- Email: [email protected]
Expression and purification of an immunogenic SUMO-OmpC fusion protein of Salmonella Typhimurium in Escherichia coli
Biologicals xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Biologicals journal homepage: www.elsevier.com/locate/biologicals
Expression and purification of an immunogenic SUMO-OmpC fusion protein of Salmonella Typhimurium in Escherichia coli Prejita,b,∗, Prakasam Thanka Pratheesha, Soman Nimishaa, Vergis Jessa,b, Karthikeyan Ashaa, Rajesh Kumar Agarwalc a
Department of Veterinary Public Health, CV&AS, Kerala Veterinary and Animal Sciences University, India Centre for One Health Education, Advocacy, Research and Training, Kerala Veterinary and Animal Sciences University, Pookode, Wayanad, Kerala, 673576, India c National Salmonella Centre (Vet), Division of Bacteriology and Mycology, Indian Veterinary Research Institute, Izatnagar, Bareilly, 243122, U.P, India b
A R T I C LE I N FO
A B S T R A C T
Keywords: Cloning Expression SUMO OmpC Salmonella Typhimurium Western blot
Salmonella is found to be a major causes of food borne diseases globally. Poultry products contaminated with this pathogen is one of the major sources of infections in humans. Outer membrane protein C (OmpC) of Salmonella Typhimurium is a promising DNA vaccine candidate to mitigate Salmonella infection in poultry. However, the large-scale production of bioactive recombinant OmpC (rOmpC) protein is hindered due to the formation of inclusion bodies in Escherichia coli. The objective of this work was to attain high level expression of rOmpC protein, purify and evaluate its functional properties. The ompC gene was optimized and fused with small ubiquitin-related modifier (SUMO) gene for high level expression as soluble protein. The fusion protein with ~58 kDa molecular weight was observed on SDS-PAGE gel. The expression levels of rOmpC fusion protein reached maximum of 38% of total soluble protein (TSP) after 8 h of 0.2% rhamnose induction. Protein purification was carried out using nickel nitrilotriacetic acid (Ni-NTA) purification column. Western blot were performed to analyse expression and immunoreactivity of rOmpC fusion protein. The results indicate that SUMO fusion system is ideal for large scale production of functional rOmpC fusion protein expression in E. coli.
1. Introduction Salmonella is the most common bacteria that cause foodborne illness worldwide causing millions of cases of illnesses and thousands of deaths annually [1–3]. Poultry meat and eggs are considered to be the major source of Salmonella infection for humans [4]. The most common serovar found in poultry are Salmonella Enteritidis and Typhimurium, and these serovars are responsible for majority of the foodborne salmonellosis [5,6]. Pathogen control strategy at pre-harvest environment is the first line of control to reduce risk of foodborne pathogens in eggs and meat. Vaccination of farmed animals can be very effective to bring Salmonella infection under control, rather than using the conventional preventive methods like disinfection, control of carriers and UV irradiation of hatcheries [7]. Live and killed S. Enteritidis and S. Typhimurium vaccines are currently available for immunization of poultry worldwide. However, these vaccines are not effective against other serovars with different O and H antigens [8]. Surface-associated antigens are found to be promising antigens candidates for the induction of both humoral and cellular immunity to
Salmonella [9]. The nucleotide sequence analysis of ompC gene in different Salmonella serotypes indicates that this gene is highly conserved among Salmonella species [10,11]. Outer membrane proteins are considered effective antigens to stimulate immune responses because they are exposed on the bacterial surface and easily recognized by the host immune system [12–14]. The porin OmpC of Salmonella was identified as the major surface antigen with unique exposed immune epitopes, and can induce both innate and adaptive immunity in chickens [15]. Studies by our group and others proved that OmpC protein of S. Typhimurium has potential as vaccine candidate against salmonellosis [15,16]. Enzyme linked immunosorbent assays (ELISA) based on OmpC proved useful to detect multiple salmonella serovars in poultry [17]. Thus, OmpC has considerable potential in development of vaccines against infection by different Salmonella serovars. High level expression, purification and characterization of immunogenic proteins is important for the development of both improved diagnostic assays and subunit vaccines against salmonellosis in poultry. Heterologous expression systems in E. coli are widely used for recombinant protein development, due to its low cost, ease of
∗ Corresponding author. Centre for One Health Education, Advocacy, Research and Training, Kerala Veterinary and Animal Sciences University, Pookode, Wayanad, Kerala, 673576, India. E-mail address: [email protected] (Prejit).
https://doi.org/10.1016/j.biologicals.2019.10.010 Received 18 June 2019; Received in revised form 17 October 2019; Accepted 19 October 2019 1045-1056/ © 2019 Published by Elsevier Ltd on behalf of International Alliance for Biological Standardization.
Please cite this article as: Prejit, et al., Biologicals, https://doi.org/10.1016/j.biologicals.2019.10.010
Biologicals xxx (xxxx) xxx–xxx
Prejit, et al.
manipulation, and availability of well established molecular tools and techniques [18]. But, E. coli doesn't have the capacity for high level expression of membrane-bound proteins and often majority of the expressed protein will be accumulated in the form of insoluble inclusion bodies. To resolve this problem, many strategies to find the ideal fusion tag have been tested [19]. The small ubiquitin-related modifier (SUMO), is a ~100- residue protein, and following covalent binding to the target protein can modulate its behaviour. SUMO fusion technology is proven tool for prokaryotic expression systems; however, the SUMO tag will be cleaved by SUMO proteases in a eukaryotic organism. The SUMO-fusion tag enhances both expression and solubility of recombinant proteins, while at the same time protecting against proteolytic degradation, facilitating protein purification, and most importantly preserving the native N-terminus following tag removal [20,21]. Researchers have upgrade the SUMO tag, called SUMOstar, which is resistant to cleavage by SUMO protease in eukaryotic expression systems. This SUMOstar tag also maintains enhanced protein expression and solubility as shown in yeast, insect, and mammalian cells [14]. Taking these facts into consideration current work was envisaged to clone and express immunopotent OmpC gene with SUMO fusion tag for attaining higher-levels soluble functional protein in E. coli.
Fig. 1. Schematic representation of pSUMO-OmpC Vector: Vector is driven my Rhamnose promoter, RBS, ribosome binding site; ATG, translation start site; His6, Hexa histidine tag, SUMO Small ubiquitin-related modifier; OmpC, outer membrane protein C insert Stop, translation end site; Kan, kanamycin resistance gene; ROP, Repressor of Priming (for low copy number); Ori, origin of replication. (T) CloneSmart® transcription terminators.
2. Materials and methods
10 min. The amplified products were analyzed by agarose gel electrophoresis in 1.5% agarose containing ethidium bromide (0.5 μg/ml).
2.1. Bacterial strain
2.4. Vector construction and transformation to E. coli
Standard culture strain of Salmonella Typhimurium E−2375 used in this study was procured from National Salmonella centre, Indian Veterinary Research Institute (IVRI), Izatnagar.
The vector pRham™ N-His SUMO (Lucigen) was used for developing the rOmpC protein expression in this study. PCR amplicon of ompC gene (1470 bp) with 18 nt flanking sequences at both the ends was used for enzyme free directional cloning into pRham N-His SUMO expression vector by homologous recombination. 3 μl (~50 ng) of unpurified PCR product was mixed with 25 ng of vector in a PCR tube, to induce enzyme free directional cloning through homologus recombination. The newly constructed vector was designated as pSUMO-OmpC vector (Fig. 1), and was transformed directly into E. cloni 10G competent cells via heat shock method (42 °C for 30 s). Screening of transgenic colonies were done on Luria-Bertani (LB) agar plates containing 30 μg/ml Kanamycin. Overnight grown (37 °C) suspected colonies in selective agar medium and were screened through colony PCR using SUMO-For and pET-Rev primers (Table-1).
2.2. Genomic DNA extraction The extraction of genomic DNA (gDNA) from standard culture of Salmonella Typhimurium was carried out using the Genomic DNA Purification Kit (California, Invitrogen) following manufacturer's instructions. Quality and quantity of gDNA isolated were checked using NanoDrop™ spectrophotometer (Thermo). 2.3. PCR amplification of ompC gene with flanking sequences PCR amplification of ompC gene was performed using gDNA isolated from Salmonella Typhimurium as template. A set of primers were designed with 18 nucleotide (nt) flanking sequence (CGC GAA CAG ATT GGA GGT-) at 5′ end of forward primer and 18 nt sequence (GTG GCG GCC GCT CTA TTA-) at 5′ end of reverse primer for enzyme free directional cloning (Table-1). The PCR reactions were carried out in a T100 Thermal Cycler (Bio-Rad Laboratories, USA). 50 μl reaction mix consist of 1 μl of each primer (0.2 μM), 0.2 mM of deoxynucleotide triphosphates, 1 μl of 50 mM MgSO4 (0.2 mM),1 unit of Platinum™ Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific, USA) in 1 × High Fidelity PCR buffer using 50 ng of gDNA as a template. PCR profile used is as follows: Initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 57 °C for 1 min, and extension at 68 °C for 1 min. Final extension at 68 °C for
2.5. Recombinant protein expression and purification Transgenic E. cloni 10G cells harboring pSUMO-OmpC vector were grown in LB medium (37 °C) till the optical density 600 nm reached 0.2. Rhaminose was added to the media to induce expression of rOmpC fusion protein. Different concentrations of L-rhaminose (0.05%, 0.1% and 0.2%) were tested to optimize high level expression of N-His SUMO-OmpC fusion protein in E. coli cells. Following induction by rhaminose samples were harvested every 2 h from 2 to 12 h to evaluate production level of expressed fusion protein. The total protein extracted were purified under denaturing condition using His-Pur Nickel-nitrilotriacetic acid (Ni-NTA) purification Column (Thermo Fisher Scientific, USA) at room temperature. The purification column with Ni-NTA resin
Table 1 Oligonucleotide primers used in this study. Primers Name
Oligonucleotide sequence
Amplicon size
Reference
ST-OmpC
For-ATGAAAGTTAAAGTACTGTCCCTCC-3′ Rev-TTAGAACTSGTAAACCAGACCCAG-3′ For-5′-CGCGAACAGATTGGAGGTAAAGTTAAAGTACTGTCC-3′ Rev 5′-GTGGCGGCCGCTCTATTAGAACTSGTAAACCAGACC-3′ For- 5′–ATTCAAGCTGATCAGACCCCTGAA–3′ Rev 5′–CTCAAGACCCGTTTAGAGGC–3′
1137 bp
This study
1167 bp
This study
1281 bp
Lucigen Lucigen
SUMO-OmpC SUMO pETite
2
Biologicals xxx (xxxx) xxx–xxx
Prejit, et al.
3.2. Expression and purification of N-His SUMO-OmpC fusion protein
were washed with two bed volume of equilibration buffer (20 mM sodium phosphate, 300 mM sodium chloride (PBS) with 10 mM imidazole; pH 7.4). The column was spun at 700 g for 2 min and the buffer discarded. Soluble recombinant protein isolated was mixed with equal volume of equilibration buffer to load sample into resin column. The column was mixed end-on-end in shaker. The column was spun at 700 g followed by washing with two resin-bed volumes of wash buffer (Phosphate-buffered saline, PBS with 25 mM imidazole; pH 7.4). This was repeated three times. His-tagged proteins were eluted using one resin-bed volume of elution buffer (PBS with 6 M guanidine-HCl and 250 mM imidazole; pH 7.4). Samples collected from elution steps were pooled, desalted and concentrated using PierceTM protein concentrators (Thermo Scientific) with 30 K MW cut off and spun at 4,000 g.The purity of N-His SUMO-OmpC protein was assessed using SDS-PAGE and the concentration was evaluated by the Bradford method.
SDS-PAGE analysis shows the presence of a ~58 kDa recombinant protein (Fig. 3a). The maximum level of expression of the recombinant protein (38% of total protein) was observed 8 h after induction with 0.2% of L-rhamnose (Fig. 3b). Theoretical molecular weight of N-His SUMO OmpC fusion protein was 53.4 kDa but on SDS-PAGE gel the protein size observed was found to be ~58 kDa (Fig.3c). Membrane proteins are covalently attached to carbohydrates or lipid moiety, most of the times and it is generally expected that the molecular weight of these proteins on gels higher than theoretical molecular weight. This phenomenon is termed “gel shifting,” its found to be common in case of membrane proteins, but reason for this to happen is yet to be convincingly explained [22]. 3.3. Results of Western blot analysis The purified recombinant protein was immunostained in Western Blot using 6x-His Tag Monoclonal Antibody (Invitrogen), which probes the N′ terminal 6x-His tag of recombinant fusion protein. Western blot analysis confirmed the expression of ~58 kDa recombinant protein in E. coli (Fig. 4a). Sera from two chickens, which were infected with Salmonella, contained anti-OmpC IgY that reacted strongly with the N-HisSUMO-OmpC fusion protein in Western blot. Negative serum did not react (Fig. 4b).
2.6. Western blot analysis Western blotting was carried out to confirm the molecular mass of the purified recombinant NHis SUMO OmpC fusion protein recombinant proteins using an anti-6 × His monoclonal antibody as probe. Following electrophoresis in a 10% SDS-PAGE gel, proteins were transferred to a nitrocellulose membrane by applying a current at 80 V for 30 min. The membrane was blocked with 3% skimmed milk in 1x Tris Buffered Saline with Tween 20 (TBST) at 4 °C and incubated overnight with 6X-his Tag. After three wash steps with TBST, the membrane was immersed in 250 μl of 3,3′-Diaminobenzidine (DAB)peroxidase substrate solution (0.3% H2O2 in 5 ml PBS) to develop bands indicating immunoreactive proteins. Reaction was stopped by rinsing the membrane in distilled water.
4. Discussion The expression, purification and characterization of immunogenic proteins are important for the development of both improved diagnostic assays and subunit vaccines against salmonellosis in poultry. Emergence of multi drug resistant Salmonella has led researchers to a focus towards developing novel vaccines that offer improved safety, comprehensive immunity, and highly cross-protective efficiency against heterologous Salmonella stains [23,24]. A large number of proteins are currently being tested for their immunological or protective applications as vaccines against salmonellosis. A variety of Salmonella OMPs, including OmpA, OmpC, OmpD, OmpF, Omp28 have been studied related to these aspects in recent decades [25,26]. OMPs are found to be a good immunogen to use in various diagnostics and vaccine studies [12,15,27]. Among these OMPs, OmpA of S. Enteritidis induces humoral immune response in chicken, but no protection was attained against homologus challenge [12]. OmpF has proved to be immunogenic in mice [28] and OmpC of S. Typhimurium has proved to be immunogenic in chickens [15]. In a recent study by Dai et al. [29], mice immunized with recombinant spores produced significant levels of antiOmpC serum IgG and mucosal secretory IgA, and oral immunization with recombinant spores induced protection of mice against a lethal challenge with S. Typhimurium. The natural abundance of membrane proteins is typically too low to isolate sufficient amounts of material for functional and structural studies. Therefore, membrane proteins must be obtained by overexpression, and the bacterium E. coli is the most widely used vehicle for this [30]. E. coli expression system continues to dominate the bacterial expression systems due to its simplicity, speed, and low cost. It remains to be the preferred system for laboratory investigations and initial development in commercial activities or as a useful benchmark for comparison among various expression platforms. This availability and the large number of expression vectors make E. coli the preferred host for production of recombinant proteins [31]. However, in E. coli heterologous proteins often cannot be expressed in a high quantity, can be incorrectly folded, or are available as insoluble aggregates only; these recombinant proteins lack characteristics of the native protein. The advances made in the field of recombinant DNA technology in recent years have made possible large scale production of functional proteins. The use of fusion tags for high-throughput expression and purification
2.7. Detection of chicken anti-OmpC IgY by Western blot A modification of the technique described above was used to detect IgY antibodies against OmpC in sera collected from six chickens (Breed: White leghorn) with salmonellosis that was confirmed by PCR analysis of cloacal swabs. Briefly, the purified NHis SUMO OmpC protein was run on an SDS-PAGE gel and transferred to a nitrocellulose membrane. The membrane was blocked and cut into vertically strips containing a lane each. Strips were incubated for 60 min with sera diluted 1:50 (with PBST). Strips were washed three times with TBST and incubated for 60 min with rabbit anti-chicken IgY horseradish peroxidase conjugate diluted 1:10000 (Invitrogen) at 37 °C). After incubation, the membranes were washed three times in TBST. Membranes were washed and exposed to DAB-peroxidase substrate solution for 10 min. The enzymatic reaction was stopped by washing the membrane with distilled water. The appearance of a brown band indicated a positive reaction.
3. Results 3.1. pSUMO-OmpC vector construction The modified 1137 bp ompC gene of S. Typhimurium was anchored with 18 nt flanking sequences at 5′ and 3′ ends and amplified using the SUMO-OmpC forward and reverse primers to obtain 1167 bp amplified DNA fragment (Fig. 2a). The 1167 bp amplicon was cloned into pRham N-His SUMO vector by enzyme free directional cloning. The newly constructed vector pSUMO-OmpC was transformed into E. cloni 10G competent cells. Transformants containing the pSUMO-OmpC insert were confirmed by colony PCR (Fig. 2b). Sequencing results confirmed the ompC gene insert was in right orientation and without any errors. The sequence of optimized N-His-SUMO-OmpC gene was submitted to the data base nucleotide sequence (GeneBank: MF136770). 3
Biologicals xxx (xxxx) xxx–xxx
Prejit, et al.
Fig. 2. a: PCR; Lane 1–5, Modified 1167bp amplicon of ompC gene with 18 nt flanking sequences at both ends. Lane-6, Native 1137 bp amplicon of ompC gene of Salmonella Typhimurium, Lane-7, negative control. Fig. 2b: Colony PCR: lane 1–5 transgenic colonies with1296 bp amplicon region of pSUMO-OmpC vector insert, Lane 6Un-transformed colony as -ve control.
Fig. 3. SDS-PAGE analysis: (a) Lane-1, 10% SDS-PAGE gel with TSP isolated from un-transformed E. coli cells; Lane-2, TSP from E. coli with pSUMO-OmpC insert. (b) Standardisation rhamnose induction for N-His-SUMO-OmpC fusion protein expression, Lane-1, Un induces cells, lane 2, TSP from 0.05% rhamnose induced cells, lane-3, 0.1% rhamnose induction, Lane-4, 0.2% rhamnose induction. (c) Ni-NTA purified ~58 kDa N-His-SUMO-OmpC fusion protein in 12% gel.
toxic nature was successfully expressed in E. coli by use of tunable rhamnose promoter and SUMO fusion tag [35]. On Western blot analysis, the positive sera reacted strongly with recombinant protein which confirmed that the protein is highly immunogenic in nature. These data clearly justify the fact that the use of SUMO fusion tag method enables high protein expression and solubility along with easy detection of difficult to express proteins in E. coli [19]
is a method of choice in recent years. Heterologous expression system E. coli is one of the popular choice for large scale production of recombinant proteins. Maltose binding protein (MBP), glutathione Stransferase (GST), and small ubiquitin-like modifier (SUMO) are commonly used fusion tags [32]. Each of these tags provide improved expression and/or solubility of complex recombinant proteins in fused form [33]. In a study by Marblestone et al. [32], when three different test proteins were fused to the C termini of maltose‐binding protein (MBP), glutathione S‐transferase (GST), thioredoxin (TRX), NUS A, ubiquitin (Ub), and SUMO tags. These constructs were expressed in E. coli and evaluated for expression and solubility. SUMO expression system was superior to commonly used fusion tags in enhancing expression and solubility with the distinction of generating recombinant protein with native sequences. The expression of antimicrobial peptide (AMPs) was difficult earlier due to their cytotoxicity to host bacterial cells, sensitivity to proteolytic degradation, and low production yield. An antimicrobial peptide ABPdHC-cecropin A with potent activity against a wide range of bacterial species was expressed by SUMO fusion in E. coli with expression levels was as high as 65 mg/L, with ~21.3% of the fusion protein in soluble form [34]. In another study difficult express α-lufin protein, due to its
5. Conclusion This study confirms that the use of SUMO tag increases the production of functional rOmpC fusion protein in the form of soluble fractions, making it easy to isolate and purify protein from E. coli cells. This technique can be used as a reliable resource for the expression and purification of other valuable proteins in future. Westen blot analysis rOmpC fusion protein established that it had immunogenic potential, and therefore can be used as a suitable candidate for immunodiagnostics and for development of subunit vaccine against salmonellosis.
4
Biologicals xxx (xxxx) xxx–xxx
Prejit, et al.
[10] Prejit, Agarwal RK, Bhilegaonkar KN. PCR based detection of the ompC gene in Salmonella serovars. Indian J Comp Microbiol Immunol Infect Dis 2009;30:91–4. [11] MacLennan Calman A, Martin Laura B, Micoli Francesca. Vaccines against invasive Salmonella disease: current status and future directions. Hum Vaccines Immunother 2014;10:1478–93. [12] Okamura M, Ueda M, Noda Y, Kuno Y, Kashimoto T, Takehara K, et al. Immunization with outer membrane protein A from Salmonella enterica serovar Enteritidis induces humoral immune response but no protection against homologous challenge in chickens. Poult Sci 2012;91(10):2444–9. [13] Jawale CV, Lee JH. Evaluation of immunogenicity and protective efficacy of adjuvanted Salmonella Typhimurium ghost vaccine against salmonellosis in chickens. Vet Q 2016;36(3):130–6. [14] Liu Q, Liu Q, Zhao X, Liu T, Yi J, Liang K, et al. Immunogenicity and cross-protective efficacy induced by outer membrane proteins from Salmonella Typhimurium mutants with truncated LPS in mice. Int J Mol Sci 2016;17(3):416. [15] Prejit, Agarwal RK, Porteen K, Dubal ZB, Asha K, Shweta S, et al. Evaluation of recombinant outer membrane protein based vaccine against Salmonella Typhimurium in birds. Biologicals 2013;41(3):162–8. [16] Jha R, Kumar A, Saxena A, Tamuly S, Saxena MK. Cloning, sequencing and in silico analysis of omp C of Salmonella typhimurium. ISRN Vet Sci 2012;2012:7. https://doi. org/10.5402/2012/512848. 512848. [17] Manoj J, Agarwal RK, Sailo B, Wani MA, Singh MK. Evaluation of recombinant outer membrane protein C based indirect enzyme-linked immunoassay for the detection of Salmonella antibodies in poultry. Vet World 2015;8(8):1006. [18] Rosano GL, Ceccarelli EA. Recombinant protein expression in Escherichia coli: advances and challenges. Front Microbiol 2014;5:172. [19] Jia B, Jeon CO. High-throughput recombinant protein expression in Escherichia coli: current status and future perspectives. Open Biol. J. 2016;6(8):160–96. [20] Wang X, Liu H, Liu Y, Li Y, Yan L, Yuan X, et al. A novel strategy for the preparation of codon-optimized truncated Ulp1 and its simplified application to cleavage the SUMO fusion protein. Protein J 2016;35(2):115–23. [21] Satakarni M, Curtis R. Production of recombinant peptides as fusions with SUMO. Protein Expr Purif 2011;78(2):113–9. [22] Rath A, Glibowicka M, Nadeau VG, Chen G, Deber CM. Detergent binding explains anomalous SDS-PAGE migration of membrane proteins. Proc Natl Acad Sci 2009;106(6):1760–5. [23] Liu Qiong, Liu Qing, Yi Jie, Liang Kang, Tian Liu, Kenneth L, et al. Outer membrane vesicles derived from Salmonella Typhimurium mutants with truncated LPS induce cross-protective immune responses against infection of Salmonella enterica serovars in the mouse model. Int J Med Microbiol 2016;306(8):697–706. [24] Mahan MJ, Heithoff DM, House JK. Salmonella cross-protective vaccines: fast-forward to the next generation of food safety. Future Microbiol 2012;7:805–8. [25] Pérez-Toledo M, Valero-Pacheco N, Pastelin-Palacios R, Gil-Cruz C, PerezShibayama C, Moreno-Eutimio MA, et al. Salmonella Typhi porins OmpC and OmpF are potent adjuvants for T-dependent and T-independent antigens. Front Immunol 2017;8:230–8. [26] Saxena A, Kumar R, Saxena MK. Vaccination with Salmonella Typhi recombinant outer membrane protein 28 induces humoral but non-protective immune response in rabbit. Vet World 2017;10(8):946. [27] Porteen K, Agarwal RK, Prejit Nithya Q, Ruban SW. Recombinant OmpC subunit vaccine facilitate satisfactory protection against challenge dose of Salmonella typhimurium in mice model. Gene Ther Mol Biol 2014;16(1):88–94. [28] Toobak H, Rasooli I, Talei D, Jahangiri A, Owlia P, Darvish Alipour Astaneh S. Immune response variations to Salmonella enterica serovar Typhi recombinant porin proteins in mice. Biologicals 2013;41:224–30. [29] Dai X, Liu M, Pan K, Yang J. Surface display of OmpC of Salmonella serovar Pullorum on Bacillus subtilis spores. PLoS One 2018;13(1):1916–27. [30] Wagner S, Klepsch MM, Schlegel S, Appel A, Draheim R, Tarry M, et al. Tuning Escherichia coli for membrane protein over-expression. Proc Natl Acad Sci 2008;105(38):14371–6. [31] Chen R. Bacterial expression systems for recombinant protein production: E. coli and beyond. Biotechnol Adv 2012;30(5):1102–7. [32] Marblestone JG, Edavettal SC, Lim Y, Lim P, Zuo X, Butt TR. Comparison of SUMO fusion technology with traditional gene fusion systems: enhanced expression and solubility with SUMO. Protein Sci 2006;15(1):182–9. [33] Steinmetz EJ, Auldridge ME. Screening fusion tags for improved recombinant protein expression in E. coli with the Expresso® solubility and expression screening system. Curr Protoc Prot Sci 2017;5(27). https://doi.org/10.1002/cpps. 1–5.27.20. [34] Zhang J, Movahedi A, Wei Z, Sang M, Wu X, Wang M, et al. High-level SUMOmediated fusion expression of ABP-dHC-cecropin A from multiple joined genes in Escherichia coli. Anal Biochem 2016;509:15–23. [35] Namvar S, Barkhordari F, Raigani M, Jahandar H, Nematollahi L, Davami F. Cloning and soluble expression of mature from Luffa cylindrica in E. coli using SUMO fusion protein. Turkish J Biol 2018;42(1):23–32.
Fig. 4. (a)Western blot analysis of recombinant His tag-OmpC. Lane M: Fermentas prestained protein marker SM0671. Lane 1: Negative control; Lane 2: ~58 kDa N-His SUMO-OmpC protein. (b) Western assay with rabbit anti chicken IgY Ab, Lane 1–2; salmonella positive serum samples.
Declaration of competing interest The authors declare that they have no competing interests. Acknowledgments The authors cordially thank Department of Biotechnology, India (Ref. No. BT/PR5796/ADV/90/146/2013 of DBT, India ) for providing funds for the project. References [1] Majowicz SE, Musto J, Scallan E, et al. The global burden of non-typhoidal Salmonella gastroenteritis. Clin Infect Dis 2010;50:882–9. [2] Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson M, Roy SL, et al. Foodborne illness acquired in the United States-major pathogens. Emerg Infect Dis 2011;1:7–15. [3] Obaro SK, Iroh Tam PY, Mintz ED. The unrecognized burden of typhoid fever. Expert Rev Vaccines 2017;16(3):249–60. [4] EFSA. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2011. EFSA J 2013;11:19–73. [5] Hendriksen RS, Vieira AR, Karlsmose S, Lo Fo Wong DM, Jensen AB, Wegener HC, et al. Global monitoring of Salmonella serovar distribution from the world health organization global foodborne infections network country data bank: results of quality assured laboratories from 2001 to 2007. Foodb Pathog Dis 2011;8(8):887–900. [6] Foley Steven L, et al. Population dynamics of Salmonella enterica serotypes in commercial egg and poultry production. Appl Environ Microbiol 2011;77(13):4273–9. [7] Dar MA, Ahmad SM, Bhat SA, Ahmed R, Urwat U, Mumtaz PT, et al. Salmonella typhimurium in poultry: a review. World’s Poult Sci J 2017;73(2):345–54. [8] Noda T, Murakami K, Ishiguro Y, Asai T. Chicken meat is an infection source of Salmonella serovar Infantis for humans in Japan. Foodb Pathog Dis 2010;7:727–35. [9] Barat S, Willer Y, Rizos K, Claudi B, Maze A, Schemmer AK, et al. Immunity to intracellular Salmonella depends on surface-associated antigens. PLoS Pathog 2012;8(10).
5
Contents lists available at ScienceDirect
Biologicals journal homepage: www.elsevier.com/locate/biologicals
Expression and purification of an immunogenic SUMO-OmpC fusion protein of Salmonella Typhimurium in Escherichia coli Prejita,b,∗, Prakasam Thanka Pratheesha, Soman Nimishaa, Vergis Jessa,b, Karthikeyan Ashaa, Rajesh Kumar Agarwalc a
Department of Veterinary Public Health, CV&AS, Kerala Veterinary and Animal Sciences University, India Centre for One Health Education, Advocacy, Research and Training, Kerala Veterinary and Animal Sciences University, Pookode, Wayanad, Kerala, 673576, India c National Salmonella Centre (Vet), Division of Bacteriology and Mycology, Indian Veterinary Research Institute, Izatnagar, Bareilly, 243122, U.P, India b
A R T I C LE I N FO
A B S T R A C T
Keywords: Cloning Expression SUMO OmpC Salmonella Typhimurium Western blot
Salmonella is found to be a major causes of food borne diseases globally. Poultry products contaminated with this pathogen is one of the major sources of infections in humans. Outer membrane protein C (OmpC) of Salmonella Typhimurium is a promising DNA vaccine candidate to mitigate Salmonella infection in poultry. However, the large-scale production of bioactive recombinant OmpC (rOmpC) protein is hindered due to the formation of inclusion bodies in Escherichia coli. The objective of this work was to attain high level expression of rOmpC protein, purify and evaluate its functional properties. The ompC gene was optimized and fused with small ubiquitin-related modifier (SUMO) gene for high level expression as soluble protein. The fusion protein with ~58 kDa molecular weight was observed on SDS-PAGE gel. The expression levels of rOmpC fusion protein reached maximum of 38% of total soluble protein (TSP) after 8 h of 0.2% rhamnose induction. Protein purification was carried out using nickel nitrilotriacetic acid (Ni-NTA) purification column. Western blot were performed to analyse expression and immunoreactivity of rOmpC fusion protein. The results indicate that SUMO fusion system is ideal for large scale production of functional rOmpC fusion protein expression in E. coli.
1. Introduction Salmonella is the most common bacteria that cause foodborne illness worldwide causing millions of cases of illnesses and thousands of deaths annually [1–3]. Poultry meat and eggs are considered to be the major source of Salmonella infection for humans [4]. The most common serovar found in poultry are Salmonella Enteritidis and Typhimurium, and these serovars are responsible for majority of the foodborne salmonellosis [5,6]. Pathogen control strategy at pre-harvest environment is the first line of control to reduce risk of foodborne pathogens in eggs and meat. Vaccination of farmed animals can be very effective to bring Salmonella infection under control, rather than using the conventional preventive methods like disinfection, control of carriers and UV irradiation of hatcheries [7]. Live and killed S. Enteritidis and S. Typhimurium vaccines are currently available for immunization of poultry worldwide. However, these vaccines are not effective against other serovars with different O and H antigens [8]. Surface-associated antigens are found to be promising antigens candidates for the induction of both humoral and cellular immunity to
Salmonella [9]. The nucleotide sequence analysis of ompC gene in different Salmonella serotypes indicates that this gene is highly conserved among Salmonella species [10,11]. Outer membrane proteins are considered effective antigens to stimulate immune responses because they are exposed on the bacterial surface and easily recognized by the host immune system [12–14]. The porin OmpC of Salmonella was identified as the major surface antigen with unique exposed immune epitopes, and can induce both innate and adaptive immunity in chickens [15]. Studies by our group and others proved that OmpC protein of S. Typhimurium has potential as vaccine candidate against salmonellosis [15,16]. Enzyme linked immunosorbent assays (ELISA) based on OmpC proved useful to detect multiple salmonella serovars in poultry [17]. Thus, OmpC has considerable potential in development of vaccines against infection by different Salmonella serovars. High level expression, purification and characterization of immunogenic proteins is important for the development of both improved diagnostic assays and subunit vaccines against salmonellosis in poultry. Heterologous expression systems in E. coli are widely used for recombinant protein development, due to its low cost, ease of
∗ Corresponding author. Centre for One Health Education, Advocacy, Research and Training, Kerala Veterinary and Animal Sciences University, Pookode, Wayanad, Kerala, 673576, India. E-mail address: [email protected] (Prejit).
https://doi.org/10.1016/j.biologicals.2019.10.010 Received 18 June 2019; Received in revised form 17 October 2019; Accepted 19 October 2019 1045-1056/ © 2019 Published by Elsevier Ltd on behalf of International Alliance for Biological Standardization.
Please cite this article as: Prejit, et al., Biologicals, https://doi.org/10.1016/j.biologicals.2019.10.010
Biologicals xxx (xxxx) xxx–xxx
Prejit, et al.
manipulation, and availability of well established molecular tools and techniques [18]. But, E. coli doesn't have the capacity for high level expression of membrane-bound proteins and often majority of the expressed protein will be accumulated in the form of insoluble inclusion bodies. To resolve this problem, many strategies to find the ideal fusion tag have been tested [19]. The small ubiquitin-related modifier (SUMO), is a ~100- residue protein, and following covalent binding to the target protein can modulate its behaviour. SUMO fusion technology is proven tool for prokaryotic expression systems; however, the SUMO tag will be cleaved by SUMO proteases in a eukaryotic organism. The SUMO-fusion tag enhances both expression and solubility of recombinant proteins, while at the same time protecting against proteolytic degradation, facilitating protein purification, and most importantly preserving the native N-terminus following tag removal [20,21]. Researchers have upgrade the SUMO tag, called SUMOstar, which is resistant to cleavage by SUMO protease in eukaryotic expression systems. This SUMOstar tag also maintains enhanced protein expression and solubility as shown in yeast, insect, and mammalian cells [14]. Taking these facts into consideration current work was envisaged to clone and express immunopotent OmpC gene with SUMO fusion tag for attaining higher-levels soluble functional protein in E. coli.
Fig. 1. Schematic representation of pSUMO-OmpC Vector: Vector is driven my Rhamnose promoter, RBS, ribosome binding site; ATG, translation start site; His6, Hexa histidine tag, SUMO Small ubiquitin-related modifier; OmpC, outer membrane protein C insert Stop, translation end site; Kan, kanamycin resistance gene; ROP, Repressor of Priming (for low copy number); Ori, origin of replication. (T) CloneSmart® transcription terminators.
2. Materials and methods
10 min. The amplified products were analyzed by agarose gel electrophoresis in 1.5% agarose containing ethidium bromide (0.5 μg/ml).
2.1. Bacterial strain
2.4. Vector construction and transformation to E. coli
Standard culture strain of Salmonella Typhimurium E−2375 used in this study was procured from National Salmonella centre, Indian Veterinary Research Institute (IVRI), Izatnagar.
The vector pRham™ N-His SUMO (Lucigen) was used for developing the rOmpC protein expression in this study. PCR amplicon of ompC gene (1470 bp) with 18 nt flanking sequences at both the ends was used for enzyme free directional cloning into pRham N-His SUMO expression vector by homologous recombination. 3 μl (~50 ng) of unpurified PCR product was mixed with 25 ng of vector in a PCR tube, to induce enzyme free directional cloning through homologus recombination. The newly constructed vector was designated as pSUMO-OmpC vector (Fig. 1), and was transformed directly into E. cloni 10G competent cells via heat shock method (42 °C for 30 s). Screening of transgenic colonies were done on Luria-Bertani (LB) agar plates containing 30 μg/ml Kanamycin. Overnight grown (37 °C) suspected colonies in selective agar medium and were screened through colony PCR using SUMO-For and pET-Rev primers (Table-1).
2.2. Genomic DNA extraction The extraction of genomic DNA (gDNA) from standard culture of Salmonella Typhimurium was carried out using the Genomic DNA Purification Kit (California, Invitrogen) following manufacturer's instructions. Quality and quantity of gDNA isolated were checked using NanoDrop™ spectrophotometer (Thermo). 2.3. PCR amplification of ompC gene with flanking sequences PCR amplification of ompC gene was performed using gDNA isolated from Salmonella Typhimurium as template. A set of primers were designed with 18 nucleotide (nt) flanking sequence (CGC GAA CAG ATT GGA GGT-) at 5′ end of forward primer and 18 nt sequence (GTG GCG GCC GCT CTA TTA-) at 5′ end of reverse primer for enzyme free directional cloning (Table-1). The PCR reactions were carried out in a T100 Thermal Cycler (Bio-Rad Laboratories, USA). 50 μl reaction mix consist of 1 μl of each primer (0.2 μM), 0.2 mM of deoxynucleotide triphosphates, 1 μl of 50 mM MgSO4 (0.2 mM),1 unit of Platinum™ Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific, USA) in 1 × High Fidelity PCR buffer using 50 ng of gDNA as a template. PCR profile used is as follows: Initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 57 °C for 1 min, and extension at 68 °C for 1 min. Final extension at 68 °C for
2.5. Recombinant protein expression and purification Transgenic E. cloni 10G cells harboring pSUMO-OmpC vector were grown in LB medium (37 °C) till the optical density 600 nm reached 0.2. Rhaminose was added to the media to induce expression of rOmpC fusion protein. Different concentrations of L-rhaminose (0.05%, 0.1% and 0.2%) were tested to optimize high level expression of N-His SUMO-OmpC fusion protein in E. coli cells. Following induction by rhaminose samples were harvested every 2 h from 2 to 12 h to evaluate production level of expressed fusion protein. The total protein extracted were purified under denaturing condition using His-Pur Nickel-nitrilotriacetic acid (Ni-NTA) purification Column (Thermo Fisher Scientific, USA) at room temperature. The purification column with Ni-NTA resin
Table 1 Oligonucleotide primers used in this study. Primers Name
Oligonucleotide sequence
Amplicon size
Reference
ST-OmpC
For-ATGAAAGTTAAAGTACTGTCCCTCC-3′ Rev-TTAGAACTSGTAAACCAGACCCAG-3′ For-5′-CGCGAACAGATTGGAGGTAAAGTTAAAGTACTGTCC-3′ Rev 5′-GTGGCGGCCGCTCTATTAGAACTSGTAAACCAGACC-3′ For- 5′–ATTCAAGCTGATCAGACCCCTGAA–3′ Rev 5′–CTCAAGACCCGTTTAGAGGC–3′
1137 bp
This study
1167 bp
This study
1281 bp
Lucigen Lucigen
SUMO-OmpC SUMO pETite
2
Biologicals xxx (xxxx) xxx–xxx
Prejit, et al.
3.2. Expression and purification of N-His SUMO-OmpC fusion protein
were washed with two bed volume of equilibration buffer (20 mM sodium phosphate, 300 mM sodium chloride (PBS) with 10 mM imidazole; pH 7.4). The column was spun at 700 g for 2 min and the buffer discarded. Soluble recombinant protein isolated was mixed with equal volume of equilibration buffer to load sample into resin column. The column was mixed end-on-end in shaker. The column was spun at 700 g followed by washing with two resin-bed volumes of wash buffer (Phosphate-buffered saline, PBS with 25 mM imidazole; pH 7.4). This was repeated three times. His-tagged proteins were eluted using one resin-bed volume of elution buffer (PBS with 6 M guanidine-HCl and 250 mM imidazole; pH 7.4). Samples collected from elution steps were pooled, desalted and concentrated using PierceTM protein concentrators (Thermo Scientific) with 30 K MW cut off and spun at 4,000 g.The purity of N-His SUMO-OmpC protein was assessed using SDS-PAGE and the concentration was evaluated by the Bradford method.
SDS-PAGE analysis shows the presence of a ~58 kDa recombinant protein (Fig. 3a). The maximum level of expression of the recombinant protein (38% of total protein) was observed 8 h after induction with 0.2% of L-rhamnose (Fig. 3b). Theoretical molecular weight of N-His SUMO OmpC fusion protein was 53.4 kDa but on SDS-PAGE gel the protein size observed was found to be ~58 kDa (Fig.3c). Membrane proteins are covalently attached to carbohydrates or lipid moiety, most of the times and it is generally expected that the molecular weight of these proteins on gels higher than theoretical molecular weight. This phenomenon is termed “gel shifting,” its found to be common in case of membrane proteins, but reason for this to happen is yet to be convincingly explained [22]. 3.3. Results of Western blot analysis The purified recombinant protein was immunostained in Western Blot using 6x-His Tag Monoclonal Antibody (Invitrogen), which probes the N′ terminal 6x-His tag of recombinant fusion protein. Western blot analysis confirmed the expression of ~58 kDa recombinant protein in E. coli (Fig. 4a). Sera from two chickens, which were infected with Salmonella, contained anti-OmpC IgY that reacted strongly with the N-HisSUMO-OmpC fusion protein in Western blot. Negative serum did not react (Fig. 4b).
2.6. Western blot analysis Western blotting was carried out to confirm the molecular mass of the purified recombinant NHis SUMO OmpC fusion protein recombinant proteins using an anti-6 × His monoclonal antibody as probe. Following electrophoresis in a 10% SDS-PAGE gel, proteins were transferred to a nitrocellulose membrane by applying a current at 80 V for 30 min. The membrane was blocked with 3% skimmed milk in 1x Tris Buffered Saline with Tween 20 (TBST) at 4 °C and incubated overnight with 6X-his Tag. After three wash steps with TBST, the membrane was immersed in 250 μl of 3,3′-Diaminobenzidine (DAB)peroxidase substrate solution (0.3% H2O2 in 5 ml PBS) to develop bands indicating immunoreactive proteins. Reaction was stopped by rinsing the membrane in distilled water.
4. Discussion The expression, purification and characterization of immunogenic proteins are important for the development of both improved diagnostic assays and subunit vaccines against salmonellosis in poultry. Emergence of multi drug resistant Salmonella has led researchers to a focus towards developing novel vaccines that offer improved safety, comprehensive immunity, and highly cross-protective efficiency against heterologous Salmonella stains [23,24]. A large number of proteins are currently being tested for their immunological or protective applications as vaccines against salmonellosis. A variety of Salmonella OMPs, including OmpA, OmpC, OmpD, OmpF, Omp28 have been studied related to these aspects in recent decades [25,26]. OMPs are found to be a good immunogen to use in various diagnostics and vaccine studies [12,15,27]. Among these OMPs, OmpA of S. Enteritidis induces humoral immune response in chicken, but no protection was attained against homologus challenge [12]. OmpF has proved to be immunogenic in mice [28] and OmpC of S. Typhimurium has proved to be immunogenic in chickens [15]. In a recent study by Dai et al. [29], mice immunized with recombinant spores produced significant levels of antiOmpC serum IgG and mucosal secretory IgA, and oral immunization with recombinant spores induced protection of mice against a lethal challenge with S. Typhimurium. The natural abundance of membrane proteins is typically too low to isolate sufficient amounts of material for functional and structural studies. Therefore, membrane proteins must be obtained by overexpression, and the bacterium E. coli is the most widely used vehicle for this [30]. E. coli expression system continues to dominate the bacterial expression systems due to its simplicity, speed, and low cost. It remains to be the preferred system for laboratory investigations and initial development in commercial activities or as a useful benchmark for comparison among various expression platforms. This availability and the large number of expression vectors make E. coli the preferred host for production of recombinant proteins [31]. However, in E. coli heterologous proteins often cannot be expressed in a high quantity, can be incorrectly folded, or are available as insoluble aggregates only; these recombinant proteins lack characteristics of the native protein. The advances made in the field of recombinant DNA technology in recent years have made possible large scale production of functional proteins. The use of fusion tags for high-throughput expression and purification
2.7. Detection of chicken anti-OmpC IgY by Western blot A modification of the technique described above was used to detect IgY antibodies against OmpC in sera collected from six chickens (Breed: White leghorn) with salmonellosis that was confirmed by PCR analysis of cloacal swabs. Briefly, the purified NHis SUMO OmpC protein was run on an SDS-PAGE gel and transferred to a nitrocellulose membrane. The membrane was blocked and cut into vertically strips containing a lane each. Strips were incubated for 60 min with sera diluted 1:50 (with PBST). Strips were washed three times with TBST and incubated for 60 min with rabbit anti-chicken IgY horseradish peroxidase conjugate diluted 1:10000 (Invitrogen) at 37 °C). After incubation, the membranes were washed three times in TBST. Membranes were washed and exposed to DAB-peroxidase substrate solution for 10 min. The enzymatic reaction was stopped by washing the membrane with distilled water. The appearance of a brown band indicated a positive reaction.
3. Results 3.1. pSUMO-OmpC vector construction The modified 1137 bp ompC gene of S. Typhimurium was anchored with 18 nt flanking sequences at 5′ and 3′ ends and amplified using the SUMO-OmpC forward and reverse primers to obtain 1167 bp amplified DNA fragment (Fig. 2a). The 1167 bp amplicon was cloned into pRham N-His SUMO vector by enzyme free directional cloning. The newly constructed vector pSUMO-OmpC was transformed into E. cloni 10G competent cells. Transformants containing the pSUMO-OmpC insert were confirmed by colony PCR (Fig. 2b). Sequencing results confirmed the ompC gene insert was in right orientation and without any errors. The sequence of optimized N-His-SUMO-OmpC gene was submitted to the data base nucleotide sequence (GeneBank: MF136770). 3
Biologicals xxx (xxxx) xxx–xxx
Prejit, et al.
Fig. 2. a: PCR; Lane 1–5, Modified 1167bp amplicon of ompC gene with 18 nt flanking sequences at both ends. Lane-6, Native 1137 bp amplicon of ompC gene of Salmonella Typhimurium, Lane-7, negative control. Fig. 2b: Colony PCR: lane 1–5 transgenic colonies with1296 bp amplicon region of pSUMO-OmpC vector insert, Lane 6Un-transformed colony as -ve control.
Fig. 3. SDS-PAGE analysis: (a) Lane-1, 10% SDS-PAGE gel with TSP isolated from un-transformed E. coli cells; Lane-2, TSP from E. coli with pSUMO-OmpC insert. (b) Standardisation rhamnose induction for N-His-SUMO-OmpC fusion protein expression, Lane-1, Un induces cells, lane 2, TSP from 0.05% rhamnose induced cells, lane-3, 0.1% rhamnose induction, Lane-4, 0.2% rhamnose induction. (c) Ni-NTA purified ~58 kDa N-His-SUMO-OmpC fusion protein in 12% gel.
toxic nature was successfully expressed in E. coli by use of tunable rhamnose promoter and SUMO fusion tag [35]. On Western blot analysis, the positive sera reacted strongly with recombinant protein which confirmed that the protein is highly immunogenic in nature. These data clearly justify the fact that the use of SUMO fusion tag method enables high protein expression and solubility along with easy detection of difficult to express proteins in E. coli [19]
is a method of choice in recent years. Heterologous expression system E. coli is one of the popular choice for large scale production of recombinant proteins. Maltose binding protein (MBP), glutathione Stransferase (GST), and small ubiquitin-like modifier (SUMO) are commonly used fusion tags [32]. Each of these tags provide improved expression and/or solubility of complex recombinant proteins in fused form [33]. In a study by Marblestone et al. [32], when three different test proteins were fused to the C termini of maltose‐binding protein (MBP), glutathione S‐transferase (GST), thioredoxin (TRX), NUS A, ubiquitin (Ub), and SUMO tags. These constructs were expressed in E. coli and evaluated for expression and solubility. SUMO expression system was superior to commonly used fusion tags in enhancing expression and solubility with the distinction of generating recombinant protein with native sequences. The expression of antimicrobial peptide (AMPs) was difficult earlier due to their cytotoxicity to host bacterial cells, sensitivity to proteolytic degradation, and low production yield. An antimicrobial peptide ABPdHC-cecropin A with potent activity against a wide range of bacterial species was expressed by SUMO fusion in E. coli with expression levels was as high as 65 mg/L, with ~21.3% of the fusion protein in soluble form [34]. In another study difficult express α-lufin protein, due to its
5. Conclusion This study confirms that the use of SUMO tag increases the production of functional rOmpC fusion protein in the form of soluble fractions, making it easy to isolate and purify protein from E. coli cells. This technique can be used as a reliable resource for the expression and purification of other valuable proteins in future. Westen blot analysis rOmpC fusion protein established that it had immunogenic potential, and therefore can be used as a suitable candidate for immunodiagnostics and for development of subunit vaccine against salmonellosis.
4
Biologicals xxx (xxxx) xxx–xxx
Prejit, et al.
[10] Prejit, Agarwal RK, Bhilegaonkar KN. PCR based detection of the ompC gene in Salmonella serovars. Indian J Comp Microbiol Immunol Infect Dis 2009;30:91–4. [11] MacLennan Calman A, Martin Laura B, Micoli Francesca. Vaccines against invasive Salmonella disease: current status and future directions. Hum Vaccines Immunother 2014;10:1478–93. [12] Okamura M, Ueda M, Noda Y, Kuno Y, Kashimoto T, Takehara K, et al. Immunization with outer membrane protein A from Salmonella enterica serovar Enteritidis induces humoral immune response but no protection against homologous challenge in chickens. Poult Sci 2012;91(10):2444–9. [13] Jawale CV, Lee JH. Evaluation of immunogenicity and protective efficacy of adjuvanted Salmonella Typhimurium ghost vaccine against salmonellosis in chickens. Vet Q 2016;36(3):130–6. [14] Liu Q, Liu Q, Zhao X, Liu T, Yi J, Liang K, et al. Immunogenicity and cross-protective efficacy induced by outer membrane proteins from Salmonella Typhimurium mutants with truncated LPS in mice. Int J Mol Sci 2016;17(3):416. [15] Prejit, Agarwal RK, Porteen K, Dubal ZB, Asha K, Shweta S, et al. Evaluation of recombinant outer membrane protein based vaccine against Salmonella Typhimurium in birds. Biologicals 2013;41(3):162–8. [16] Jha R, Kumar A, Saxena A, Tamuly S, Saxena MK. Cloning, sequencing and in silico analysis of omp C of Salmonella typhimurium. ISRN Vet Sci 2012;2012:7. https://doi. org/10.5402/2012/512848. 512848. [17] Manoj J, Agarwal RK, Sailo B, Wani MA, Singh MK. Evaluation of recombinant outer membrane protein C based indirect enzyme-linked immunoassay for the detection of Salmonella antibodies in poultry. Vet World 2015;8(8):1006. [18] Rosano GL, Ceccarelli EA. Recombinant protein expression in Escherichia coli: advances and challenges. Front Microbiol 2014;5:172. [19] Jia B, Jeon CO. High-throughput recombinant protein expression in Escherichia coli: current status and future perspectives. Open Biol. J. 2016;6(8):160–96. [20] Wang X, Liu H, Liu Y, Li Y, Yan L, Yuan X, et al. A novel strategy for the preparation of codon-optimized truncated Ulp1 and its simplified application to cleavage the SUMO fusion protein. Protein J 2016;35(2):115–23. [21] Satakarni M, Curtis R. Production of recombinant peptides as fusions with SUMO. Protein Expr Purif 2011;78(2):113–9. [22] Rath A, Glibowicka M, Nadeau VG, Chen G, Deber CM. Detergent binding explains anomalous SDS-PAGE migration of membrane proteins. Proc Natl Acad Sci 2009;106(6):1760–5. [23] Liu Qiong, Liu Qing, Yi Jie, Liang Kang, Tian Liu, Kenneth L, et al. Outer membrane vesicles derived from Salmonella Typhimurium mutants with truncated LPS induce cross-protective immune responses against infection of Salmonella enterica serovars in the mouse model. Int J Med Microbiol 2016;306(8):697–706. [24] Mahan MJ, Heithoff DM, House JK. Salmonella cross-protective vaccines: fast-forward to the next generation of food safety. Future Microbiol 2012;7:805–8. [25] Pérez-Toledo M, Valero-Pacheco N, Pastelin-Palacios R, Gil-Cruz C, PerezShibayama C, Moreno-Eutimio MA, et al. Salmonella Typhi porins OmpC and OmpF are potent adjuvants for T-dependent and T-independent antigens. Front Immunol 2017;8:230–8. [26] Saxena A, Kumar R, Saxena MK. Vaccination with Salmonella Typhi recombinant outer membrane protein 28 induces humoral but non-protective immune response in rabbit. Vet World 2017;10(8):946. [27] Porteen K, Agarwal RK, Prejit Nithya Q, Ruban SW. Recombinant OmpC subunit vaccine facilitate satisfactory protection against challenge dose of Salmonella typhimurium in mice model. Gene Ther Mol Biol 2014;16(1):88–94. [28] Toobak H, Rasooli I, Talei D, Jahangiri A, Owlia P, Darvish Alipour Astaneh S. Immune response variations to Salmonella enterica serovar Typhi recombinant porin proteins in mice. Biologicals 2013;41:224–30. [29] Dai X, Liu M, Pan K, Yang J. Surface display of OmpC of Salmonella serovar Pullorum on Bacillus subtilis spores. PLoS One 2018;13(1):1916–27. [30] Wagner S, Klepsch MM, Schlegel S, Appel A, Draheim R, Tarry M, et al. Tuning Escherichia coli for membrane protein over-expression. Proc Natl Acad Sci 2008;105(38):14371–6. [31] Chen R. Bacterial expression systems for recombinant protein production: E. coli and beyond. Biotechnol Adv 2012;30(5):1102–7. [32] Marblestone JG, Edavettal SC, Lim Y, Lim P, Zuo X, Butt TR. Comparison of SUMO fusion technology with traditional gene fusion systems: enhanced expression and solubility with SUMO. Protein Sci 2006;15(1):182–9. [33] Steinmetz EJ, Auldridge ME. Screening fusion tags for improved recombinant protein expression in E. coli with the Expresso® solubility and expression screening system. Curr Protoc Prot Sci 2017;5(27). https://doi.org/10.1002/cpps. 1–5.27.20. [34] Zhang J, Movahedi A, Wei Z, Sang M, Wu X, Wang M, et al. High-level SUMOmediated fusion expression of ABP-dHC-cecropin A from multiple joined genes in Escherichia coli. Anal Biochem 2016;509:15–23. [35] Namvar S, Barkhordari F, Raigani M, Jahandar H, Nematollahi L, Davami F. Cloning and soluble expression of mature from Luffa cylindrica in E. coli using SUMO fusion protein. Turkish J Biol 2018;42(1):23–32.
Fig. 4. (a)Western blot analysis of recombinant His tag-OmpC. Lane M: Fermentas prestained protein marker SM0671. Lane 1: Negative control; Lane 2: ~58 kDa N-His SUMO-OmpC protein. (b) Western assay with rabbit anti chicken IgY Ab, Lane 1–2; salmonella positive serum samples.
Declaration of competing interest The authors declare that they have no competing interests. Acknowledgments The authors cordially thank Department of Biotechnology, India (Ref. No. BT/PR5796/ADV/90/146/2013 of DBT, India ) for providing funds for the project. References [1] Majowicz SE, Musto J, Scallan E, et al. The global burden of non-typhoidal Salmonella gastroenteritis. Clin Infect Dis 2010;50:882–9. [2] Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson M, Roy SL, et al. Foodborne illness acquired in the United States-major pathogens. Emerg Infect Dis 2011;1:7–15. [3] Obaro SK, Iroh Tam PY, Mintz ED. The unrecognized burden of typhoid fever. Expert Rev Vaccines 2017;16(3):249–60. [4] EFSA. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2011. EFSA J 2013;11:19–73. [5] Hendriksen RS, Vieira AR, Karlsmose S, Lo Fo Wong DM, Jensen AB, Wegener HC, et al. Global monitoring of Salmonella serovar distribution from the world health organization global foodborne infections network country data bank: results of quality assured laboratories from 2001 to 2007. Foodb Pathog Dis 2011;8(8):887–900. [6] Foley Steven L, et al. Population dynamics of Salmonella enterica serotypes in commercial egg and poultry production. Appl Environ Microbiol 2011;77(13):4273–9. [7] Dar MA, Ahmad SM, Bhat SA, Ahmed R, Urwat U, Mumtaz PT, et al. Salmonella typhimurium in poultry: a review. World’s Poult Sci J 2017;73(2):345–54. [8] Noda T, Murakami K, Ishiguro Y, Asai T. Chicken meat is an infection source of Salmonella serovar Infantis for humans in Japan. Foodb Pathog Dis 2010;7:727–35. [9] Barat S, Willer Y, Rizos K, Claudi B, Maze A, Schemmer AK, et al. Immunity to intracellular Salmonella depends on surface-associated antigens. PLoS Pathog 2012;8(10).
5