterization of tescalcin, a novel EFhand protein with a single Ca2+-binding site: metal-binding properties, localization in tissues and cells, and effect on calcineurin. Biochemistry 42, 14553–14565. Hamburger, V., Hamilton, H.L., 1951. A series of normal stages in the development of the chick embryo. J. Morphol. 88, 49–92. Heger, S., Seney, M., Bless, E., Schwarting, G.A., Bilger, M., Mungenast, A., Ojeda, S.R., Tobet, S.A., 2003. Overexpression of glutamic acid decarboxylase-67 (GAD-67) in gonadotropin-releasing hormone neurons disrupts migratory fate and female reproductive function in mice. Endocrinology 144, 2566–2579. Jeske, Y.W.A., Bowles, J., Greenfield, A., Koopman, P., 1995. Expression of a linear Sry transcript in the mouse genital ridge. Nature 10, 480–482. Karl, J., Capel, B., 1998. Sertoli cells of the mouse testis originate from the coelomic epithelium. Dev. Biol. 203, 323–333. Kaufman, M.H., 1992. The Atlas of Mouse Development. Academic Press, San Diego, CA. Kawasaki, H., Kretsinger, R.H., 1994. Calcium-binding proteins. I. EF-hands. Protein Profile 1, 343–517. Keegan, C.E., Hammer, G.D., 2002. Recent insights into organogenesis of the adrenal cortex. Trends Endocrinol. Metab. 13, 200–208. Koopman, P., Munsterberg, A., Capel, B., Vivian, N., Lovell-Badge, R., 1990. Expression of a candidate sex-determining gene during mouse testis differentiation. Nature 348, 450–452. Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P., Lovell-Badge, R., 1991. Male development of chromosomally female mice transgenic for Sry. Nature 351, 117–121. Li, X., Liu, Y., Kay, C.M., Muller-Esterl, W., Fliegel, L., 2003. The Na+/H+ exchanger cytoplasmic tail: structure, function, and interactions with tescalcin. Biochemistry 42, 7448–7456. Li, X., Ding, J., Liu, Y., Brix, B.J., Fliegel, L., 2004. Functional analysis of acidic amino acids in the cytosolic tail of the Na+/H+ exchanger. Biochemistry 43, 16477– 16486. Mailander, J., Muller-Esterl, W., Dedio, J., 2001. Human homolog of mouse tescalcin associates with Na(+)/H(+) exchanger type-1. FEBS Lett. 507, 331–335. McLaren, A., 1988. Somatic and germ-cell sex in mammals. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 322, 3–9. Morrish, B.C., Sinclair, A.H., 2002. Vertebrate sex determination: many means to an end. Reproduction 124, 447–457. Munsterberg, A., Lovell-Badge, R., 1991. Expression of the mouse anti-Mullerian hormone gene suggests a role in both male and female sexual differentiation. Development 113, 613–624.
Y. Bao et al. / Gene Expression Patterns 9 (2009) 273–281 Perera, E.M., Martin, H., Seeherunvong, T., Kos, L., Hughes, I.A., Hawkins, J.R., Berkovitz, G.D., 2001. Tescalcin, a novel gene encoding a putative EF-hand Ca(2+)-binding protein, Col9a3, and renin are expressed in the mouse testis during the early stages of gonadal differentiation. Endocrinology 142, 455–463. Ross, A.J., Capel, B., 2005. Signaling at the crossroads of gonad development. Trends Endocrinol. Metab. 16, 19–25. Schmahl, J., Eicher, E.M., Washburn, L.L., Capel, B., 2000. Sry induces cell proliferation in the mouse gonad. Development 127, 65–73. Sinclair, A.H., Berta, P., Palmer, M.S., Hawkins, J.R., Griffiths, B.L., Smith, M.J., Foster, J.W., Frischauf, A.M., Lovell-Badge, R., Goodfellow, P.N., 1990. A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 346, 240–245.
281
Smith, C.A., Katz, M., Sinclair, A.H., 2003. DMRT1 is upregulated in the gonads during female-to-male sex reversal in ZW chicken embryos. Biol. Reprod. 68, 560–570. Smith, C.A., Sinclair, A.H., 2004. Sex determination: insights from the chicken. Bioassays 26, 120–132. Tobet, S.A., Schwarting, G.A., 2006. Minireview: recent progress in gonadotropin-releasing hormone neuronal migration. Endocrinology 147, 1159–1165. Zaun, H.C., Shrier, A., Orlowski, J., 2008. Calcineurin B-homologues protein 3 promotes the biosynthetic maturation, cell surface stability and optimal transport of Na+/H+ exchanger NHE1 isoform. J. Biol. Chem. 283, 12456– 12467.