Expression and purification of human WWP2 HECT domain in Escherichia coli

YPREP 4625

No. of Pages 7, Model 5G

29 December 2014 Protein Expression and Purification xxx (2014) xxx–xxx 1

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep 5 6 3

Q1

4 7 8 9 10 11 1 2 3 5 14 15 16 17 18 19 20 21 22 23 24

Q2

Expression and purification of human WWP2 HECT domain in Escherichia coli Jiahong Jiang a, Jimin Zheng a,⇑, Zongchao Jia b a b

College of Chemistry, Beijing Normal University, Beijing, China Department of Biochemical and Molecular Sciences, Queens University, Kingston, Ontario, Canada

a r t i c l e

i n f o

Article history: Received 25 October 2014 and in revised form 10 December 2014 Available online xxxx Keywords: Human WWP2 HECT domain expression Purification Escherichia coli Pull-down assay

a b s t r a c t WWP2 (WW domain-containing protein 2) is an E3 ubiquitin ligase belonging to the NEDD4-like protein family involved in various cell regulations, such as carcinogenesis, transcription control and cellular transport. Compared with homologues, WWP2 is difficult to express and no practical protocols have been developed for WWP2 preparation in large scale. Recently, domain structures of homologues of WWP2 have been determined by crystallography and NMR, but none for WWP2 has been attained. In this work, through a combination of extensive screening of 100 constructs, expression strategies and host systems, we have found a soluble HECT domain truncation (WHP2) of WWP2 which is amendable for preparation scale expression in Escherichia coli. We have also established a relatively simple purification process to achieve highly pure WHP2 protein by employing immobilized metal-affinity chromatography followed by salting out, ion exchange chromatography and finally, size exclusion chromatography. We are able to obtain about 60 mg/L of the soluble WHP2. The identity and structure of the expressed WHP2 have been analyzed by mass spectrometry and circular dichroism. The native ability of WHP2 to bind different partners has been revealed by pull-down assay. Ó 2014 Published by Elsevier Inc.

26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41

42 43

Introduction

44

WWP2, also known as atrophin-1-interactingprotein 2, or AIP-2, is an E3 ubiquitin ligase consisting of 870 amino acids (AAs)1 and belongs to the NEDD4-like protein family [1]. There are nine members of the Nedd4-like E3 family, all of which share a similar overall domain architecture, including a C2 (protein kinase C conserved region 2) domain at the N-terminus, and a HECT (homologous to E6-AP C terminus) domain at the C-terminus (Fig. 1). In addition, there are two to four WW domains between the C2 and HECT domains which are capable of binding substrates and E2 (UBcH7). In order to avoid excessive ubiquitination of substrates and WWP2 itself leading to unfavorable protein degradation, the intermediate sequence including the four WW domains provides flexibility so that the C2 domain of WWP2 binds in the vicinity of the catalytic cysteine (C838), where it interferes with Ub thioester formation. This

45 46 47 48 49 50 51 52 53 54 55 56 57

⇑ Corresponding author. Tel.: +86 10 58806002. E-mail address: [email protected] (J. Zheng). 1 Abbreviations used: WWP2, WW domain-containing protein 2; AA, amino acid; IPTG, isopropyl b-D-thiogalactoside; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; CBB, Coomassie Brilliant Blue; LC MS/MS, liquid chromatography tandem mass spectrometry; CD, circular dichroism; E2, ubiquitin-conjugating enzyme; PBS, phosphate-buffered saline.

inactive form will be retained until docked substrates unlock the WWP2 molecule. As a result, this intra-molecular interaction between the C2 and HECT domains inhibits WWP2 activity to stabilizes WWP2 levels in cells and similarly, inhibits other C2-WWHECT-domain E3s, including WWP1 and Smurf2. Although C2 domain can be involved in protein interaction in some cases [2,3], NEDD4 family proteins recruit substrates mainly by WW domains or HECT domain. WW domains recognize target proteins via PY motif (PPXY) or certain residues on substrates [4,5]. Most substrates reported are of this kind [6–8]. For WWP2, very few HECT binding substrates have been discovered and up to 2011, only Smad7 was identified [9]. Subsequently, PTEN was revealed as a new substrate of WWP2 where it exhibited physical interaction via its HECT domain [10]. This finding has inspired us to investigate how WWP2 HECT domain targets its unique substrates and more experiments are needed to cast light on the molecular mechanism. As such, a robust approach to production of high quality protein is required for both biochemical and biophysical experiments. In previous reports, HECT domain of mouse WWP2 was expressed in bacteria for pull-down experiments [11]; the same truncation was prepared using HEK293 cell for human WWP2 in the subsequent publication [7]. In the interacting domain mapping experiment for human WWP2 and PTEN, all WWP2 truncations

http://dx.doi.org/10.1016/j.pep.2014.12.013 1046-5928/Ó 2014 Published by Elsevier Inc.

Q1 Please cite this article in press as: J. Jiang et al., Expression and purification of human WWP2 HECT domain in Escherichia coli, Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.013

58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81

YPREP 4625

No. of Pages 7, Model 5G

29 December 2014 2 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106

J. Jiang et al. / Protein Expression and Purification xxx (2014) xxx–xxx

were prepared from mammalian cell [10]. As a result of small amounts of protein, biophysical experiments involving WWP2 HECT domain, such as ITC that requires high quantity of soluble protein sample, have not been reported. This can be attributed to a lack of protocol generating soluble HECT domain. Meanwhile, no such a commercial product is available. Thus far no structures of WWP2 have been revealed; only domain structures of the closely associated members in the HECT family of E3 ligases have been attained by NMR [12,13] or protein crystallography [14,15]. Additionally, several complex structures are available [15,16]. Here in we have performed extensive construct screening through combination of different fusion tags (GST/His/Nusa/MBP/ SUMO) and encoding gene sequences. We have successfully found a construct (named WHP2) amendable for expressing soluble HECT domain of human WWP2 plus the last two WW domains in high yield from Escherichia coli. High purity of this N-His tagged protein was achieved by four purification steps employing immobilized metal-affinity chromatography followed by salting out and an ion exchange process. Finally, size exclusion chromatography was applied to elute the final product. A yield of 60 mg/L of the recombinant protein was achieved. Protein identity and secondary structure of the purified WHP2 were confirmed by mass spectrometry and circular dichroism. In addition, we show that WHP2 protein is capable of binding E2 (UBcH7) and substrate PTEN.

107

Materials and methods

108

Plasmids construction and construct screening

109

The nucleotide sequences encoding human WWP2 (BC013645) truncation genes were amplified from human placenta cDNA library (Biosciences Source). Construct genes were sub cloned into original or modified vectors (Table 1) by standard clone strategy. In order to generate EcoR1 restrict site identical to pET-Duet1 plasmid, multiple cloning site (MCS) of original pET-44A (+) and pGEX6P-1 plasmid were modified by primer induced site-directed mutagenesis. All plasmids were verified by gene sequencing and correct ones were subjected to construct screening process. The truncation protein covering the last two WW domains and HECT domain of WWP2 was named as WHP2 for short (Fig. 1). WHP2 gene encoding 475 AAs (391–865) is 1425 bp in length and inserted into pET-Duet1 vector (Novagen) in RBS1 (ribosome binding site1) by restriction sites EcoR1 and Xho1 (primer sequence: FP CCGGAATTCCCTCTACCAGTCTTCGAGTGCT, RP CTCGA GTTACTCGGTCTCCTCAAT). Other parallel constructs of different HECT truncation genes for different vectors were obtained by the similar protocol. It was reported that the last 5 AAs at C-terminus

110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126

Fig. 1. Schematic representation of the modular architecture of WWP2. WWP2 architecture is composed of C2 domain, WW domain and HECT domain. Between WW2 and WW3, a hydrophilic AA sequence increase intra-molecular flexibility. The region covered by WHP2 is highlighted in red box. Domain boundaries were divided in accordance with analysis result by ScanProsite (http://prosite.expasy.org/ scanprosite/) and comparison with homologues. Terminal AA positions of some truncations were marked in blue. Red spot represents the catalytic cysteine (C838) on HECT domain. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

of HECT E3s impairs crystallization and thus was removed [15]. Similarly, we also deleted the last 5 AAs and used N-terminal fusion tag to avoid adding extra residues in the C-terminus of the corresponding constructs. The selection of WHP2 construct was based on the analysis result from on line server (http://ch.embnet. org/software/COILS_form.html). Other constructs were designed on the basis of secondary structure prediction or crystal structure of the HECT domain of WWP1.

127

Bacterial cultivation

135

Bacterial strain TOP10 was used for general cloning and plasmid maintenance, whilst cell strains for protein expression and other variables are listed (Table 1). All transformations were performed by heat-shock transformation. Cells were then shaken at 37 °C for 50 min and streaked on LB plates supplemented with 100 mg/L ampicillin or kanamycin. Positive colonies were selected to isolate plasmid DNA, which was digested with appropriate enzymes to confirm the presence of desired gene fragment which was visualized electrophoretically (1.5% agarose gel, TAE buffer). Finally, plasmids were sequenced to confirm no mutations had occurred. Cell cultivation conditions using LB media (10 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl; pH 7.2) were as follows: 1 ml of LB medium in 2 ml EP tube supplemented with antibiotic was inoculated with a single colony and incubated on an orbital shaker at 180–200 rpm at 37 °C for 3–4 h. Subsequently, turbid media was used to scale up culture volume. For the initial construct screening, cell culture was seeded into 100 ml of LB media in 250 ml flask supplemented with the antibiotic. Cells were grown to OD600 = 1 and induced by 1 mM IPTG at 16 °C and 26 °C for 12 h. Cell pellet was harvested in 50 ml Corning tube by centrifuge for SDS–PAGE analysis. For expression optimization of WHP2, cell was cultivated in 1 L LB using baffled shake-flasks and induced with the addition of 0.2 mM IPTG at three different temperature (16, 26 and 36 °C) for 3, 7, and 16 h post induction, respectively. 100 ml samples were cultured and analyzed on SDS–PAGE. For inducible expression of WHP2, transferred BL21 (DE3) cells were grown to OD600 = 1 and induced by 0.2 mM IPTG at 23 °C for 7 h. Then cells were harvested by centrifugation at 4 °C, 4,500 rpm for 30 min. Clean water was used to suspend cell pellet for a couple of times and removed by centrifugation. Finally, cell was stored at 80 °C. All the rest experiments were performed at 4 °C in a cold chamber.

136

Cell disruption and affinity chromatography

169

WHP2 cell pellet was suspended in chilled lysis buffer (50 mM Tris–HCl, pH 8.0, 300 mM NaCl, 10% glycerol, 1 mM PMSF, 40 g/ml Dnase I) and stirred in a cold chamber. Dispersed cell was processed by glass homogenizer and applied to French press (Thermo Scientific), 1200 psi for 2 cycles. Whole cell lysate was centrifuged at 4 °C, 18,000 rpm for 30 min. After removing cell debris, supernatant was diluted using binding buffer (50 mM Tris–HCl, pH 8.0, 300 mM NaCl, 5 mM b-ME) for a few times before loading onto a pre-equilibrated Hitrap TALON Superflow column (GE Healthcare). When unbound protein had been washed off, protein fractions were eluted by binding buffer supplemented with 150 mM imidazole. Protein concentration was analyzed by Bradford method (Bio-Rad) and elution was concentrated to 5–10 mg/ml using 10 kDa cutting off Centricon (Millipore).

170

Salting out

184

Concentrated sample was incubated at 4 °C for 12–24 h and precipitant was removed by centrifugation. Supernatant was

185

Q1 Please cite this article in press as: J. Jiang et al., Expression and purification of human WWP2 HECT domain in Escherichia coli, Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.013

128 129 130 131 132 133 134

137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168

171 172 173 174 175 176 177 178 179 180 181 182 183

186

YPREP 4625

No. of Pages 7, Model 5G

29 December 2014 3

J. Jiang et al. / Protein Expression and Purification xxx (2014) xxx–xxx Table 1 WHP2 constructs. Vectors Original pET-Duet1 pET-Duet1 pET-28b pET-28b pET44a+ pGEX6P-1

Construct AA Tag N-his-SUMO N-his N-His-MBP N-his N-his-Nusa GST

Modified to SUMO-Duet1 MBP-28b MpET44a+ MpGEX6P-1

Cell strains

Start from

C termini

For entire HECT domain 391 480 494 495 507 512 513 536 554

865 or 870 865 865 865 865 865 865 865 865

BL21 (DE3) BL21 (DE3)lysis BL21RP BL21 (RIL) DL41

For fragments of HECT domain 495 623 495 751 512 623 536 623 536 751 554 623 554 751 Variables

6

16

5

Note: In order to reduce the number of experiments, expression trials were only performed at 16 and 26 °C using BL21 (DE3) and BL21 RP (CodonPlus). In further optimization, more variables were involved, including concentration of IPTG, 3 temperatures (16, 23 and 36 °C) and induction time.

191

titrated into 50% (w/v) ammonium sulfate solution (pH 8.0) drop by drop with mild stirring. The volume of ammonium sulfate solution was about 10 times of sample to precipitate protein completely at 4 °C for 1 h. Supernatant was discarded after centrifugation at 4 °C, 12,000 rpm.

192

Anion-exchange chromatography and size exclusion

193

Protein precipitated by ammonium sulfate was dissolved in IEX buffer A (20 mM Tris–HCl, pH 8.0). Insoluble precipitant was removed and supernatant was filtered by 0.2 lm syringe filter (Sartorius). Sample was loaded on DEAE Fast Flow column (GE Healthcare) and fractioned with linear gradient elute by IEX buffer B (20 mM Tris–HCl, pH8.0, 500 mM NaCl). Pooled fractions were subjected to desalting column (GE Health) equilibrated by gel filtration buffer (5 mM PBS, pH 6.8, 100 mM NaCl, 10 mM b-ME, 2% glycerol). WHP2 protein was concentrated by Centricon (Millipore) to 5 mg/ml for size exclusion chromatography. Fractions were eluted from HiLoad Superdex200 16/60 for SDS–PAGE analysis and samples within the narrow peak of WHP2 were pooled.

187 188 189 190

194 195 196 197 198 199 200 201 202 203 204 205

SDS–PAGE and Western blot

206

211

Samples were mixed with loading buffer at the ratio of 1:4 (v/v), incubated at 95 °C for 10 min. Cooled samples were loaded onto 12% polyacrylamide gels to analyze distribution of WHP2 and visualized by CBB staining. Quantity One software (BioRad) was used for gel analysis via band density. Accordingly, Western blot was performed using anti-His monoclonal antibody-HRP conjugate.

212

LC MS/MS spectrometry and circular dichroism

213

Excised gel band of WHP2 from SDS–PAGE was cut for LC MS/MS spectrometry using the similar method described elsewhere [18]. Purified WHP2 protein was resuspended in deionized water to a final concentration of 0.275 mg/ml. CD spectra were recorded on Chirascan™-plus CD Spectrometer (Applied Photophysics) with the following parameters: temperature 25 °C, cell length 3 mm, measure range 190–250 nm, data pitch 0.1 nm, standard sensitivity, D.I.T. 1 s, bandwidth 1 nm, scanning speed 50 nm/min, 4 accumulations.

207 208 209 210

214 215 216 217 218 219 220

Spectra were acquired by averaging eight scans and corrected for buffer signal.

221

Interaction with binding partners

223

Another two recombinant fusion proteins, GST-PTEN and GSTE2 (UBcH7) were expressed using pGEX6P-1 vector in E. coli to be tested as binding partners. Cell transferred by empty pGEX6P1 plasmid was used to express GST tag as a control. Glutathioneagarose resin (GE Healthcare) was equilibrated using GST binding buffer (100 mM PBS, pH 6.8, 300 mM NaCl, 5 mM DTT) and the beads were suspended for separation into 3 gravity columns (Bio-Rad) equally, about 0.5 ml slurry each share. Then column plugs at the bottom were removed until extra slurry buffer in the columns was discarded. Cells expressing WHP2 from 100 ml culture was mixed with GST-protein-expressing cells from 100 ml culture. Cell pellet was suspended using 5 ml GST binding buffer for ultrasonic disruption. The three aliquots of supernatant were isolated by centrifuge at 4 °C, 12,000 rpm for 30 min and transferred to the blocked gravity columns mentioned above by gentle mixing with beads at interval. Slurries were incubated at 4 °C for 1 h and then the supernatant was removed. Resins were washed using GST binding buffer and GST wash buffer (100 mM PBS, pH 6.8, 500 mM NaCl, 5 mM DTT) in turns for a couple of times. Finally, the resin was suspended using 3 ml GST binding buffer supplemented with 15 mM glutathione to get eluted fraction which was subjected to SDS–PAGE and detected by Western blot using anti-His antibodies. At the same time, duplicated gel was subjected to Western blotting using anti-GST antibodies to serve as input.

224

Results

249

Plasmid construction and construct screening

250

We performed systematic construct screening of WWP2, including full length WWP2, individual domains and tandem domains. For HECT domain, the constructs were designed in attempts to contain the entire domain and especially, the first one of three AAs sequence which determines the difference between the two

251

Q1 Please cite this article in press as: J. Jiang et al., Expression and purification of human WWP2 HECT domain in Escherichia coli, Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.013

222

225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248

252 253 254 255

YPREP 4625

No. of Pages 7, Model 5G

29 December 2014 4

J. Jiang et al. / Protein Expression and Purification xxx (2014) xxx–xxx

280

HECT domains of WWP1 and WWP2. As indicated in Fig. 1, WHP2 sequence starts in the middle of a hydrophilic sequence between hydrophobic domains. WW2 and WW3 plasmids sequencing demonstrated that the target genes were inserted into vector correctly and no unexpected mutation occurred. Besides WHP2, there were totally 9 construct genes encoding entire HECT domain with different N-terminus and 7 construct genes for HECT fragments. By combining different forward primers and reverse primers, we generated various HECT truncation genes which were inserted into the vectors (Table 1), but only one out of 96 constructs generated soluble protein, namely WHP2. In most bacteria cell strains, especially BL21 (DE3) and BL21RP, WHP2 protein was expressed well and clear protein band was observed from the whole cell lysate using SDS–PAGE by CBB staining (data not shown). In contrast, the rest of constructs produced either trace quantity of protein not feasible to purify or nothing at all. We have made several changes in the WHP2 plasmid, including introducing protease cleavage sites and changing the starting position in the vicinity of the 391st residue, but these minor changes in the WHP2 plasmid led to no improvement. Other strategies were also attempted, such as co-expression of modified WHP2 gene with binding partner genes by individual plasmids or inserting the modified WHP2 gene and binding partner genes in the same pETDuet1 plasmid (RBS1 and RBS2). In parallel trials, we attempted to express HECT domain alone using insect cell, but no positive result was achieved.

281

Expression condition optimization

282

297

Expression optimization of WHP2 was focused on induction time and temperature. As shown in Fig. 2B, higher temperature promotes inclusion body formation. Likewise, the amount of soluble WHP2 protein in whole cell lysate decreased after longer time induction (Fig. 2A). The CBB stained band was observed migrating 58 kDa which corresponds to the calculated molecular weight for the His-tagged WHP2. The identity of this band was also confirmed by Western blotting (Fig. 3B). In order to prepare WHP2 in a larger scale, WHP2 protein had also been expressed in 10 L fermentor containing 8.0 L LB medium, but no significant improvement in protein yield was achieved. In addition, increased IPTG concentration did not change WHP2 expression significantly. At the end, the optimal expression of the recombinant WHP2 is at 23 °C using 0.2 mM IPTG for 7 h. A cell OD600 about 1 is appropriate for induction and 9 g cell by wet weight is harvested from 1 L LB culture on average.

298

Protein purification

299

Supernatant of WHP2 cell lysate was filtered and loaded onto immobilized nickel affinity chromatography column on FPLC to elute WHP2 protein (Fig. 3A). Practically, a lower flow speed as well as lower sample concentration benefited the interaction between protein and beads. In order to induce misfolded protein to precipitate during incubation, an increased protein concentration around 10–15 mg/ml is required. After salting out, irreversibly precipitated protein was removed and the rest of WHP2 protein dissolved in buffer was stable. In practical, a fast dilution of WHP2 by IEX buffer A to a low concentration, no more than 1 mg/ml was necessary to prevent protein aggregation before loading onto DEAE column. As shown in Fig. 4, unbound WHP2 protein was removed and eluted fraction was pooled for concentration. It should be emphasized that NaCl was required to stabilize monomerized WHP2 protein during purification. When WHP2 was concentrated at over 20 mg/ml, buffer salted by 300–500 mM NaCl could effectively prevent protein aggregation in Centricon. Consequently, a high yield could be achieved. On the contrary, when the concentration of WHP2 was decreased, less NaCl was

256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279

283 284 285 286 287 288 289 290 291 292 293 294 295 296

300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317

Fig. 2. Expression profile of WHP2. (A) SDS–PAGE of supernatant from induced cell. (B) SDS–PAGE of inclusion body from induced cell. (1) MW: molecular weight marker. Induction temperature: 16 °C for (2)–(4); 23 °C for (5)–(7); 36 °C for (8)– (10). Total induction time: 3 h for (2), (5), (8); 7 h for (3), (6), (9); 16 h for (4), (7), (10). WHP2 band is marked by a red arrow. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Fig. 3. SDS–PAGE analysis of WHP2 protein purified by TALON column from bacterial lysate. (A) MW: pre-stained protein Marker (Thermal) with apparent MW marked for individual bands; Lane A2: eluted protein fraction from TALON column (B) Western blotting analysis of the duplicated gels transferred onto PVDF membrane and probed with a mouse monoclonal anti-His-HRP conjugated antibody. Sample loaded onto lane A2 was 5 times of that on lane B2.

needed. So far, three buffers including Tris–HCl (pH 8.0), PBS (pH 7.0) and HEPES (pH 7.5) are compatible with WHP2 in the presence of 50–150 mM NaCl. In gel filtration, WHP2 protein migrated with an apparent molecular weight of 58 kDa suggesting monomer

Q1 Please cite this article in press as: J. Jiang et al., Expression and purification of human WWP2 HECT domain in Escherichia coli, Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.013

318 319 320 321

YPREP 4625

No. of Pages 7, Model 5G

29 December 2014 J. Jiang et al. / Protein Expression and Purification xxx (2014) xxx–xxx

Fig. 4. Anion exchange of WHP2 protein. Precipitated protein was dissolved in IEX buffer by gently to prevent oxidation induced by air bubbles. After filtration, sample was loaded on DEAE Fast Flow column (GE Healthcare) and unbound protein was removed in flow through fraction. Target protein was fractioned with linear gradient by IEX buffer B. Because of high purity of WHP2 eluted from TALON column, high performance IEX columns, such as Hitrap Q HP and Mono Q are not necessary to improve the protein resolution.

322 323 324 325 326 327 328 329 330 331

in solution (Fig. 5A). No significant high molecular weight peak was observed migrating in the void volume. The final WHP2 protein were >95% pure as estimated using SDS–PAGE (Fig. 5B). The final yield of WHP2 protein is about 60 mg/L cell culture. For short term storage, high salted (300–500 mM NaCl) buffer helped stabilize WHP2 protein which could be placed in cold chamber for a few weeks without protein precipitation occurring, although multiple freeze/thaw cycles could result in protein aggregation and even visible precipitates rapidly. For long term storage, WHP2 protein was concentrated to 1.0 mg/ml before snap freezing.

332

LC MS/MS spectrometry and CD

333

Gel sample of WHP2 was enzymatically digested by trypsin and chymotrypsin to generate small peptides. The partial peptide sequence of WHP2 was confirmed by LC MS/MS analysis (Fig. 6). The data base search showed 94% sequence coverage of query. The missed N-terminus of the WHP2 protein was manually

334 335 336 337

5

examined in the tryptic digestion and the sequence was identified by both MS and MS/MS. CD measurements resulted in a profile that is characteristic for a-helix-rich proteins suggesting proper structure and folding of the purified WHP2 (Fig. 7).

338

Interaction with binding partners

342

In a pull-down assay, both GST-PTEN and GST-E2 pulled down WHP2 (Fig. 8). The capability of interaction with E2 (UBcH7) and substrate PTEN indicated the integrity of essential binding surfaces on WHP2 protein. This will enable us to characterize complexes formed by HECT of WWP2 and other substrates, such as PTEN in the near future.

343

Discussion

349

It is over a decade that WW domain containing proteins have been studied. In previous research, most of the identified substrate proteins of WWP2 were mediated by WW domains. However, robust expression and purification of HECT domains have not been established. In an attempt to find a construct for structure studies and serve as a platform for both biophysical and biochemical experiments, we have screened various constructs, optimized expression conditions and established purification procedures. As a result, for the first time, we have succeeded in expression and purification of high quantity of the recombinant human WWP2 HECT domain in bacteria. By screening a combination of different tags and gene sequences, we found a soluble HECT domain containing construct, WHP2. The SDS–PAGE and chromatographic analyses show that we can generate large amount of recombinant soluble HECT domain of WWP2 protein for subsequent biochemical and biophysical analysis. Our mass spectrometry data has confirmed the identity of this recombinant protein. WHP2 has a good protein behavior dispersed in solution as monomer and stable after the purification procedures. This protocol is practically reproducible and cost effective. It has been demonstrated that WHP2 contains intact sub domains capable of interacting with binding partners, such as the C-lobe of E2 and the N-lobe of the substrate, namely PTEN in this case. Our results show that WHP2 retains the ability to bind E2 and PTEN. The ability to express recombinant HECT domain protein will enable a large number of previously difficult biochemical and biophysical experiments to be carried out. After obtaining soluble WHP2 protein, we have already started to look for more substrates

350

Fig. 5. Size exclusion chromatography of WHP2 protein and SDS–PAGE. (A) Analysis of WHP2 on a Superdex 75 10/300GL gel filtration column equilibrated with buffer. A major peak with an apparent molecular weight of 58 kDa corresponding to monomer WHP2 was observed. The elution volumes of the gel filtration standards used for calibration are indicated along with their molecular weights above (in kDa). (B) SDS–PAGE analysis of the main peak fractions eluting with a molecular mass of 58 kDa on a 12% SDS–PAGE gel under reducing conditions in Tris–glycine electrophoresis running buffer and visualized by Coomassie Brilliant Blue staining.

Q1 Please cite this article in press as: J. Jiang et al., Expression and purification of human WWP2 HECT domain in Escherichia coli, Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.013

339 340 341

344 345 346 347 348

351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377

YPREP 4625

No. of Pages 7, Model 5G

29 December 2014 6

J. Jiang et al. / Protein Expression and Purification xxx (2014) xxx–xxx

Fig. 6. LC MS/MS analysis of WHP2. (A) LC MS/MS result based on peptides generated by trypsin and chymotrypsin. 9 high score peptides of WHP2 were listed. The 9th peptide covering the last 9 AA of WHP2 sequence indicating the completed expression of WHP2. (B) Examination of the N-terminus of WHP2. The N terminal sequence of WHP2 was not detected. A tryptic digestion was performed manually. Two WHP2N-terminus peptides attributed to the marked peaks representing the individual trypsinized peptide fractions and marked by the corresponding m/z values (molecular weight). The peak height is relative abundance.

378 379 380 381 382 383 384 385 386

for HECT domain of WWP2 by using co-immunoprecipitation in mammalian cell. Furthermore, the binding of PTEN and E2 implies that the two WW domains do not occupy the important binding surface in HECT domain of WWP2, instead they may coordinate the folding of HECT domain. We attempted to modify WHP2 plasmid to add a protease cleavage site in WHP2 protein by AAs replacement or inserting AAs directly. To our surprise, these changes led to no protein expression at all. It indicated that the AA sequence between

WW domains and HECT domain is essential for WHP2 expression in bacteria. In insect cell, we found that HECT-containing constructs expressed only small fragments containing N-His-tag, suggesting premature termination. This reflected a great difficulty in the folding of HECT domain. As shown in Table 1, all constructs except WHP2 generated no soluble protein in bacteria despite of the fused tags. In conclusion, the two WW domains are critical in successful expression of WHP2 which turns out to be a result of both chance and effort.

Q1 Please cite this article in press as: J. Jiang et al., Expression and purification of human WWP2 HECT domain in Escherichia coli, Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.013

387 388 389 390 391 392 393 394 395

YPREP 4625

No. of Pages 7, Model 5G

29 December 2014 J. Jiang et al. / Protein Expression and Purification xxx (2014) xxx–xxx

7

it will not be published elsewhere in the same form, in English or in any other language, including electronically without the written consent of the copyright-holder.

412

Conflict of interest

415

All the authors declare no competing financial, personal or other relationships with other people or organizations that could inappropriately influence, or be perceived to influence, the research within this study.

416

Uncited reference

420

[17].

Fig. 7. CD spectrum of purified WHP2 shows typical profile of a-helix rich proteins. This result is in accordance with HECT domain of WWP1 in spite of a considerable increase in b-sheets introduced by 2 WW domains in WHP2.

Fig. 8. Pull-down experiments using cell lysates demonstrate the WHP2’s native capability of interacting with binding partners, E2 and PTEN. (A) Western blot analysis of individual fraction eluted from GST beads probed with an antiGST-horseradish peroxidase polyclonal antibody conjugate (signal way) to detect GST-E2 and GST-PTEN. (B) Western blot analysis using duplicated gel probed with an anti-His-horseradish peroxidase monoclonal antibody conjugate (Tianjin Sungene Biotech) to detect His-WHP2. GST protein was included as a pull-down control in lanes A1 and B1; A2 and B2 for E2 (UBcH7), A3 and B3 for PTEN. To avoid excessive signal of GST tag in Western blotting, sample loaded into lane A1 and A2 was reduced by 9 and 6 times respectively. 396

Conclusion

397

405

After extensive construct screening, we have successfully over expressed recombinant WHP2 using a heterologous bacterial expression system and obtained high purity WHP2 protein. Further MS and CD results confirmed the correct protein sequence and secondary structure of WHP2, in addition to its binding capability. The ability to express recombinant HECT domain protein will enable previously difficult biochemical and biophysical experiments to be carried out. WHP2 will be employed to identify new substrates interaction in the near future.

406

Submission declaration and verification

407

All authors declare that; the work described within this manuscript has not been published previously and is not under consideration for publication elsewhere, that its publication is approved by all authors and tacitly or explicitly by the responsible authorities where the studies were carried out, and that, if accepted,

398 399 400 401 402 403 404

408 409 410 411

413 414

417 418 419

Q3

421

Acknowledgments

422

The authors would like to thank Dr. Yi-Ming She from Plant Stress Biology Center, Shanghai, for carrying out mass spectrometry analysis and Dr. Hua Jiang from College of Chemistry, Beijing Normal University, for providing access to CD instrument. This project was supported by 973 Program (2012CB910304) from the Ministry of Science and Technology of the People’s Republic of China and Grants from the National Natural Science Q4 Q5 Foundation of China (No. 21273023).

423

References

431

[1] K.F. Harvey, S. Kumar, Nedd4-like proteins: an emerging family of ubiquitinprotein ligases implicated in diverse cellular functions, Trends Cell Biol. 9 (1999) 166–169. [2] P.J. Plant, H. Yeger, O. Staub, P. Howard, D. Rotin, The C2 domain of the ubiquitin protein ligase Nedd4 mediates Ca2+-dependent plasma membrane localization, J. Biol. Chem. 272 (1997) 32329–32336. [3] K. Lu et al., Pivotal role of the C2 domain of the Smurf1 ubiquitin ligase in substrate selection, J. Biol. Chem. 286 (2011) 16861–16870. [4] G. Pirozzi, S.J. McConnell, A.J. Uveges, J.M. Carter, A.B. Sparks, B.K. Kay, D.M. Fowlkes, Identification of novel human WW domain-containing proteins by cloning of ligand targets, J. Biol. Chem. 272 (1997) 14611–14616. [5] P.J. Lu, X.Z. Zhou, M. Shen, K.P. Lu, Function of WW domains as phosphoserineor phosphothreonine-binding modules, Science 283 (1999) 1325–1328. [6] F.J. McDonald et al., Ubiquitin-protein ligase WWP2 binds to and downregulates the epithelial Na(C) channel, Am. J. Phys. Renal Physiol. 283 (2002) F431– F436. [7] Y. Yang, B. Liao, S. Wang, B. Yan, Y. Jin, et al., E3 ligase WWP2 negatively regulates TLR3-mediated innate immune response by targeting TRIF for ubiquitination and degradation, Proc. Natl. Acad. Sci. U.S.A. 110 (2013) 5115–5120. [8] W. Zou, X. Chen, J.H. Shim, et al., The E3 ubiquitin ligase Wwp2 regulates craniofacial development through mono-ubiquitylation of goosecoid, Nat. Cell Biol. 13 (2011) 59–65. [9] S.M. Soond, A. Chantry, Selective targeting of activating and inhibitory Smads by distinct WWP2 ubiquitin ligase isoforms differentially modulates TGF-b signalling and EMT, Oncogene 30 (2011) 2451–2462. [10] M. Subbareddy, K. Sridhar, R. Neelam, R.P. Vivek, L.P. Jenny, et al., WWP2 is an E3 ubiquitin ligase for PTEN, Nat. Cell Biol. 13 (2011) 728–733. [11] H.M. Xu et al., WWP2, an E3 ubiquitin ligase that targets transcription factor Oct-4 for ubiquitination, J. Biol. Chem. 279 (2004) 23495–23503. [12] S. Wiesner et al., Autoinhibition of the HECT-type ubiquitin ligase Smurf2 through its C2 domain, Cell 130 (2007) 651–662. [13] A.Z. Shaw, P. Martin-Malpartida, B. Morales, F. Yraola, M. Royo, M.J. Macias, Phosphorylation of either Ser16 or Thr30 does not disrupt the structure of the Itch E3 ubiquitin ligase third WW domain, Proteins 60 (2005) 558–560. [14] A.A. Ogunjimi, D.J. Briant, N. Pece-Barbara, C. Le Roy, G.M. Di Guglielmo, et al., Regulation of Smurf2 ubiquitin ligase activity by anchoring the E2 to the HECT domain, Mol. Cell 19 (2005) 297–308. [15] M.A. Verdecia, C.A.P. Joazeiro, N.J. Wells, J.L. Ferrer, M.E. Bowman, T. Hunter, J.P. Noel, Conformational flexibility underlies ubiquitin ligation mediated by the WWP1 HECT domain E3 ligase, Mol. Cell 11 (2003) 249–259. [16] Q. Huang, D.M. Szebenyi, Structural basis for the interaction between the growth factor-binding protein GRB10 and the E3 ubiquitin ligase NEDD4, J. Biol. Chem. 285 (2010) 42130–42139. [17] E. Aragon, N. Goerner, A.I. Zaromytidou, Q. Xi, A. Escobedo, J. Massague, M.J. Macias, A Smad action turnover switch operated by WW domain readers of a phosphoserine code, Genes Dev. 13 (12) (2011) 1275–1288. [18] Y.M. She, M. Rosu-Myles, L. Walrond, T.D. Cyr, Quantification of protein isoforms in mesenchymal stem cells by reductive dimethylation of lysines in intact proteins, Proteomics 12 (2012) 369–379.

432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480

424 425 426 427 428 429 430

481

Q1 Please cite this article in press as: J. Jiang et al., Expression and purification of human WWP2 HECT domain in Escherichia coli, Protein Expr. Purif. (2014), http://dx.doi.org/10.1016/j.pep.2014.12.013