Expression and functional role of bone morphogenetic proteins (BMPs) in placenta during different stages of pregnancy in water buffalo (Bubalus bubalis)

General and Comparative Endocrinology 285 (2020) 113249

Contents lists available at ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Expression and functional role of bone morphogenetic proteins (BMPs) in placenta during different stages of pregnancy in water buffalo (Bubalus bubalis)

T

Sheelendra Kumar1, H. Lakshmi Devi1, N. Singh Jalmeria, M. Punetha, Yogesh Pandey, ⁎ H.A. Samad, G. Singh, M. Sarkar, V.S. Chouhan Physiology & Climatology, Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar Pradesh 243122, India

A R T I C LE I N FO

A B S T R A C T

Keywords: Placenta Growth factors Caruncle Cotyledons BMP PCNA BAX

The objective of this study was to document the expression and functional role of BMPs in the placental (caruncle; CAR, cotyledon; COT) during different stages of pregnancy in water buffalo. Samples collected from Early pregnancy 1 (EP1); Early pregnancy 2 (EP2), Mid pregnancy (MP), Late pregnancy (LP) while the third stage of oestrus cycle (NP) was taken as control. Also, the synergistic role of BMP4/BMP7 or combination on mRNA expression of vWF, PCNA, StAR, CYP11A1, 3βHSD, and BAX were studied in trophoblast cells cultured (TCC) during an early stage. The qPCR and immunoblotting studies revealed that BMP2, BMPR1A, BMPR1B, and BMPR2 mRNA level was significantly (p < 0.05) upregulated during early pregnancy in COTs while in CARs it was significantly upregulated (p < 0.05) during all the stages of pregnancy.BMP4 mRNA level was significantly upregulated (p < 0.05) during early pregnancy in COTs as well as in CARs. BMP6 expression was significantly upregulated (p < 0.05) during early and late stages of pregnancy. BMP7 mRNA level was upregulated (p < 0.05) during the late stage of pregnancy in COTs. At 100 ng/ml, the BMP4 maximally stimulated the transcripts of StAR, CYP11A1, and 3βHSD while BMP7 maximally stimulated the transcripts of 3βHSD that paralleled with P4 accretion in the media (P < 0.05). BMP4 as well as BMP7 upregulated the transcripts of PCNA, vWF, and downregulated BAX in the TCC (P < 0.05). In conclusion, BMPs are expressed in a regulated manner with stage-specific differences in the placenta and promotes the angiogenesis, proliferation, cell survivability, and steroidogenesis thereby regulating placental function in an autocrine/paracrine manner in water buffalo.

1. Introduction The domestic water buffalo (Bubalus bubalis) is a large bovine animal, frequently used for milk, meat, and draught purposes. Asia is the home of water buffaloes, with more than 85% of buffaloes in only three countries of south and East Asia. There are 194.2 million head of buffaloes in the world, of which 110.0 million is in India (FAOSTAT, 2014). In mammals, most embryonic loss (> 30% of fertilized ova in most mammalian species and perhaps over 50% in humans) occurs during early pregnancy (Short et al., 1984). In buffalo species, embryonic mortality is considered as one of the major causes of fertility loss, especially in the animals that are not mated during their reproductive period (Campanile et al., 2007). Reduced placental vascular development and increased vascular resistance during early pregnancy

have been associated with early embryonic mortality (Grazul-Bilska et al., 2014). During early pregnancy, extensive angiogenesis in maternal and fetal placental tissues are accompanied with a substantial increase in uterine and umbilical blood flows to support the same (Grazul-Bilska et al., 2011; Grazul-Bilska et al., 2013). The placenta is the organ through which nutrients, respiratory gases, and wastes are exchanged between the maternal and fetal systems. The efficiency of placental exchange is closely related to fetal weight, placental size, and uterine and umbilical blood flows during normal pregnancies in many mammalian species (Ramsey, 1982; Faber and Thornburg, 1983; Magness, 1998). At the cellular interface, the rates of placental blood flow are dependent on placental vascularization so that placental angiogenesis is critical for the successful development of viable and healthy offspring (Reynolds and Redmer, 2001).

⁎

Corresponding author. E-mail address: [email protected] (V.S. Chouhan). 1 Authors equal contribution. https://doi.org/10.1016/j.ygcen.2019.113249 Received 9 March 2019; Received in revised form 9 August 2019; Accepted 20 August 2019 Available online 21 August 2019 0016-6480/ © 2019 Elsevier Inc. All rights reserved.

General and Comparative Endocrinology 285 (2020) 113249

S. Kumar, et al.

pregnancy was ascertained by the curved crown-rump formula: Y = 28.66 + 4.496 X, where Y is the age in days, and X is the crownrump length (CRL) in centimeters (Soliman, 1975). Samples from each stage of pregnancy was collected, Early pregnancy 1 (EP1; day 28th–45th, n = 6); Early pregnancy 2 (EP2; day 46th–90th, n = 6); Mid pregnancy, (MP; day 91th–180th, n = 6) and Late pregnancy (LP; day 181th to till parturition, n = 6). The non-gravid uterus at the third stage of the oestrus cycle (NP; day11th–16th, n = 6) was treated as control (Chouhan et al., 2013). Placental tissue was snap-frozen in liquid nitrogen and stored at −80 °C until RNA and protein isolation.

Vascular density of maternal placental tissues continues to increase slowly throughout gestation (Stegeman, 1974), but the vascular density of the fetal placental COTs remains relatively constant through midgestation and increases dramatically during the last third of gestation in association with fetal growth (Reynolds and Redmer, 2001; Stegeman, 1974). Placental vascularization is initiated, and established early in pregnancy; and supports early embryonic survival, and subsequent fetal growth and development (Grazul-Bilska et al., 2011; Grazul-Bilska et al., 2013). Placental angiogenesis is tightly regulated by various angiogenic growth factors like vascular endothelial growth factor VEGF (Leung et al., 1989); fibroblast growth factor-2 (Gospodarowicz et al., 1987), placental like growth factors PIGF (Maglione et al., 1991), TGF-β1 (Derynck et al., 1985), leptin (Zheng et al., 1999), angiopoietins (Sato et al., 1995) and BMPs (Fujiwara et al., 2001). Bone morphogenetic proteins (BMPs) are a family of highly conserved, multifunctional growth factors belonging to transforming growth factor (TGF-β) family. Over 20 members of BMPs with varying functions such as embryogenesis, skeletal formation, hematopoiesis, and neurogenesis have been identified in human. BMPs stimulate the target cells by specific membrane-bound receptors and signal transduced through mothers against decapentaplegic (Smads) and mitogen-activated protein kinase (MAPK) pathways (Jian et al., 2015). It has been demonstrated that BMP-2, BMP-4, BMP-6, BMP-7, and BMP-9 play an important role in bone formation (Jian et al., 2015). BMP-2 and 4 regulate trophoblast lineage development and differentiation and induce trophoblast development from human embryonic stem cells (Xu et al., 2002; Schulz et al., 2008). In cattle, BMP4 supplementation improves the formation of trophoblast cell outgrowths from blastocysts (Suzuki et al., 2011), and trophoblast cell lines generated from these outgrowths produced a multitude of factors, including interferon-tau (IFNT). IFN-τ is the maternal recognition of pregnancy factor in ruminants that are secreted from mononucleated cells (MNCs) before placental attachment to the uterine lining (Thakur et al., 2017). In mouse embryos, the expression of BMP-4 in the epiblast-derived tissues has been implicated in the development of the vascular connection between the placenta and embryo (Fujiwara et al., 2001). The effect of BMPs and their functional role in corpus luteum and follicles of buffaloes have been reported (Rajesh et al., 2018), and treatment of primary luteal cells with BMPs in-vitro confirmed the presence of functional receptors that stimulated the P4 production and luteal cell survival (Rajesh et al., 2016). Except for few reports in mouse (Ozkaynak et al., 1997), human (Martinovic et al., 1996) and in bovine (Pennington and Ealy, 2012), limited study has been conducted relating to the modulatory role of BMPs in the control of placental development and function in the species mentioned above. To the best of our knowledge, no studies have been reported in this direction in buffaloes. Given their role in controlling placental function as evident in other species studied so far, BMP system (BMP and BMP receptors) is hypothesized that locally produced BMPs are involved in the regulation of placental function in water buffalo. To test this hypothesis, we evaluated (a) messenger RNA (mRNA) and protein expression and its receptors in placental compartment of bubaline species during different stages of pregnancy and (b) the in vitro effects of BMP4 and BMP7 or in combination on P4 secretion, steroidogenesis, placental angiogenesis, and survivability of trophoblast cells.

2.2. Trophoblast cell culture For evaluation of the effects of the BMP4 and BMP7 in trophoblast cell function, a trophoblast cell culture model was developed with cells isolated from fresh pregnant uteri. Four pregnant uteri (45–60 days of pregnancy) were collected from a local abattoir and transported back to the laboratory in 1× PBS at 37 °C temperature in a vacuum flask. The uteri were opened, and the placentomes were exposed under laminar flow. The fetal COTs of six placentomes per uterus were separated from the maternal CAR manually. After washing in phosphate-buffered saline (1× PBS) three times, COTs were cut into small pieces to obtain a cellular homogenate. The homogenate derived from each animal was pooled, and three disaggregation methods were applied in parallel, mechanical fragmentation with a Teflon mesh (150 grade), enzymatic disaggregation by 0.05% collagenase I type 1A (C-0130; Sigma-Aldrich) for 40 min. After enzymatic digestion, inactivation of the enzymes was carried out by centrifugation and washing (for collagenase) or by adding 15% FCS solution (for trypsin). Then, the tissue was washed with Dulbecco’s modified eagle medium (Cat #: CC3021.05L; Lot #:34316008; Cell clone, Genetix), and serially filtered through 100 mesh/in. stainless steel screens (Sigma) to remove undigested tissue. The filtrate was diluted in DMEM/F12 medium (Cat #: CC3021.05L; Lot #:34316008; Cell clone, Genetix); supplemented with 15% FCS (Cellclone, Genetix) and Antibiotic-Antimycotic solution (penicillin G100 IU/ml, streptomycin 100 mg/ml, amphotericin 0.25 mg/ml, SV30079.01; HyClone; Thermo Scientific). Then the cells consisting of TGC and a low percentage of fibroblastoid cells (< 10%) were washed and resuspended in the same culture medium. Cells from each disaggregation method were again pooled and seeded onto polystyrene dishes at an initial density of 8,000,000 cells/ml. Subsequently, the dishes were placed in an incubator at 38.5 °C with 5% CO2 atmosphere and 100% relative humidity. Trophoblast cells counting was done by hemocytometer and Cell viability was determined by trypan blue exclusion dye (T8154; Sigma-Aldrich), and it was > 90%. 1–1.5 × 105 cells per ml were seeded in 12 wells culture plate (total volume: 1 ml containing 15% fetal bovine serum (Sigma-Aldrich) and Antibiotic-Antimycotic solution as above. Subsequently, the culture plates were placed in a humified CO2 (5%) incubator at 38.5 °C. The cells were allowed to attach and grow (70%–75% confluent) for 48 h, and thereafter, the media was replaced with fresh media containing different concentrations (1, 10, and 100 ng/ml) of BMP4 and BMP7 separately and were maintained for 24, 48 and 72 h time interval. The doses of the BMP4 and BMP7 were selected based on the earlier report (Rajesh et al., 2016). Control cells were grown in media without BMPs. Each treatment was tested in triplicate wells in each experiment. Cells were harvested for the m-RNA isolation and gene expression analysis of StAR, 3βHSD, CYP11A1, CYP19A1, PCNA, BAX, and vWF.

2. Material and methods 2.1. Collection of placentomes

2.3. Primers Entire reproductive tract of water buffaloes was collected from a local slaughterhouse immediately after slaughter and was transported on ice to the laboratory. Both maternal CARs (CARs) and fetal COTs (COTs) were collected from each stage of pregnancy. The stage of the

To amplify the genes, a set of gene-specific primers were designed from the published sequence and for primer design by DNASTAR software was used. Details of the primers used are given in Table 1. 2

General and Comparative Endocrinology 285 (2020) 113249

S. Kumar, et al.

Table 1 Details of the primers used in qPCR studies of cotyledons and caruncles for the following examined factors. Gene

Sequence of nucleotide (5′–3′)

Efficiency (%)

Amplicon length (bp)

EMBL accession No. or reference

BMP2

Forward: AAGGCCCTTGCTTGTCACTTT Reverse: TGCTTGCCGCTTTTCTCTTC Forward: TTTATGAGGTTATGAAGCCCCCGGC Reverse: AGTTTCCCACCGCGTCACATTGTG Forward: GGCCCCGTTAACTCGACTGTGACAA Reverse: TTGAGGACGCCGAACAAAACAGGA Forward: GGCAGGACTGGATCATCG Reverse: GAGCACAGAGATGGCATTGA Forward: TCAGCGAACTATTGCCAAACAG Reverse: CCCATCCACACTTCTCCGTATC Forward: TGGATGTCTAGGACTAGAAGGCTC Reverse: CAAAATCTCTGTTTTTCAGCGGA Forward: AACACCACTCAGTCCACCTC Reverse: GTCAGCATCCTATATCCAAAGCA Forward: CTGCGTGGATTAACCAGGTTCG Reverse: CCAGCTCTTGGTCGCTGTAGAG Forward: GGATCATCTGCCTGTTGGTGGA Reverse: GTGGATGACCACTGAGGTGC Forward: AGTTCGAGGGATCCTACCCAGA Reverse: AGCCATCACCTCCGTGTTCAG Forward: TCTGACGGCAACTTCAACTG Reverse: AAGTAGGAGAGGAGGCCGTC Forward: ACCTGCAGAGCATGGACTCGTC Reverse: CATGCTGGTGAGGTTCACGCCCA Forward: ATCGTAGGGGACTTCCAAGGTGG Reverse: CGGTCTCCAGGTATAGCCCTCTGG Forward: GCGATACTCACTCTTCTACTTTCGA Reverse: TCGTACCAGGAAATGAGCTTGAC

102.3

73

NM_001099141.1

104.2

104

NM_001045877.1

101.2

108

XM_600972.2

99.7

191

NM_001206015.1

103.6

75

NM_001076800.1

98.9

149

NM_001 1 05328.1

100.7

120

NM_001304285.1

95.1

84

NM_174189.2

91

191

NM_174343.2

95.7

146

NM_176644.2

97.7

250

NM_173894.1

93.3

160

NM_001034494.1

101.9

154

NM_001205308. 1

94.7

82

U85042.1

BMP4 BMP6 BMP7 BMPR1A BMPR1B BMPR2 StAR 3βHSD CYP11A1 BAX PCNA vWF GAPDH

Abbreviations: BMP, Bone Morphogenetic Protein; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; StAR, Steroidogenic acute regulatory protein; 3βHSD, 3beta hydroxysteroid dehydrogenase; CYP11A1, Cytochrome P450 family 11 subfamily A member 1; CYP19A1, Cytochrome P450 family 19 subfamily A member 1; PCNA, Proliferating cell nuclear antigen; vWF, Von willebrand factor. EMBL, European molecular biology laboratory.

of the real-time machine (Bio-rad CFX manager Real-Time QPCR tm software) qPCR efficiencies were determined by amplification of a standardized dilution series, and slopes were obtained. The specificity of the desired product was checked using analysis of melting temperature, which is product specific and high-resolution gel electrophoresis to verify that transcripts were of exact molecular size and further confirmed by sequence analysis. Negative control PCR containing all components except template was included for each sample to check out the formation of primer dimer.

2.4. Quantitative RT-PCR analysis Total RNA was isolated from different stages of CARs and COTs (6 samples per stages) by Qiazol reagent (Cat#: 79306, Qiagen) according to manufacturer instructions. Total RNA was treated with DNase 1 (Invitrogen) to remove any possible DNA contamination. The integrity of total RNA was checked on 1.0% agarose gel using 1× tris-borateEDTA (TBE) as electrophoresis buffer. The bands of 28 s RNA and 18 s RNA reflected the intactness of extracted total RNA. The purity and concentration of total RNA were checked using nanodrop. Isolated RNA samples were free from the protein contamination as the optical density (OD) 260: OD 280 values were > 1.9. The concentrations of the RNA samples were in the range of 1000–2000 ng/ml. Constant amounts of 1 µg of total RNA from CAR and COT (n = 6/stage) were reverse transcribed using cDNA synthesis kit Revert Aid First Strand cDNA Synthesis Kit ((Cat #:#172-5201; Thermo Scientific) and oligo-dT18 primer at 42˚C for 60 min. The resulting cDNAs were used in qPCR. The qPCR for each cDNA and the housekeeping genes GAPDH was performed in duplicate using SsoFast Eva green supermix kit (Bio-Rad) in a Bio-Rad CFX manager Real-Time qPCR System instrument as per manufacturer’s instructions. In brief, PCR templates containing 0.5-µl reverse-transcribed total RNA were added to the 0.25-µl forward primer (0.2 mM), 0.25-µl reverse primer (0.2 mM), and 5 µl of SsoFast Eva Green Supermix to a final volume of 10 µl and were subjected to the qPCR protocol for all investigated factors. The following general qPCR protocol was used for all investigated factors: Enzyme activation for 30 s at 95 °C, 40 cycles of a 3-segmented amplification and quantification program (denaturation for 5 s at 95 °C, annealing for 10 s at the primer-specific temperature [55 °C for PCNA, 60 °C for all other examined factors] and elongation for 15 s at 72 °C). Slow heating did a melting step from 61 to 95 °C @ 0.58 °C/s and continuous fluorescence measurement, and a final cooling down to 4 °C. After the end of the run, cycle threshold values and amplification plot for all determined factors were acquired using the “Eva green (with dissociation curve)” method

2.5. Gene expression analysis The CARs of the non-gravid uterus of third stage oestrus cycle (11–16 days) were used as calibrator for obtaining relative mRNA expression. GAPDH was used as housekeeping. The efficiency of corrected relative quantification of mRNA was obtained by the method of Pfaffl (2001). For this, efficiencies of primers were determined by serial dilution of template cDNA sample and run in triplicate. The efficiency of the primer of different factors has been given in Table 1. 2.6. Western blot The relative expression of the protein in the CARs and COTs of different groups were determined by suspending liquid nitrogen triturated CARs/COTs tissue of different stages in Tissue-PE LB™ (G Biosciences, USA) buffer and Halt™protease inhibitor cocktail (Thermo Scientific), which was later homogenized and centrifuged at 12,000g. The total soluble protein concentration in the supernatant was estimated using a Bradford Protein Assay. Further, the supernatant was diluted in sodium dodecyl sulfate (SDS) sample buffer (final concentration of 60 mM Tris, pH 6.8, 2% SDS, 100 mM dithiothreitol, and 10% glycerol), followed by boiling for 5 min. The protein samples (100 mg from CARs and COTs tissue from each stage) were subjected to SDS–10%–12.5% PAGE, electro-transferred onto polyvinylidene 3

General and Comparative Endocrinology 285 (2020) 113249

S. Kumar, et al.

B). BMP6 mRNA level was significantly upregulated (p < 0.05) during early and late stages of pregnancy whereas in mid-pregnancy, it was downregulated in COTs as compared to NP (Fig. 2C). BMP7 mRNA level was upregulated (p < 0.05) during the late stage of pregnancy whereas, in early pregnancy and mid-pregnancy, it was downregulated in COTs as compared to NP (Fig. 2D). Protein expression profile followed a similar trend as mRNA (Fig. 3).

difluoride (PVDF) membrane and blocked with 5% bovine serum albumin (BSA) before incubation with primary antibodies viz. BMPs and their receptors at a 1:200 dilution and GAPDH at a 1:500 dilution. Antibody binding was detected using corresponding secondary antibodies conjugated with horseradish peroxidase (HRP) and was added and incubated at 37 °C for 1 h. After washing 3–4 times in PBS-Tween 20 solution, the positive signals were detected by incubating the membrane using 0.06% 3,3′-diaminobenzidine tetrahydrochloride (DAB, Genei) in 1× PBS (pH 7.4) containing 0.06% H2O2 for 10–15 min. The bands were visualized under white light and recorded on a digital camera. The experiment was replicated thrice for each protein.

3.4. BMPRs mRNA and protein expression in COTs BMPR1A mRNA level was significantly upregulated (p < 0.05) during the early stage of pregnancy, whereas there was no significant difference during mid and late pregnancy in COTs as compared to NP (Fig. 2E). BMPR1B mRNA level was significantly upregulated (p < 0.05) during the early stage of pregnancy whereas in mid and late pregnancy, it was downregulated in COTs as compared to NP (Fig. 2F). BMPR2 mRNA level significantly upregulated (p < 0.05) during the early stage of pregnancy whereas in late pregnancy, it was downregulated in COTs as compared to NP (Fig. 2G). Protein expression profile followed a similar trend as mRNA (Fig. 3).

2.7. Hormone determination Concentrations of P4 determined in the spent media of trophoblast cell culture was estimated by P4125I RIA kit (IM1188) supplied by Immunotech, The Czech Republic as per manufacturer’s instruction. The spent media was diluted with phosphate-buffered saline (PBS) at 1:5 dilutions. The measurable range was 0.05–50 ng/mL for P4. The intra- and interassay coefficients of variation were 5.5% and 7.6% for P4.

3.5. Effect of BMP4 and BMP7 on placental angiogenesis, cell survivability & steroidogenesis in cultured trophoblast cell in-vitro

2.8. Statistical analyses 3.5.1. Effect of BMP4, BMP7, and combination treatment on mRNA expression of steroidogenic genes (StAR, CYP11A1, and 3βHSD) in cultured trophoblast cell in-vitro The mRNA expression of StAR increased significantly (P < 0.05) in a dose-dependent manner showing maximum expression (P < 0.05) (100 ng/ml BMP4) (Fig. 4B) and (1 ng/ml BMP7) (Fig. 4F) at 72 h of culture period compared to control. The TC was subjected with a combination of (100 ng/ml BMP4 and 100 ng/ml BMP7), and the mRNA expression of StAR (Fig. 4J) were highest (P < 0.05) at 24 h of incubation. The mRNA expression of CYP11A1 increased significantly (P < 0.05) at the highest dose (100 ng/ml BMP4) at 72 h incubation period compared to control (Fig. 4C). Expression of CYP11A1 was upregulated at all doses with maximum expression (P < 0.05) at 24 h (1 ng/ml BMP7) of the culture period (Fig. 4G). The expression pattern CYP11A1 at a combined dose (100 ng/ml BMP4 & 100 ng/ml BMP7) showed maximum expression (P < 0.05) at 24 h compared to control (Fig. 4K). The mRNA expression of3βHSD was maximum (P < 0.05) at 48 h of incubation with BMP4 (10 ng/ml) (Fig. 4D) treatment and during 72 h of the cultured period with BMP7 (10 ng/ml) (Fig. 4H) treatment. The mRNA expression in a combined dose of 3βHSD increased during all the stages of incubation with maximum expression at (P < 0.05) 72 h of incubation compared to control (Fig. 4L). The maximum progesterone (P4) concentration in TCC spent media was observed (P < 0.05) at 72 h of incubation with BMP4 (100 ng/ml) (Fig. 4A) and BMP7 (10 ng/ml) (Fig. 4E). The maximum progesterone (P4) concentration in TCC spent media was observed (P < 0.05) at 24 h of incubation with the combination dose of BMP4 and BMP7 (Fig. 4I).

All experimental data are shown as Mean ± SEM. The statistical significance of differences in the P4 concentration and mRNA expression of StAR, CYP11A1, CYP19A1, vWF, 3βHSD, BAX and PCNA in cultured trophoblast cells were assessed using the software SPSS.17.0 by two-way analysis of variance followed by Tukey’s honestly significant differences test (HSD) as a multiple comparison test. The model included the main effects of the fixed factors (dose of BMPs, wherever required) and their expression along with the different time points (24, 48 and72 h). Differences were considered significant if P < 0.05. 3. Results 3.1. BMPs mRNA and protein expression in CARs BMP2 mRNA level significantly upregulated (p < 0.05) during all the stages of pregnancy in CARs as compared to NP (Fig. 1A). BMP4 and BMP6 mRNA level were significantly upregulated (p < 0.05) during the early stage of pregnancy whereas in mid and late pregnancy, it was downregulated in CAR as compared to NP (Fig. 3B, C). BMP7 mRNA level was significantly upregulated (p < 0.05) during the early and mid-stages of pregnancy, whereas, there was no significant difference during late pregnancy in CAR as compared to NP (Fig. 3D). Protein expression profile followed a similar trend as mRNA (Fig. 3). 3.2. BMP mRNA and protein expression in CARs BMPR1A mRNA level was significantly upregulated (p < 0.05) during all the stages of pregnancy in CAR as compared to NP (Fig. 1E). BMPR2 mRNA level was significantly upregulated (p < 0.05) during all the stages of pregnancy in CAR as compared to NP except EP1 (Fig. 1G). BMPR1B mRNA level was significantly upregulated (p < 0.05) during the early stages and in mid of pregnancy whereas, in late pregnancy, it was downregulated in CARs as compared to NP (Fig. 1F). Protein expression profile followed a similar trend as mRNA (Fig. 3).

3.5.2. Effect of BMP4, BMP7, and combination treatment on mRNA expression cell survivability genes (PCNA and BAX) The expression of PCNA increased at all doses and at all period of incubation with maximum expression at 72 h of incubation with BMP4 (100 ng/ml) (Fig. 5A) and BMP7 (100 ng/ml) (Fig. 5B) treatment. The expression PCNA in a combined dose of was highest (P < 0.05) during 72 h of incubation (Fig. 5C). The expression of BAX decreased at all time period of incubation with least expression was observed at 72 h with 100 ng/ml BMP4 (Fig. 5D) and 100 ng/ml BMP7 treatment (Fig. 5E) compared to control. The expression in the combined dose of BAX expression (P < 0.01) was

3.3. BMPs mRNA and protein expression in COTs BMP2 and BMP4 mRNA level were significantly upregulated (p < 0.05) during the early stage of pregnancy whereas in mid and late pregnancy, it was downregulated in COTs as compared to NP (Fig. 2A, 4

General and Comparative Endocrinology 285 (2020) 113249

S. Kumar, et al.

Fig. 1. Relative mRNA expression of BMP Family in Placenta (CAR) during different stages of pregnancy in water buffalo (A) BMP2, (B) BMP4, (C) BMP6, (D) BMP7, (E) BMPR1A, (F) BMPR1B, (G) BMPR2. (NP) Non-gravid, the third stage of the oestrus cycle (11–16 days) was taken as control. All the values are shown Mean ± SEM. Different superscripts denote statistically different values (P < 0.05).

lowest during 48 h and 72 h of incubation (Fig. 5F).

period of incubation with maximum expression at 72 h of incubation with BMP4 (100 ng/ml) (Fig. 6A) and BMP7 (100 ng/ml) (Fig. 6B) compared to control. The expression vWF in a combined dose of was highest (P < 0.05) during 48 h of incubation (Fig. 6C).

3.5.3. Effect of BMP4, BMP7, and combination treatment on mRNA expression of the angiogenic gene (vWF) in TCC The mRNA expression of vWF increased at all doses and at all time 5

General and Comparative Endocrinology 285 (2020) 113249

S. Kumar, et al.

Fig. 2. Relative mRNA expression of BMP Family in Placenta (COT) during different stages of pregnancy in water buffalo (A) BMP2, (B) BMP4, (C) BMP6, (D) BMP7, (E) BMPR1A, (F) BMPR1B and (G) BMPR2. (NP) Non-gravid, the third stage of the oestrus cycle (11–16 days) was taken as control. All the values are shown Mean ± SEM. Different superscripts denote statistically different values (P < 0.05.

4. Discussion

livestock. Buffaloes contribute about 55% of the total milk production in India. In spite of their good production performance, the reproductive efficiency has not been exploited to the maximum in buffalo species. This is due to several inherent reproductive problems such as

Successful milk and meat production from farm animals are intimately dependent on the sound reproductive health of the female 6

General and Comparative Endocrinology 285 (2020) 113249

S. Kumar, et al.

Fig. 3. Demonstration of relative changes of BMP family and its receptors protein expression by immunoblotting at different stages of pregnancy in CAR and COT of BMP2, BMP4, BMP6, BMP7, BMPR1A, BMPR1B, and BMPR2 in water buffalo. GAPDH was used as a reference protein. GAPDH, glyceraldehydes 3-phosphate dehydrogenase.

delayed puberty, silent estrus, seasonal breeding, longer post-partum anoestrus, less intense estrus expression, and low conception rate and embryonic mortality, etc. Out of this, early embryonic mortality is

considered as one of the major causes of fertility loss in buffaloes. Reduced placental vascular development and increased vascular resistance during early pregnancy have been associated with early

Fig. 4. Time and concentrations dependent effects of BMP4/BMP7 or combinations on progesterone and its biosynthetic pathway enzymes in bubaline trophoblast cell culture (TCC) invitro. Each point in the line chart indicates mean ± SEM. The different superscripts indicate the concentrations dependent effect at a given time point ((P < 0.05). (A) Progesterone production in the spent cultured media; (B) StAR mRNA in TCC on BMP4 treatment; (C) CYP11A1 mRNA in TCC on BMP4 treatment; and (D) 3β HSD mRNA in TCC on BMP4 treatment; (E) Progesterone production in the spent cultured media; (F) StAR mRNA in TCC on BMP7 treatment; (G) CYP11A1 mRNA in TCC on BMP7 treatment; and, (H) three β HSD mRNA in TCC on BMP7 treatment; (I) Progesterone production in the spent cultured media (J) StAR mRNA in TCC on combination BMP4/BMP7 treatment; (K) CYP11A1 mRNA in TCC on combination BMP4/BMP7 treatment; and, (L) 3 β HSD mRNA in TCC on combination BMP4/BMP7 treatment. TCC, Trophoblast cell culture; StAR, steroidogenic acute regulatory protein; CYP11A1, cholesterol side-chain cleavage enzyme, and 3β HSD, 3-beta-hydroxysteroid dehydrogenase. 7

General and Comparative Endocrinology 285 (2020) 113249

S. Kumar, et al.

Fig. 5. The different superscripts indicate the concentrations dependent effect at a given time point ((P < 0.05). (A) PCNA mRNA in TCC on BMP4 treatment; (B) PCNA mRNA in TCC on BMP7 treatment; (C) PCNA mRNA in TCC on combination BMP4/BMP7 treatment; (D) BAX mRNA in TCC on BMP4 treatment; (E) BAX mRNA in TCC on BMP7 treatment; (F) BAX mRNA in TCC on combination BMP4/BMP7 treatment. TCC, Trophoblast cell culture; PCNA, Proliferating cell nuclear antigen; BAX, BCL-2 associated X protein.

pregnancy it was downregulated in COTs as compared to the nongravid uterus (NP). BMP2 mRNA level was significantly upregulated (p < 0.05) during all the stages of pregnancy in CARs as compared to NP. BMP4 mRNA level was significantly upregulated (p < 0.05) during the early stage of pregnancy whereas in mid and late pregnancy, it was downregulated in CAR as compared to NP. BMP6 expression was significantly upregulated (p < 0.05) during early and late stages of pregnancy whereas, in mid-pregnancy, it was downregulated in COTs as compared to NP. The increased expression of BMP6 in early pregnancy reflected that it might have a role in placental angiogenesis while increased expression of BMP6 in late pregnancy may be related to the development of estrogenic receptors near parturition. This is supported by findings of (Glister et al., 2004) who reported that in bovine GCs, BMP6 upregulated basal and IGF stimulated estrogen production. However, BMP6 has been found to suppress P4 production in the GC of rat (Otsuka et al., 2001). BMP7 mRNA level was upregulated (p < 0.05) during the late stage of pregnancy whereas in early and mid-pregnancy, it was downregulated in COTs as compared to NP. The increased expression of BMP7 in late pregnancy may be responsible for the decrease in progesterone (P4) production, which may help the animal in preparation of parturition. This is supported by findings of Zhang et al. (2015) who reported that BMP7 suppress StAR and progesterone production via ALK3 and SMAD1/5/8-SMAD4 in human granulosa-lutein cells. BMPR1A, BMPR1B, and BMPR2 mRNA level were significantly upregulated during the early stage of pregnancy in COTs as compared to NP. BMPR1A and BMPR2 mRNA level were significantly upregulated during all the stages of pregnancy in CAR as compared to NP except EP1. BMPR1B mRNA level was significantly upregulated during the early stage of pregnancy whereas, in mid and late pregnancy, it was downregulated in COTs as compared to NP. This is supported by findings of Ozkaynak et al. (1997) and Pennington and Ealy (2012) who reported that BMP-4 was expressed in the giant trophoblast of the mouse and the BMP2/4 ligands and its receptors were shown within

embryonic mortality (Campanile et al., 2007). Hence, circumventing all these problems is of primary importance to augment reproductive status and milk production of this species of animal. A key to the efficient functioning of the female reproductive system is the proper angiogenesis and vasculogenesis of placental tissues, which is tightly regulated by various angiogenic growth factors (Leung et al., 1989; Gospodarowicz et al., 1987; Maglione et al., 1991; Derynck et al., 1985; Zheng et al., 1999; Sato et al., 1995; Fujiwara et al., 2001). The present research work was carried out to investigate the expression and functional role of bone morphogenetic proteins in the placenta during different stages of pregnancy and the effect of BMP4 and/or BMP7on placental angiogenesis, cell survivability, and steroidogenesis in in-vitro trophoblast cell culture model in water buffalo. We demonstrated the same with varying degree of regulation through mRNA expression, protein expression, and localization in bubaline CARs and COTs during different stages of pregnancy. Our results indicated that BMPs and their receptors are present in the COTs and CARs in the buffalo with prominent expression in the early and mid-stages of pregnancy. A little variation was observed in the expression profile and localization of BMP and its receptor family in comparison with other species. This may be attributed to species-specific differences. Different workers reported the expression of BMPs and its receptors in granulosa cells (GC), theca cells (TC) and corpus luteum (CL) in diverse species like rat (Shimasaki et al., 1999), cattle (Glister et al., 2004), sheep (Souza et al., 2002), and Buffalo (Rajesh et al., 2018; Rajesh et al., 2016). In addition to this, the expression of BMPs family in placenta has also been reported previously only in human (Martinovic et al., 1996) and mouse (Ozkaynak et al., 1997) and bovine (Pennington and Ealy, 2012) models. There was a reasonable congruence among the real-time, immunoblotting, and immunohistochemistry studies on the expression profile of BMPs and their receptors. The present study indicated that BMP2 and BMP4 mRNA level were significantly upregulated (p < 0.05) during the early stage of pregnancy whereas in mid and late 8

General and Comparative Endocrinology 285 (2020) 113249

S. Kumar, et al.

species (Martinovic et al., 1996; Ozkaynak et al., 1997). Our results showed that at 72 h of culture, 100 ng/ml of BMP4 stimulated the transcripts of critical intermediate enzymes involved in steroidogenesis viz. StAR, CYP11A1, and 3βHSD significantly and BMP7 stimulated the transcripts of 3βHSD significantly that correlated well with P4 accumulation in the culture media. Treatment of TCC with BMPs in vitro confirmed the presence of functional receptors that stimulated the P4 production and trophoblast cell survival. Our result is supported by Verduzco et al. (2012) who reported that expression of enzymes involved in steroidogenesis in the bovine placenta during the first half of gestation in caruncular epithelial cells and uninucleate trophoblast cells were the principal cells detected that were positive for the three markers. Western blot analysis showed that only caruncular tissue expressed all three steroidogenic markers; in contrast, COTs only expressed StAR and cytochrome P45011A1. Moreover, the results support the concept that the upregulation of P4 and its biosynthetic pathway enzymes such as CYP11A1, StAR, and 3-βHSD in the placenta is likely due to the autocrine and /or paracrine effects of BMP4 and BMP7 under physiological milieu. Highest concentrations of BMP4 and BMP7 significantly upregulated the transcripts of anti-apoptotic PCNA and downregulated proapoptotic BAX in the trophoblast cell culture (TCC) (P < 0.05) suggesting their role in controlling cell survival. This is supported by Ozkaynak et al. (1997) who reported that the expression of BMP4 and BMP7 in the mouse placenta is involved in trophoblast cell proliferation and differentiation. Similarly, BMP4, 6, and 7 increased the proliferation of GC in the cow (Glister et al., 2004). BMP4, as well as BMP7, upregulated the transcript of vWF in the TCC (P < 0.05) suggesting their role in placental angiogenesis. The results indicate that BMP4 and BMP7 might stimulate angiogenesis in the developing placenta of buffalo. This is supported by various studies which reported that BMP4 and BMP7 help in angiogenesis of developing CL and follicles in Buffalo, (Rajesh et al., 2018; Rajesh et al., 2016), in human (Akiyama et al., 2014), and in the cow [Shimizu et al. (2012); and BMP4, as well as BMP7, upregulated the transcripts of CYP19A1 in the TCC (P < 0.05) suggesting that they might stimulate estrogen production in the placenta of water buffalo. Inclusively, our results show that BMPs and their receptors are expressed in a coordinated manner with stage-specific differences in buffalo placenta and they especially BMP4 and BMP7 promotes the angiogenesis, proliferation, cell survivability and steroidogenesis thereby regulating placental function in an autocrine/paracrine manner in water buffalo. Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Fig. 6. The different superscripts indicate the concentrations dependent effect at a given time point (P < 0.05). (A) vWF mRNA in TCC on BMP4 treatment; (B) vWF mRNA in TCC on BMP7 treatment; (C) vWF mRNA in TCC on combination BMP4/BMP7. TCC, Trophoblast cell, vWF, Von Willebrand factor.

Acknowledgment We thank Director, ICAR-Indian Veterinary Research Institute, Izatnagar, India, for funding of this research.

bovine trophectoderm before uterine attachment, respectively. There is no information available about the role of BMP family in placental angiogenesis, steroidogenesis, and cell survivability in different stages of pregnancy in Buffalo. To the best of our knowledge, this is the first comprehensive study on BMPs and their receptor system in the placenta of water buffalo. In agreement with documented studies, we were able to ascertain their specific role in buffalo species. BMP4 and BMP7 were selected for in vitro studies as they are widely used to study the regulation of steroid production in the follicular GC of different species (Akiyama et al., 2014; Kayamori et al., 2009; Lee et al., 2001; Shimizu et al., 2012). Similarly, they are widely used to study the regulation of steroid production in the trophoblast cells of different

References Akiyama, I., Yoshino, O., Osuga, Y., Shi, J., Harada, M., Koga, K., Hirota, Y., Hirata, T., Fujii, T., Saito, S., Kozuma, S., 2014. Bone morphogenetic protein 7 increased vascular endothelial growth factor-A (VEGF-A) expression in human granulosa cells and VEGF receptor expression in endothelial cells. Reprod. Sci. 21 (4), 477–482. Campanile, G., Di Palo, R., Neglia, G., Vecchio, D., Gasparrini, B., Prandi, A., Galiero, G., D’occhio, M.J., 2007. Corpus luteum function and embryonic mortality in buffaloes treated with a GnRH agonist, HCG, and progesterone. Theriogenology 67, 1393–1398. Chouhan, V.S., Panda, R.P., Yadav, V.P., Babitha, V., Khan, F.A., Das, G.K., Gupta, M., Dangi, S.S., Singh, G., Bag, S., Sharma, G.T., Berisha, B., Schams, D., Sarkar, M., 2013. Expression and localization of vascular endothelial growth factor and its receptors in

9

General and Comparative Endocrinology 285 (2020) 113249

S. Kumar, et al.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29, 2002–2007. Rajesh, G., Paul, A., Mishra, S.R., Bharati, J., Thakur, N., Mondal, T., Soren, S., Harikumar, S., Narayanan, K., Chouhan, V.S., Bag, S., Das, B.C., Singh, G., Maurya, V.P., Sharma, G.T., Sarkar, M., 2016. Expression and functional role of bone morphogenetic proteins (BMPs) in cyclical corpus luteum in buffalo (Bubalus bubalis). Gen. Comp. Endocrinol. 240, 198–213. Rajesh, G., Mishra, S.R., Paul, A., Punetha, M., Vidyalakshmi, G.M., Narayanan, K., Bag, S., Bhure, S.K., Chouhan, V.S., Maurya, V.P., Singh, G., Sarkar, M., 2018. Transcriptional and translational abundance of Bone morphogenetic protein (BMP) 2, 4, 6, 7 and their receptors BMPR1A, 1B and BMPR2 in buffalo ovarian follicle and the role of BMP4 and BMP7 on estrogen production and survival of cultured granulosa cells. Res. Vet. Sci. 118, 371–388. Ramsey, E.M., 1982. The Placenta, Human and Animal. Praeger, New York. Reynolds, L.P., Redmer, D.A., 2001. Angiogenesis in the placenta. Biol. Reprod. 64, 1033–1040. Sato, T.N., Tozawa, Y., Deutsch, U., Wolburg-Buchholz, K., Fujiwara, Y., GendronMaguire, M., Gridley, T., Wolburg, H., Risau, W., Qin, Y., 1995. Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature 376, 70–74. Schulz, L.C., Ezashi, T., Das, P., Westfall, S.D., Livingston, K.A., Roberts, R.M., 2008. Human embryonic stem cells as models for trophoblast differentiation. Placenta 29, S10–S16. Shimasaki, S., Zachow, R.J., Li, D.M., Kim, H., Iemura, S., Ueno, N., Sampath, K., Chang, R.J., Erickson, G.F., 1999. A functional bone morphogenetic protein system in the ovary. Proc. Natl. Acad. Sci. U.S.A. 96, 7282–7287. Shimizu, T., Magata, F., Abe, Y., Miyamoto, A., 2012. Bone morphogenetic protein 4 (BMP-4) and BMP-7 induce vascular endothelial growth factor expression in bovine granulosa cells. Anim. Sci. J. 83, 663–667. Short, R.V., 1984. Species differences in reproductive mechanisms. In: Austin, C.R., Short, R.V. (Eds.), Reproduction in Mammals, Book 4, second ed. Cambridge University Press, Cambridge, UK. Soliman, M.K., 1975. Studies on physiological chemistry of allantoic fluid of buffalo at various periods of pregnancy. Indian Vet. J. 52, 106–112. Souza, C.J., Campbell, B.K., McNeilly, A.S., Baird, D.T., 2002. Effect of bone morphogenetic protein 2 (BMP2) on oestradiol and inhibin A production by sheep granulosa cells, and localization of BMP receptors in the ovary by immunohistochemistry. Reproduction 123 (3), 363–369. Stegeman, J.H.J., 1974. Placental development in the sheep and its relation to fetal development. Bijdragen Tot De Dierkunde (Contrib. Zool.) 44, 3–72. Suzuki, Y., Koshi, K., Imai, K., Takahashi, T., Kizaki, K., Hashizume, K., 2011. Bone morphogenetic protein-4 accelerates the establishment of bovine trophoblastic cell lines. Reproduction 142 (5), 733–743. Thakur, Nipuna, Singh, Girjesh, Paul, A., Bharati, J., Rajesh, G., Vidyalakshmi, G.M., Chouhan, V.S., Bhure, S.K., Maurya, V.P., Singh, G., Sarkar, M., 2017. Expression and molecular cloning of interferon-stimulated genes in buffalo. Theriogenology 100, 50–58. Verduzco, A., Fecteau, G., Lefebvre, R., Smith, L.C., Murphy, B.D., 2012. Expression of steroidogenic proteins in bovine placenta during the first half of gestation. Reprod. Fertil. Dev. 24 (2), 392–404. Xu, R.H., Chen, X., Li, D.S., Li, R., Addicks, G.C., Glennon, C., Zwaka, T.P., Thomson, J.A., 2002. BMP4 initiates human embryonic stem cell differentiation to trophoblast. Nat. Biotechnol. 20 (12), 1261–1264. Zhang, H., Klausen, C., Zhu, H., Chang, H.M., Leung, P.C., 2015. BMP4 and BMP7 suppress StAR and progesterone production via ALK3 and SMAD1/5/8-SMAD4 in human granulosa-lutein cells. Endocrinology 156 (11), 4269–4280. Zheng, J., Bird, I.M., Melsaether, A.N., Magness, R.R., 1999. Activation of the mitogenactivated protein kinase cascade is necessary but not sufficient for basic fibroblast growth factor- and epidermal growth factor-stimulated expression of endothelial nitric oxide synthase in ovine fetoplacental artery endothelial cells. Endocrinology 140, 1399–1407.

the corpus luteum during oestrus cycle in water buffaloes (Bubalus bubalis). Reprod. Domestic Anim. 48, 810–818. Derynck, R., Jarrett, J.A., Chen, E.Y., Eaton, D.H., Bell, J.R., Assoian, R.K., Roberts, A.B., Sporn, M.B., Goeddel, D.V., 1985. Human transforming growth factor-beta complementary DNA sequence and expression in normal and transformed cells. Nature 316, 701–705. Faber, J.J., Thornburg, K.L., 1983. Placental Physiology. Structure and Function of Fetomaternal Exchange. Raven Press, New York. Food and Agriculture organization of the United Nations. FAOSTAT. 2014. http://www. fao.org/faostat/en/#data/QA. Fujiwara, T., Dunn, N.R., Hogan, B.L.M., 2001. Bone morphogenetic protein 4 in the extraembryonic mesoderm is required for allantois development and the localization and survival of primordial germ cells in the mouse. Proc. Natl. Acad. Sci. U.S.A. 98, 13739–13744. Glister, C., Kemp, C.F., Knight, P.G., 2004. Bone morphogenetic protein (BMP) ligands and receptors in bovine ovarian follicle cells: actions of BMP-4, -6 and -7 on granulosa cells and differential modulation of Smad-1 phosphorylation by follistatin. Reproduction 127, 239–254. Gospodarowicz, D., Ferrara, N., Schweigerer, L., Neufeld, G., 1987. Structural characterization and biological functions of fibroblast growth factor. Endocr. Rev. 8, 95–114. Grazul-Bilska, A.T., Johnson, M.L., Borowicz, P.P., Minten, M., Bilski, J.J., Wroblewski, R., Velimirovich, M., Coupe, L.R., Redmer, D.A., Reynolds, L.P., 2011. Placental development during early pregnancy in sheep: cell proliferation, global methylation, and angiogenesis in the fetal placenta. Reproduction 141, 529–540. Grazul-Bilska, A.T., Johnson, M.L., Borowicz, P.P., Baranko, L., Redmer, D.A., Reynolds, L.P., 2013. Placental development during early pregnancy in sheep: effects of embryo origin on fetal and placental growth and global methylation. Theriogenology 79, 94–102. Grazul-Bilska, A.T., Johnson, M.L., Borowicz, P.P., Bilski, J.J., Cymbaluk, T., Norberg, S., Reynolds, L.P., 2014. Placental development during early pregnancy in sheep: effects of embryo origin on vascularization. Reproduction (Cambridge, England) 147 (5), 639–648. https://doi.org/10.1530/REP-13-0663. Jian, Y., Pujie, S., Maolin, T., Yun, W., Meng, L., Fengjiao, F., Ming, D., 2015. Bone morphogenetic proteins: relationship between molecular structure and their osteogenic activity. Food Sci. Hum. Well. Kayamori, T., Kosaka, N., Miyamoto, A., Shimizu, T., 2009. The differential pathways of bone morphogenetic protein (BMP)-4 and -7 in the suppression of the bovine granulosa cell apoptosis. Mol. Cell. Biochem. 323, 161–168. Lee, W.S., Otsuka, F., Moore, R.K., Shimasaki, S., 2001. Effect of bone morphogenetic protein-7 on folliculogenesis and ovulation in the rat. Bio. Reprod. 65, 994–999. Leung, D.W., Cachianes, G., Kuang, W.J., Goeddel, D.V., Ferrara, N., 1989. Vascular endothelial growth factor is a secreted angiogenic mitogen. Science 246, 1306–1309. Maglione, D., Guerriero, V., Viglietto, G., Delli-Bovi, P., Persico, M.G., 1991. Isolation of a human placenta cDNA coding for a protein related to the vascular permeability factor. Proc. Natl. Acad. Sci. U.S.A. 88, 9267–9271. Magness, R.R., 1998. Maternal cardiovascular and other physiological responses to the endocrinology of pregnancy. In: Bazer, F.W. (Ed.), The Endocrinology of Pregnancy, pp. 507–539. Martinovic, S., Latin, V., Suchanek, E., Stavljenic-Rukavina, A., Sampath, K.I., Vukicevic, S., 1996. Osteogenic protein-1 is produced by human fetal trophoblasts in vivo and regulates the synthesis of chorionic gonadotropin and progesterone by trophoblasts in vitro. Eur. J. Clin. Chem. Clin. Biochem. 34, 103–109. Otsuka, F., Moore, R.K., Shimasaki, S., 2001. Biological function and cellular mechanisms of bone morphogenetic protein-6 in the ovary. J. Biol. Chem. 276, 32889–32895. Ozkaynak, E., Donald, F., Mislav, J., Slobodan, V., Hermann, O., 1997. Osteogenic protein-1 mRNA in the uterine endometrium. Biochem. Biophys. Res. Commun. 234 (1), 242–246. Pennington, K.A., Ealy, A.D., 2012. The expression and potential function of bone morphogenetic proteins 2 and 4 in bovine trophectoderm. Reprod. Biol. Endocrinol. 10 (1), 12.

10