- Email: [email protected]
Expression of a foreign gene in Chlamydomonas reinhardtii chloroplast
JOURNALOF BIOSCIENCE AND BIOENGINEERING Vol.
81, No.
3, 307-314.
1999
Expression of a Foreign Gene in Chlamydomonas reinhardtii Chloroplast KIYOHIDE
ISHIKURA,
YASUKO TAKAOKA, KO KATO, * MASAMI SEKINE, KAZUYA YOSHIDA, AND ATSUHIKO SHINMYO Graduate School of Biological Sciences, Nara Institute of Science and Technology, 8916-S Takayama, Ikoma, Nara 630-0101, Japan Received 16 September 1998/Accepted 16 November 1998
Chimeric genes for expression of a foreign gene in the Chlamydomonas reinhardtii chloroplast were constructed. These chimeric genes are composed of the promoter from chloroplast genes, rbcL, psbA, and atpA, S- and S/-untranslated regions, and the Escherichia coli ,9-glucuronidase (GUS) structural gene (uidA) as a foreign gene. Three types of chloroplast transformants (RG, PG, and AG), which contained the rbcL-uidA, psbA-uidA, and atpA-uidA chimerlc genes integrated in the chloroplast genome, were generated by particle bombardment. The AG transformant grown under photoautotrophlc conditions showed the highest GUS activity (130 nmol/min/mg protein) so far reported in C. reinhurdtii, and the accumulated GUS protein accounted for 0.08% of the total soluble proteins. GUS activity in RG was 12% of that in AG, and no activity was detected in PG. We also measured the GUS activity from transformants grown under heterotrophic conditions, but the culture conditions made little difference in activity levels. The difference in the amount of accumulated GUS protein in the transformants was paralleled by the difference in the level of transcripts, and the pattern of gene expression was not the same as that of the endogenous genes in the chloroplast. [Key words: Chlamydomonas reinhardtii, chloroplast,
transformation,
promoter,
expression,
p-glucuroni-
dase]
The chloroplast is one of the most important organelles in plant cells, since it performs several essential functions, such as biological photosynthesis, i.e., the conversion of light energy to high-energy chemical metabolites (ATP, NADPH, and carbohydrates), and photosynthetic carbon fixation to amino acids and fatty acid biosynthesis. Chloroplasts possess their own unique genetic system. The genes present in the chloroplast genome rely on RNA- and protein-synthesizing systems for their expression, and the apparatus for gene expression closely resembles that in prokaryotic cells. At present, introduction of useful genes into higher plants is limited to the nuclear genome. When considering future plant biotechnology, an important approach for improving and enhancing chloroplast function is manipulation of the chloroplast genome. Chloroplast gene expression is regulated at the transcriptional, posttranscriptional, and translational steps (1). We have to obtain a thorough understanding of the regulation of chloroplast gene expression in order to express a foreign gene efficiently in the chloroplast. Cells of the eukaryotic green alga, Chlamydomonas reinhardtii, are 10 pm in length and 3 pm in width. The cells contain a single cup-shaped chloroplast that occupies nearly 40% of the cell volume. The chloroplast genome consists of a 196-kb circular double-stranded DNA with approximately 80 copies per cell (2). C. reinhardtii is a powerful model system for studying chloroplast gene expression for several reasons. First, this organism can grow extremely well under controlled laboratory conditions and can form clear colonies on agar plates. Second, photosynthesis in C. reinhardtii is dispensable if a carbon source such as acetic acid is provided in the medium, and the organism can then grow photoautotro* Corresponding
phically, mixotrophically, or heterotrophically. Third, methods and tools have been developed recently for efficient chloroplast transformation (3-5). Chloroplast transformation can be achieved by bombardment of cells with DNA-coated gold particles. The transforming DNA is integrated efficiently into the chloroplast genome by homologous recombination. In the work reported here, we tried to construct a foreign gene expression system in the C. reinhardtii chloroplast. Three candidates for promoter were selected from chloroplast genes in C. reinhardtii, such as rbcL, psbA, and atpA genes, since transcripts of these genes were abundant in C. reinhardtii cells (6); the rbcL, psbA, and atpA encode the large subunit of ribulosebisphosphate carboxylase/oxygenase, Dl protein of the photosystem II reaction center, and the (Y subunit of ATP synthase, respectively. We constructed chimeric genes composed of the promoters, 5’- and 3’-untranslated regions of the chloroplast genes, and the Escherichia coli ,%glucuronidase gene @idA) as the reporter gene. These chimeric genes were introduced into the C. reinhardtii chloroplast by particle bombardment, and stable chloroplast transformants were selected. The effects of different promoters and untranslated regions on the gene expression were studied at the transcriptional and translational levels. MATERIALS
AND METHODS
Algae and culture conditions C. reinhardtii wildtype strain 137~ was obtained from Dr. M. GoldschmidtClermont (University of Geneva). This strain was cultured in Tris-acetate-phosphate (TAP) medium or Trismin (M) medium (7). C. reinhardtii nonphotosynthetic and photosynthetic transformants were maintained on TAP and M media, respectively. For the solid medium
author. 307
308
ISHIKURA
ET AL.
2% agar was added, and if necessary spectinomycin (100 pg/ml) was supplemented. All strains were grown in TAP medium in the dark (heterotrophic growth), in TAP medium under light (mixotrophic growth, 10001x), or in M medium under light (photoautotrophic growth, 1000 lx) at 25°C. Construction of chloroplast transfomation vectors Conventional cloning techniques were used throughout (8). The bacterial host was E. coli DH5a. In order to remove the SphI site, the plasmid vector pUC19 was digested with SphI, the ends were filled-in with a T4 DNA polymerase and ligated to obtain plasmid pUC19AS. A 3.9-kb EcoRI-BamHI fragment from plasmid R15 (9) containing the C. reinhardtii rbcL and psaB genes was inserted into pUC19AS digested with EcoRI and BamHI to obtain plasmid pUCEB; the psaB gene encodes the polypeptide of the photosystem I reaction center (Fig. 1). A 1.9-kb EcoRV-SmaI fragment containing an aadA expression cassette consisting of the atpA promoter region, aadA (aminoglycoside adenine transferase gene) coding region, and rbcL terminator region (4) was inserted into pUCEB digested partially with HpaI to obtain plasmid pUCEBaadA. The aadA gene confers resistance to spectinomycin on Chlamydomonas cells. The EcoRV- and ClaI-digested pUCEBaadA ends were filled-in with a Klenow fragment, and ligated to delete the rbcl-coding region. The resultant plasmid was designated pUCEBdrbcL. The coding sequence of the ,%glucuronidase gene (uidA) was amplified by the polymerase chain reaction (PCR) using the primer sets GUS5 and GUS3 (Table l), and pBIlO1 (10) as the template, and the amplified fragment was inserted into pT7Blue T-Vector (Novagen Inc., Madison, WI, USA) at the cloning site to obtain plasmid pT7GUS. A 1.8-kb NcoI-SphI fragment from pT7GUS was inserted into pUCEBaadA digested with NcoI and SphI to obtain plasmid pUCEBGUS. The NcoI site contains the translational initiation site of the uidA gene. For preparation of 5’-segments of the rbcL, psbA, and atpA genes, total DNA was isolated from C. reinhardtii wild-type 137~ (7), and used as the template for PCR amplification. The PCR primer sets for the 3 genes were RBCL5 and RBCL3 for SibcL, PSBAS and PSBA3 for 5lpsbA , and ATPAS and ATPA for S’atpA, respectively (Table 1). These 5’-segments were first subcloned in pT7Blue T-Vector at the cloning site, from which they were excised with CfaI and NcoI. The 0.37-kb S’rbcL, the 0.25-kb S’psbA, and the 0.58-kb 5’atpA ClaI-NcoI fragments were introduced into CfaI- and NcoI-digested pUCEBGUS. The plasmids generated were designated pGrbcL, pGpsbA, and pGatpA, respectively (Fig. 1A). The sequence of the 5’-segments were verified by sequencing, and some nucleotide substitutions were detected using the sequence database. These substitutions were detected in independent PCR products. Our sequences appear in the DDBJ, EMBL and GenBank nucleotide sequence databases with the following accession numbers; AB016252 for S’rbcL, AB016253 for S’psbA, and AB016254 for 5htpA. Preparation of fragments of the chloroplast-specific In order to assay a specific RNA in Chlamydogenes monas cells, the coding segments of the chloroplast genes were amplified by PCR using primers (Table 1) and total DNA from wild-type cells as the template; primer sets 16S5 and 16S3 for the 0.5kb internal por-
J. Broscx.
BIOENL,
tion of the 16s rRNA gene, PF and PR for the i.5-kb coding segment of the rbcL gene, PSBAS and PSBA30 for the 0.3-kb exon 1 of the psbA gene, and ATPASO and ATPA for the 1.4-kb internal portion of the atpA gene. Each PCR product was basically cloned into puc19. The plasmids generated were designated pUC16S, pUCrbcL, pUCpsbA, and pUCatpA, respectively. A 1.8-kb PstI-BamHI fragment from pT7GUS was cloned into pUC19 to create plasmid pUCGUS. PCR Twenty-five cycles of amplification were performed in a Perkin-Elmer thermal cycler. Each amplification cycle consisted of 1 min denaturation at 94°C 5 min annealing at 55”C, and 3 min extension at 72°C. The amplified products were analyzed by electrophoresis on a 1% agarose gel. Chloroplast transformation C. reinhardtii wildtype cells were plated onto agar TAP medium containing 100 ,ng/ml spectinomycin at a density of approximately 1 X 107cells/90-mm petri plate. Gold particles (1 ;rm) coated with plasmid DNAs were shot into Chlamydomonas cells on the agar plate using a Bio-Rad PDS 1OOOHe Biolistic gun at 1100 psi. After incubation in the dark for one week, the transformant colonies were subcultured on TAP-spectinomycin plates three to four times until they were homoplasmic. Nonphotosynthetic mutant cells were also plated onto agar M medium. After bombardment with plasmids containing the rbcL gene, the cells were incubated under light for two weeks. Transformants which could grow by photosynthesis were subcultured on M plates until they were homoplasmic. Preparation of crude extract from C. reinhardtii cells Cells were grown to a density of approximately 1 x lo6 cells/ml in TAP or M medium and were harvested by centrifugation at 2OOOxg for 10min at 4”C, resuspended in 1.3 ml of GUS lysis buffer [50 mM NaH2P04/ Na2HP04 (pH 7.0), 10 mM EDTA, and 10 mM 2-mercaptoethanol], and disrupted by sonication (level 9, Handy sonic model UR-20P, TOMY SEIKO Co. Ltd., Tokyo) for 20 x 15 s at 15 s intervals. The lysate was centrifuged at 100,000 x g for 1.5 h at 4”C, and the supernatant was used for the subsequent experiments. GUS assays The fluorescence assay of GUS activity was performed using 4-methylumbelliferyl glucuronide as described by Jefferson et al. (10). GUS activity was expressed as nanomoles of methylumbelliferone per minute per mg of protein. Western blot analysis of the GUS protein SDSpolyacrylamide gel electrophoresis (SDS-PAGE) was performed with a 7.5% acrylamide gel (17) and the separated proteins were immunoblotted (8) with rabbit polyclonal antibodies raised against E. coli GUS (Molecular probes Inc., Eugene, OR, USA, #A-5790) and then with a goat anti-rabbit IgG alkaline phosphatase conjugate according to the method of the manufacturer (Promega Co., Madison, WI, USA). Protein concentration was measured by the Coomassie blue dye-binding method (18). RNA isolation and Northern blot analysis of uidA About 3 x lo9 cells were lysed by extensive transcript grinding with a pestle and mortar in 10ml of 50 mM Tris-HCl buffer (pH 8.0) containing 300mM NaCI, 5 mM EDTA, 2 mM aurin tricarboxylic acid (Sigma Chemical Co., St. Louis, MO, USA), 2% SDS, 2% Natriisopropylnaphtalene sulfonate (Kant0 Chemical Co. Inc., Tokyo), and 12.8mM 2-mercaptoethanol in liquid nitrogen. The homogenate was supplemented with 1.4 ml of 3 M KC1 and stored on ice for 15 min. After centrifu-
VOL.
EXPRESSION
87, 1999
GENE IN CHLOROPLAST
309
NcoI-SphI fragment containing the entire uidA coding region was labeled with [(w-32P]dCTP and BcaBestTM (Takara Shuzo Co. Ltd., Kyoto) and used to probe the filter. 16s rRNA used as the internal control was hybridized with a 16s rRNA gene probe consisting of a 0.48kb NcoI-Sac11 fragment (14) labeled with [a-32P]dCTP. Prehybridization and hybridization were performed in hybridization buffer [250mM NaHP04 (pH 7.2), 1 mM EDTA, 1% bovine serum albumin, 250 mM NaCl, and 7% SDS] at 65°C (8, 19). The filter was washed once with Wash A [40 mM NaHP04 (pH 7.2), 1 mM EDTA, 0.5% bovine serum albumin, and 5%] for 30min at
gation at 2OOOxg for 20min at 4°C 7.3 ml of 10M LiCl were added to the supernatant and stored on ice for 30 min. Insolubilized RNA was precipitated by centrifugation at 30,000 x g for 25 min at 4”C, redissolved in 4ml of water, and then extracted two times each with phenol/chloroform and chloroform, to remove proteins in the RNA solution. Purified RNA was recovered by precipitation with ethanol and dissolved in 50~1 of water. The purified RNA (5 pg) was fractionated by electrophoresis in a 2% agarose-formaldehyde gel and transferred onto a Hybond-N+ (Amersham Pharmacia Biotech Ltd., Uppsala, Sweden) membrane (8). A 1%kb A
OF FOREIGH
pUCEB EV
HP
Ca
pUCEBaadA E I
__ ‘A#&
promoter S&CL
pGpsbA
5’PSbA .
SatpA --__
EV 1
(HP)
1
uidA gene
tsta
--__ I
-- 1
__--
*-
N,C
pGrbcL
E
--
I
Ca
pGatpA
cassett
4 8dA --__
EV I
SP
NC
-
puc19
terminator SP
__---_
--
_---
(HP)
1
Ba
Ba
-
puc19
pUCEBdrbcL
B GUS3R
PR
PG AG
transformed chloroplast genome
chloroplast
genome
chloroplasi
benome
FIG. 1. Construction of plasmids for chloroplast transformation. (A) GUS expression plasmids, pGrbcL, pGpsbA, and pGatpA, and related plasmids, pUCEB and pUCEBaadA, are shown. In the chimeric gene, the ui&l coding region (filled boxes) was placed between a region upstream of the chloroplast genes (open boxes) and the 3’-region of the &CL gene (stippled boxes, &CL); 5’rbcL (0.37-kb), 5jlsb.4 (0.25kb), and S’afpA (0.58-kb) are the S’-segments of the rbcL, psbA, and atpA genes, respectively. The chimeric ui&l genes were inserted into a EcoRI-BumHI chloroplast DNA fragment (thick line) between the rbcL and psuB genes (coding regions are shown by shaded boxes). pUCEBdrbcL is the rbcL-deletion plasmid, in which the rbcL gene was replaced by an n&A cassette consisting of the a@4 promoter, au&I coding region, and rbcL terminator. Plasmid pUC19 is shown by a thin line. (B) Primers for confirming the homoplasmicity of transformants. Location and direction of primers are indicated by arrowheads. E, EcoRl; EV, EcoRV; Ca, CM; NC, NcoI; Sp, SphI; Hp, HpuI; Ba, BumHI.
310
ISHIKURA
ET
AL.
J. B~oscl. TABLE
Gene
Oligo:
uidA
CUSS: GUS3: GUS3R: RBCLS: RBCL3: PF: PR: PSBAS: PSBA3: PSBA30: ATPAS : ATPA3: ATPASO: ATPA30: 16S5: 16S3: PC6: AAD3:
rbcL
psbA
afpA
16s rRNA psaB aadA
1.
Oligonucleotides
used in this work
Sectuencea,b
Position
CAGTCCCCCATGGTACGTCCTGTAGAA GCGGCATGCTTATTGTTTGCCTCCC CCGCAGCAGGGAGGCAAACAATAA GCACATCGATGGGTTTATAGGTATT AACCATGGATATAAATAAATGTAAC TTATTTTAGGATCGTCAAAAGAAG ATGCTATTCACATAAACATCATG CGTCCTATATCGATACTCCGAAGGA GCTGCCATGGGTTAATTTTTTTAAA CAACCGATGTATAAACGGTTTTCAG AATATCGATGACTTTATTAGAGGCAGTG ATTGCCATGGAAAAGAAAAAATAAATAA ATGGTAGATTTCGGTATCGTTTTCC AGCAGCTTTAGCTTGAGATTTAAATTC ATCCATGGAGAGTTTGATCCTGGCTC CCTCTGTATTACCGCGGCTGCTGGCA TCCTTATTGAGCCTGTATTTGCTC GATCACTAAGGTAGTTGGCAAATAA
a The oligonucleotides used as primers b The linkers are underlined.
for the PCR
are listed
2543-2569 436994345 4331-4360 823- 847 1196-1172 1149-1172 2652-2630 I25 259- 235 346- 322 920- 893 329- 356 261- 237 1362-1336 1455-1480 1947-1922 1501-1524 1172-1196 in 5-3’
65”C, several times with Wash B [40mM NaHP04 (pH 7.2), 1 mM EDTA, and 1% SDS] at 65°C (19), and then exposed to X-ray film with an intensifying screen at -80°C. The filter was also exposed to an imaging plate (Fuji Photo Film Co. Ltd., Kanagawa). The hybridization signals were quantified by a bio-imaging analyzer (BAS 2000, Fuji Photo Film). In vivo labeling of RNA A fifty-ml cell suspension of C. reinhardtii grown to a density of approximately 4 x 106 cells/ml in TAP medium was inoculated in 600 ml of low-phosphate TAP medium in which the phosphate concentration was reduced from 1 mM to 0.05 mM. Cells were grown for four to five generations under light (10001x) at 27°C with a doubling time of 5 to 6 h (7), and harvested by centrifugation at 3000 x g for 5 min at 4°C. Then, the cells were suspended in prewarmed fresh TAP medium without phosphate at a concentration of 2 x 10’ cells/ml. After incubation of the cell suspension for 30min at 27”C, 32P-orthophosphate (ICN Biochemicals Ins., Costa Mesa, CA, USA, in dilute HCl) was added at a concentration of 2 nM (175 kBq/ml). A 3.5-ml portion of the labeled culture was withdrawn at 10min after the initiation of the labeling to a centrifugation tube containing 2 volumes of ice-cold TAP medium. The cells were pelleted by centrifugation at 3000 X g for 3 min at 4°C and frozen in liquid nitrogen. Total Hybridization analysis of 32P-labeled RNA RNA was isolated from pulse-labeled cells by using FastPrep FP120 (BIO 101, Vista, CA, USA) and FastRNA KIT-RED (BIO 101) according to the recommendations of the supplier (BIO 101). Plasmid DNAs, pUCGUS, pUCrbcL, pUCpsbA, pUCatpA, pUC16S, and pUC19 (1 pg/slot) were applied to a Zeta-probe GT membrane (Bio-Rad, Hercules, CA, USA) in a Bio-Dot SF Microfiltration Apparatus (Bio-Rad), and were covalently linked to the membrane by exposure to UV light. Hybridization and prehybridization were carried out as described above. Prehybridization was carried out for 1 h after which total radioactive RNA was applied to the membrane and hybridization was performed for 70 h at 60°C. Autoradiography was carried out as described above.
HIOENC,.,
Linkerb
Reference
NcoI SphI
(10) (10) (10)
Clal NcoI
(9) (91 (91 (91 (11) (11) (11) (9, 121 (9, 12) (9) (131 (14) (14) (15)
CIaI NcoI CIaI NcoI
(16)
orientation.
RESULTS Construction of GUS expression vectors Three plasmids, pGrbcL, pGpsbA, and pGatpA, have been constructed for expression of the uidA gene in the C. reinhardtii chloroplast (Fig. 1A). The uidA gene was placed between the 5’-upstream region of the C. reinhardtii chloroplast genes, rbcL, psbA , or atpA, and the 3’-end of the rbcL gene. These 5’-upstream regions contain the promoter, Sluntranslated region, and the translation initiation AUG codon. As a result, the expression of the uidA gene would be controlled by the transcriptional and translational signals in the Chlamydomonas chloroplast. These chimeric genes were placed between the chloroplast genes, rbcL and psaB, so that the donor genes would be inserted into the target region in the chloroplast genome by homologous recombination (Fig. 1A). Transformation and selection of transformants In general, antibiotic-resistance marker genes are used for the selection of transformed plant cells. For the selection of chloroplast-transformed cells, we tried to use not only the spectinomycin-resistance gene, but also the rbcL gene, which is essential for photosynthesis and allows photoautotrophic growth of transformants when incorporated into a rbcl-deficient host cell. We constructed the rbcl-deletion plasmid pUCEBdrbcL, in which rbcL was replaced by an aadA cassette (4) (Fig. 1A). The plasmid pUCEBdrbcL was introduced into the chloroplast genome of C. reinhardtii strain 137~ by particle gun bombardment, and a transformant was selected by its resistance to spectinomycin in the dark. The transformant generated was designated DEVL. DEVL could not grow photoautotrophically at all (Fig. 3), and was used as a host cell for the subsequent chloroplast transformation. The GUS expression vectors were introduced into the chloroplast genome of DEVL, and transformants were selected by their ability to grow photosynthetically via rescue of rbcL. It was confirmed by PCR using GUS3R and PC6 as primer sets (Fig. lB, Table 1) that the donor genes were inserted into the target region in these transformants. A 1.4-kb amplified fragment was detected in all three transformants (Fig. 2A). Primer PC6 anneals to the chloroplast genome, but not to the integrated plasmid DNA. The transformants were subcultured on M
EXPRESSION
OF FOREIGH
WT
GENE IN CHLOROPLAST
DEVL
RG
PG
311
AG
FIG. 3. Growth of the transformants and control strains. C. reinhardtii wild-type 137~ (WT), rbcl-deleted nonphotosynthetic mutant (DEVL), and the transformants (RG, PC, and AG) were grown on various agar media. TAP, TAP medium; TAP 50, TAP medium containing 50 ,eg/ml spectinomycin; M 100, M medium containing 0.01% (v/v) acetic acid. Cells were incubated in the dark on TAP or TAP 50, or under light (1000 lx) on M 100 at 25°C for 10 d.
C
Ml2345
FIG. 2. The homoplasmicity of the transformants. Fragments amplified by PCR were analyzed by 1% agarose gel electrophoresis and detected by ethidium bromide staining. Total DNA was purified from the transformants, and the uidA gene using primer sets GUS3R and PC6 (A), the rbcL gene using primer sets PF and PR (B), and the aadA gene using primer setsAAD and PC6 (C) were amplified. Lanes l-5 were derived from the following cells; lane 1, C. reinhurdtii wild-type 137~; lane 2, DEVL; lane 3, RG; lane 4, PC; lane 5, AG. Lane M indicates R/Sty1 digest.
plates three or four times until they became homoplasmic. The transformants containing the rbcL-uidA, psbAuidA, and atpA-uidA chimeric genes were designated RG, PG, and AG, respectively. To confirm the homoplasmicity of the chloroplast genomes in the transformants, DNA segments of the entire rbcL, aadA, and uidA genes were amplified by PCR using primer sets PF/PR, AAD3/PC6, and GUS3R/PC6, respectively (Figs. 1B and 2, Table 1). When the primer sets PF and PR were used, the same 1.5kb fragments corresponding to rbcL were amplified in wild-type cells and all transformants except DEVL (Fig. 2B). In RG, an additional 2.0-kb amplified fragment was observed (Fig. 2B, lane 3). As shown in Fig. IB, PF and PR primers could also anneal to the 5’- and 3’-untranslated regions of the uidA gene in RG. A 1.9-kb amplified fragment in DEVL corresponding to the replacement of rbcL by the aadA cassette was also detected (Fig. 2B, lane 2). When the primer sets AAD and PC6 were used, amplified fragments were not detected in any of the three transfor-
mants (Fig. 2C). The transformants generated were sensitive to spectinomycin and could grow photoautotrophitally (Fig. 3). There were no differences in growth between the wild-type and transformant cells (Fig. 3). These results indicate that every transformant was homoplasmic and did not have any portion of the aadA gene. The accumulation of GUS protein in the transformants To examine the expression of the uidA gene in each transformant, proteins prepared from mixotrophitally grown cells were resolved by 7.5% acrylamide SDSPAGE, and the GUS protein was detected by Western blotting with the anti-GUS antibody. Two independent clones from each of the transformants were examined. A clear band was detected at the position corresponding to the molecular size of the GUS protein (68 kDa) in RG and AG, but not in PG (Fig. 4). Two nonspecific bands were detected in wild-type and the 3 transformants. The GUS activity in crude extracts of the transformants grown photoautotrophically is shown in Fig. 5. The AG and RG transformants showed 13Ok6.6 and 1625.5 nmol/min/mg protein in 3 independent transformants, respectively. The activity in wild-type and PG transformants was less than 0.4 nmol/min/mg protein. These results were consistent with the amount of GUS protein in the transformants, as shown in Fig. 4. The accumulation of uidA mRNA in the transforTo confirm the expression of the uidA gene at mants the transcriptional level, total RNA was extracted from W-f
a
RG b
a
PG b
a
AG
b
FIG. 4. Western blot analysis of the crude extracts. Proteins (3 pg) prepared from mixotrophically grown cells were resolved by 7.5% acrylamide SDS-PAGE, and the GUS proteins were detected by Western blotting. C. reinhardtii wild-type 137~ (WT) and two independent clones (a and b) in each of the transformants (RG, PG, and AG) were analyzed. The arrow indicates the position of the GUS protein.
312
ISHIKURA
ET AL.
.I B~osct. BIOEN(;.,
*
lWT
RG
AG
PG
FIG. 5. GUS activities of the transformants. Crude extracts were prepared from cells in photoautotrophic culture, and GUS activities were measured by fluorescent assay using 4-methylumbelliferyl glucuronide as the substrate. The data are the means *SD of three independent clones.
photoautotrophically grown cells and subjected to Northern blot analysis using the ui&I gene as the probe (Fig. 6). A single band of approximately 2.0 kb hybridized in RG, which was the expected size for a mRNA beginning at the same rbcL transcription start point as the normal transcripts, extending through the uidA coding sequence and ending at the position of the rbcL 3’-end. In AG, a 2.3 kb RNA, with the expected size from the atpA promoter to the rbcL 3’-end, was observed in abundance. The uidA transcript was scarcely detected in PG. The amount of uidA mRNA in AG was approximately 13-fold more than that in RG calculated relative to the amount of 16s rRNA. These results together with the amount and activity of GUS protein shown in Figs. 4 and 5, respectively, indicate that the differences in the accumulation of GUS protein among the transformants were the result of differences in the amounts of transcripts. By a pulse-labeling experiment (Fig. 7), rapid labeling of the uidA mRNA in the AG transformant was detected, but labeling was slow in RG, indicating that the WT
RG
PG
AG
FIG. 7. Transcriptional activity of the chimeric uidA gene in the transformants. Phosphate-starved cells of C. reinhnrdtii wild-type 137~ (WT) and the transformants (RG, PG, and AG) were labeled in vivo for 10 min with 32P-orthophosphate, and 32P-labeled RNA was hybridized to immobilized specific DNA on a membrane. Not only the uidA mRNA, but the endogenous atpA, rbcL, and psbA mRNAs and 16s rRNA were used as positive controls. pUCl9 DNA was used as the negative control.
amount of transcripts in AG and RG transformants might be controlled by the rate of transcription, not the stability of the mRNA. However, pulse-labeled uidA mRNA in PG was similar to that in RG, in spite of the significantly lower accumulation of the uidA mRNA (Fig. 6). This result suggests that rapid degradation of uidA mRNA occurred in the PG transformant. Pulselabeled RNAs of endogenous genes were almost the same in wild-type and transformant cells (Fig. 7). The Effect of culture conditions on GUS activity specific activity of GUS was higher in AG than in RG, and was not detected in PC grown under photoautotrophic conditions (Fig. 5). The endogenous enzymes encoded by rbcL and psbA were the most abundant proteins in the chloroplast (1). Since the state of chloroplast development and chloroplast gene expression were influenced by environmental conditions, especially light (20, 21), we investigated the effect of culture conditions on GUS activity in these transformants (Table 2). GUS specific activity in cells grown in a photoautotrophic culture was 1.5 to 4.5fold higher than that in a heterotrophic culture. But, ratio of GUS activity among RG, PG, and AG was similar under both culture conditions. DISCUSSION
uidA mRNA
Genetic manipulation of the chloroplast genome might be an important technique for construction of useful transgenic plants in the future. Since transformation of chloroplasts of higher plants is still difficult (22), we chose a green alga, C. reinhardtii, as the model plant. Transformation of the C. reinhardtii chloroplast genome
16s rRNA TABLE
GUS specific activitya (nmol/min/mg protein) Photoautotrophic Heterotrophic conditions conditions WT 0.36kO.076 0.08110.028 16k5.5 1123.6 RG PG 0.35kO.074 o.o77t-0.020 62211 AG 130t6.6 a Mean (fS.D.) of three independent clones.
Strains FIG. 6. Northern blot analysis of u&I mRNA in the transformants. Total RNA was extracted from photoautotrophically grown cells and 5 ,ug of total RNA was separated on a 2% formaldehyde/agarose gel, transferred to a membrane, and probed with the oligonucleotide corresponding to the #idA or 16s rRNA genes, as described in Materials and Methods. C. reinhardtii wild-type 137~ (WT) and the transformants (RG, PG, and AG) were analyzed.
2. Effect of culture conditions on GUS activity
VOL.87, 1999 was obtained by particle bombardment followed by homologous recombination (3-5). About 102 to lo3 transformant colonies could be obtained in one week of cultivation after bombardment, and homogenous selection of transformants was established within 1 to 2 months under suitable selection conditions. In our attempt to construct an efficient gene expression system in chloroplasts, three candidates for promoter were selected from the chloroplast genes in C. reinhardtii, namely, the rbcL, psbA, and atpA genes, since transcripts of these genes were abundant in C. reinhardtii cells (6). An aproximately 0.5kb 5’-upstream region of each gene was linked to the uidA reporter gene and introduced into the C. reinhardtii chloroplast genome. The chimeric uidA genes with the atpA and rbcL promoters showed 130 and 16nmol/min/mg protein GUS activity, respectively, but that with the psbA promoter showed scarcely detectable GUS activity (Fig. 5). The GUS activity level was basically consistent with the amount of uidA transcript (Fig. 6). The RG transformant accumulated a small amount of the chimeric uidA mRNA compared with that of the atpA-uidA mRNA, and PG accumulated no p.sbA-uidA mRNA. The endogenous rbcL and psbA genes are represented by the largest mRNA pools in the C. reinhardtii chloroplast (6). This means that the pattern of chimeric gene expression is not the same as that of endogenous genes. The transcriptional activities of the endogenous chloroplast genes (rbcL, psbA, and atpA) have been measured (6). The rbcL gene is transcribed about 2.3-fold more actively than psbA, and 17-fold more rapidly than the mRNA in atpA. We also measured the transcriptional activity of the chimeric uidA genes in the transformants (Fig. 7). Although we replaced only the rbcL and psbA coding region with uidA, the transcriptional activities of the rbcL-uidA and psbA-uidA chimeric genes were lower than that of the atpA-uidA chimeric gene, and did not proceed at the same rate as with the endogenous chloroplast genes. The activity of the rbcL promoter is enhanced by a sequence lying between positions + 126 and + 170 in the coding region of the rbcL, in which position + 1 is the site of initiation of transcription and position +93 is the site of initiation of translation (23). Therefore we assume that the rbcL-uidA chimerit gene construct may not have had full transcriptional activity. There are several possibilities to explain the difference in psbA gene expression between the endogenous and chimeric uidA genes. In the psbA-uidA chimeric gene, the 240-bp upstream region of the psbA gene was ligated to the uidA coding sequence. It is thought that the full promoter activity of the psbA gene requires the 240-bp upstream sequence, and/or the coding region as dose the rbcL gene. Although the psbA-uidA chimeric gene had transcriptional activity, the transcripts did not accumulate in the PG transformant (Figs. 6 and 7). The transcripts from the psbA-uidA chimeric gene may be rapidly degraded. Several chloroplast-encoded mRNAs contain sequences within the S/-untranslated region that have the potential to form stem-loop structures, and these may play a role in mRNA stability (1, 24). Probably the 5’-untranslated region of the psbA-uidA mRNA could not make a correct structure for high mRNA stability. In addition to the 5’-untranslated region, the coding region of the psbA gene might need to form a stem-loop structure for mRNA stability. These data sug-
EXPRESSIONOFFOREIGH GENEINCHLOROPLAST 313 gest that the rbcL and psbA promoters and 5’-untranslated regions are not sufficient to express a foreign gene, and their coding regions may be needed for complete gene expression. The AG transformant accumulated the most GUS protein of the various transformants examined in this experiment (Fig. 5), and their GUS specific activity was about 200-fold that in the pDG3 transformant (0.57 nmol/min/ mg protein) harboring the petD-uidA chimeric gene; petD encodes subunit IV of the cytochrome bs/f complex (25), which has the highest GUS activity so far reported in Chlamydomonas. The accumulated GUS protein accounted for 0.08% of the soluble protein in the AG transformant cells calculated on the basis of the specific activity of purified ,&glucuronidase (168,000 nmol/ min/mg protein, #G7646, Sigma). When a useful foreign gene is introduced into the C. reinhardtii chloroplast in an expression cassette using the atpA gene promoter and S/-untranslated region, it may be expected that the presence of the gene product is enough to alter the function of the chloroplast. We also measured the GUS activity under heterotrophic conditions (Table 2), but little difference was noted between two culture conditions. This result shows that the expression of a foreign gene using these expression cassettes is not influenced much by environmental conditions, such as carbon source or light. In the advancement of the metabolic engineering of plants and plant cells, manipulation of the chloroplast genome will become more important for improvement of plant metabolism. At present, metabolic modification of the chloroplast is done by insertion of a foreign gene into the nuclear chromosome and translocation of the expressed protein equipped with a targetting signal to the chloroplast from the cytoplasm. Direct transformation of the chloroplast genome is a simpler system. In the transformation of plants by bacterial genes, integration in the chloroplast genome must be emphasized, since the gene expression system in chloroplasts is basically the prokaryotic type. Study on the control mechanisms of gene expression of the Chlamydomonas chloroplast genome in detail will be applied to transformation of the chloroplast genome in higher agriculturally and industrially important plants in the near future. ACKNOWLEDGMENTS We wish to thank Dr. Michel Goldschmidt-Clermont (University of Geneva) for kindly providing the aadA cassette and plasmid R15. This work was supported in part by the “Research for the Future” Program from the Japan Society for the Promotion of Science (JSPS) (Project JSPS-RFTF97R16001) and Grants-in-Aid for scientific research, No. 09450305 and No. 10170221, to A.S. from the Ministry of Education, Science and Culture, Japan. REFERENCES Rochaix, J.-D.: Post-transcriptional regulation of chloroplast gene expression in Chlamydomonas reinhardtii. Plant Mol. Biol., 32, 327-341 (1996). Harris, E. H.: The Chlamydomonas Sourcebook. Academic Press Inc., San Diego (1989). Boynton, J. E. and Gillham, N. W.: Chloroplast transformation in Chlamydomonas, p. 510-536. In Wu, R. (ed.), Methods in enzymology, vol. 217. Academic Press Inc., San Diego (1993). Goldschmidt-Clermont, M.: Transgenic expression of aminoglycoside adenine transferase in the chloroplast; a selectable
314
5. 6.
I.
8. 9.
ISHIKURA
ET AL.
marker for site-directed transformation of Chlamydomonas. Nucl. Acids Res., 19, 4083-4089 (1991). Zhu, G. and Spreitzer, R. J.: Directed mutagenesis of chloroplast ribulosebisphosphate carboxylase/oxygenase. J. Biol. Chem., 269, 3952-3956 (1994). Blowers, A. D., Ellmore, G. S., Klein, U., and Bogorad, L.: Transcriptional analysis of endogenous and foreign genes in chloroplast transformants of Chlamydomonas. Plant Cell, 2, 1059-1070 (1990). Rochaix, J.-D., Mayfield, S., Goldschmidt-Clermont, M., and Erickson, J.: Molecular biology of Chlamydomonas, p. 253275. In Shaw, C. H.(ed.), Plant molecular biology, IRL Press, Oxford (1988). Sambrook, J., Fritsch, E. F., and Maniatis, T.: Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989). Dron, M., Rahire, M., and Rochaix, J.-D.: Sequence of the chloroplast DNA region of Chlamydomonas reinhardtii containing the gene of the large subunit of ribulose bisphosphate carboxylase and part of its flanking genes. J. Mol. Biol., 162, 775-793
.f
15.
16.
17.
18. 19. 20.
(1982).
10. Jefferson, R. A., Kavanagh, T. A., and Bevan, M. W.: GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J., 6, 3901-3907 (1987). 11. Erickson, J. M., Rahire, M., and Rochaix, J.-D.: Chlamydomonas reinhardtii gene for the 32,OOOmol. wt. protein of photosystem II contains four large iontrons and is located entirely within the chloroplast inverted repeat. EMBO J., 3, 2753-2762 (1984). 12. Fiedler, H. R., Schmid, R., Leu, S., Shavit, N., and Strotmann, H.: Isolation of CFOCFl from Chlamydomonas reinhardtii cw15 and the N-terminal amino acid sequences of the CFOCFl subunits. FEBS Lett., 337, 163-166 (1995). 13. Leu, S., Schlesinger, J., Michaels, A., and Shavit, N.: Complete DNA sequence of the Chlamydomonas reinhardtii chloroplast atpA gene. Plant Mol. Biol., 18, 613-616 (1992). 14. Dron, M., Rahire, M., and Rochaix, J.-D.: Sequence of the chloroplast 16s rRNA gene and its surrounding regions of
21.
Chlamydomonas reinhardtii. Nucl. Acids Res., 10, 7609-7620 (1982). Kueck, U., Choquet, Y., Schneider, M., Dron, M., and Bennoun, P.: Structural and transcription analysis of two homologous genes for the P700 chlorophyll a-apoproteins in Chlumydomonas reinhardtii: evidence for in vivo trans-splicing. EMBO J., 6, 2185-2195 (1987). Hollingshead, S. and Vapnek, D.: Nucleotide sequence analysis of a gene encoding a streptomycin/spectinomycin adenylyltransferase. Plasmid, 13, 17-30 (1985). Laemmli, U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680.-685 (1970). Bradford, M. M.: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem., 72, 248-254 (1976). Church, G.M. and Gilbert, W.: Genomic sequencing. Proc. Natl. Acad. Sci. USA, 81, 1991-1995 (1984). Hauser, C. R., Gillham, N. W., and Boynton. J. E.: Translational regulation of chloroplast genes. J. Biol. Chem., 271, 1486-1497 (1996). Salvador, M. L., Klein, U., and Bogorad, L.: Light-regulated and endogenous fluctuations of chloroplast transcript level in Chlamydomonas. Regulation by transcription and RNA degradation. Plant J., 3, 213-219 (1993) Zoubenko, 0. V., Allison, L. A., Svab, Z., and Maliga, P.: Efficient targeting of foreign genes into the tobacco olastid genome. Nucl. Acids Res., 22, 3819-3824 (1994). . Klein, U., Salvador, M. L., and Bogorad, L.: Activity of the Chlamydomonas chloroplast rbcL gene promoter is enhanced by a remote sequence element. Proc. Natl. Acad. Sci. USA, 91, 10819-10823 (1994). Rocbaix, J.-D.: Post-transcriptional steps in the expression of chloroplast genes. Annu. Rev. Cell Biol., 8, l-28 (1992). Sakamoto, W., Kindle, K. L., and Stern. D. B.: In vivo analvsis of Chlamydomonas chloroplast petD gene expression using stable transformation of $glucuronidase translational fusions. Proc. Natl. Acad. Sci. USA, 90, 497-501 (1993). -I.
22.
23.
24. 25.
Brosc~. BIOEN<;.
81, No.
3, 307-314.
1999
Expression of a Foreign Gene in Chlamydomonas reinhardtii Chloroplast KIYOHIDE
ISHIKURA,
YASUKO TAKAOKA, KO KATO, * MASAMI SEKINE, KAZUYA YOSHIDA, AND ATSUHIKO SHINMYO Graduate School of Biological Sciences, Nara Institute of Science and Technology, 8916-S Takayama, Ikoma, Nara 630-0101, Japan Received 16 September 1998/Accepted 16 November 1998
Chimeric genes for expression of a foreign gene in the Chlamydomonas reinhardtii chloroplast were constructed. These chimeric genes are composed of the promoter from chloroplast genes, rbcL, psbA, and atpA, S- and S/-untranslated regions, and the Escherichia coli ,9-glucuronidase (GUS) structural gene (uidA) as a foreign gene. Three types of chloroplast transformants (RG, PG, and AG), which contained the rbcL-uidA, psbA-uidA, and atpA-uidA chimerlc genes integrated in the chloroplast genome, were generated by particle bombardment. The AG transformant grown under photoautotrophlc conditions showed the highest GUS activity (130 nmol/min/mg protein) so far reported in C. reinhurdtii, and the accumulated GUS protein accounted for 0.08% of the total soluble proteins. GUS activity in RG was 12% of that in AG, and no activity was detected in PG. We also measured the GUS activity from transformants grown under heterotrophic conditions, but the culture conditions made little difference in activity levels. The difference in the amount of accumulated GUS protein in the transformants was paralleled by the difference in the level of transcripts, and the pattern of gene expression was not the same as that of the endogenous genes in the chloroplast. [Key words: Chlamydomonas reinhardtii, chloroplast,
transformation,
promoter,
expression,
p-glucuroni-
dase]
The chloroplast is one of the most important organelles in plant cells, since it performs several essential functions, such as biological photosynthesis, i.e., the conversion of light energy to high-energy chemical metabolites (ATP, NADPH, and carbohydrates), and photosynthetic carbon fixation to amino acids and fatty acid biosynthesis. Chloroplasts possess their own unique genetic system. The genes present in the chloroplast genome rely on RNA- and protein-synthesizing systems for their expression, and the apparatus for gene expression closely resembles that in prokaryotic cells. At present, introduction of useful genes into higher plants is limited to the nuclear genome. When considering future plant biotechnology, an important approach for improving and enhancing chloroplast function is manipulation of the chloroplast genome. Chloroplast gene expression is regulated at the transcriptional, posttranscriptional, and translational steps (1). We have to obtain a thorough understanding of the regulation of chloroplast gene expression in order to express a foreign gene efficiently in the chloroplast. Cells of the eukaryotic green alga, Chlamydomonas reinhardtii, are 10 pm in length and 3 pm in width. The cells contain a single cup-shaped chloroplast that occupies nearly 40% of the cell volume. The chloroplast genome consists of a 196-kb circular double-stranded DNA with approximately 80 copies per cell (2). C. reinhardtii is a powerful model system for studying chloroplast gene expression for several reasons. First, this organism can grow extremely well under controlled laboratory conditions and can form clear colonies on agar plates. Second, photosynthesis in C. reinhardtii is dispensable if a carbon source such as acetic acid is provided in the medium, and the organism can then grow photoautotro* Corresponding
phically, mixotrophically, or heterotrophically. Third, methods and tools have been developed recently for efficient chloroplast transformation (3-5). Chloroplast transformation can be achieved by bombardment of cells with DNA-coated gold particles. The transforming DNA is integrated efficiently into the chloroplast genome by homologous recombination. In the work reported here, we tried to construct a foreign gene expression system in the C. reinhardtii chloroplast. Three candidates for promoter were selected from chloroplast genes in C. reinhardtii, such as rbcL, psbA, and atpA genes, since transcripts of these genes were abundant in C. reinhardtii cells (6); the rbcL, psbA, and atpA encode the large subunit of ribulosebisphosphate carboxylase/oxygenase, Dl protein of the photosystem II reaction center, and the (Y subunit of ATP synthase, respectively. We constructed chimeric genes composed of the promoters, 5’- and 3’-untranslated regions of the chloroplast genes, and the Escherichia coli ,%glucuronidase gene @idA) as the reporter gene. These chimeric genes were introduced into the C. reinhardtii chloroplast by particle bombardment, and stable chloroplast transformants were selected. The effects of different promoters and untranslated regions on the gene expression were studied at the transcriptional and translational levels. MATERIALS
AND METHODS
Algae and culture conditions C. reinhardtii wildtype strain 137~ was obtained from Dr. M. GoldschmidtClermont (University of Geneva). This strain was cultured in Tris-acetate-phosphate (TAP) medium or Trismin (M) medium (7). C. reinhardtii nonphotosynthetic and photosynthetic transformants were maintained on TAP and M media, respectively. For the solid medium
author. 307
308
ISHIKURA
ET AL.
2% agar was added, and if necessary spectinomycin (100 pg/ml) was supplemented. All strains were grown in TAP medium in the dark (heterotrophic growth), in TAP medium under light (mixotrophic growth, 10001x), or in M medium under light (photoautotrophic growth, 1000 lx) at 25°C. Construction of chloroplast transfomation vectors Conventional cloning techniques were used throughout (8). The bacterial host was E. coli DH5a. In order to remove the SphI site, the plasmid vector pUC19 was digested with SphI, the ends were filled-in with a T4 DNA polymerase and ligated to obtain plasmid pUC19AS. A 3.9-kb EcoRI-BamHI fragment from plasmid R15 (9) containing the C. reinhardtii rbcL and psaB genes was inserted into pUC19AS digested with EcoRI and BamHI to obtain plasmid pUCEB; the psaB gene encodes the polypeptide of the photosystem I reaction center (Fig. 1). A 1.9-kb EcoRV-SmaI fragment containing an aadA expression cassette consisting of the atpA promoter region, aadA (aminoglycoside adenine transferase gene) coding region, and rbcL terminator region (4) was inserted into pUCEB digested partially with HpaI to obtain plasmid pUCEBaadA. The aadA gene confers resistance to spectinomycin on Chlamydomonas cells. The EcoRV- and ClaI-digested pUCEBaadA ends were filled-in with a Klenow fragment, and ligated to delete the rbcl-coding region. The resultant plasmid was designated pUCEBdrbcL. The coding sequence of the ,%glucuronidase gene (uidA) was amplified by the polymerase chain reaction (PCR) using the primer sets GUS5 and GUS3 (Table l), and pBIlO1 (10) as the template, and the amplified fragment was inserted into pT7Blue T-Vector (Novagen Inc., Madison, WI, USA) at the cloning site to obtain plasmid pT7GUS. A 1.8-kb NcoI-SphI fragment from pT7GUS was inserted into pUCEBaadA digested with NcoI and SphI to obtain plasmid pUCEBGUS. The NcoI site contains the translational initiation site of the uidA gene. For preparation of 5’-segments of the rbcL, psbA, and atpA genes, total DNA was isolated from C. reinhardtii wild-type 137~ (7), and used as the template for PCR amplification. The PCR primer sets for the 3 genes were RBCL5 and RBCL3 for SibcL, PSBAS and PSBA3 for 5lpsbA , and ATPAS and ATPA for S’atpA, respectively (Table 1). These 5’-segments were first subcloned in pT7Blue T-Vector at the cloning site, from which they were excised with CfaI and NcoI. The 0.37-kb S’rbcL, the 0.25-kb S’psbA, and the 0.58-kb 5’atpA ClaI-NcoI fragments were introduced into CfaI- and NcoI-digested pUCEBGUS. The plasmids generated were designated pGrbcL, pGpsbA, and pGatpA, respectively (Fig. 1A). The sequence of the 5’-segments were verified by sequencing, and some nucleotide substitutions were detected using the sequence database. These substitutions were detected in independent PCR products. Our sequences appear in the DDBJ, EMBL and GenBank nucleotide sequence databases with the following accession numbers; AB016252 for S’rbcL, AB016253 for S’psbA, and AB016254 for 5htpA. Preparation of fragments of the chloroplast-specific In order to assay a specific RNA in Chlamydogenes monas cells, the coding segments of the chloroplast genes were amplified by PCR using primers (Table 1) and total DNA from wild-type cells as the template; primer sets 16S5 and 16S3 for the 0.5kb internal por-
J. Broscx.
BIOENL,
tion of the 16s rRNA gene, PF and PR for the i.5-kb coding segment of the rbcL gene, PSBAS and PSBA30 for the 0.3-kb exon 1 of the psbA gene, and ATPASO and ATPA for the 1.4-kb internal portion of the atpA gene. Each PCR product was basically cloned into puc19. The plasmids generated were designated pUC16S, pUCrbcL, pUCpsbA, and pUCatpA, respectively. A 1.8-kb PstI-BamHI fragment from pT7GUS was cloned into pUC19 to create plasmid pUCGUS. PCR Twenty-five cycles of amplification were performed in a Perkin-Elmer thermal cycler. Each amplification cycle consisted of 1 min denaturation at 94°C 5 min annealing at 55”C, and 3 min extension at 72°C. The amplified products were analyzed by electrophoresis on a 1% agarose gel. Chloroplast transformation C. reinhardtii wildtype cells were plated onto agar TAP medium containing 100 ,ng/ml spectinomycin at a density of approximately 1 X 107cells/90-mm petri plate. Gold particles (1 ;rm) coated with plasmid DNAs were shot into Chlamydomonas cells on the agar plate using a Bio-Rad PDS 1OOOHe Biolistic gun at 1100 psi. After incubation in the dark for one week, the transformant colonies were subcultured on TAP-spectinomycin plates three to four times until they were homoplasmic. Nonphotosynthetic mutant cells were also plated onto agar M medium. After bombardment with plasmids containing the rbcL gene, the cells were incubated under light for two weeks. Transformants which could grow by photosynthesis were subcultured on M plates until they were homoplasmic. Preparation of crude extract from C. reinhardtii cells Cells were grown to a density of approximately 1 x lo6 cells/ml in TAP or M medium and were harvested by centrifugation at 2OOOxg for 10min at 4”C, resuspended in 1.3 ml of GUS lysis buffer [50 mM NaH2P04/ Na2HP04 (pH 7.0), 10 mM EDTA, and 10 mM 2-mercaptoethanol], and disrupted by sonication (level 9, Handy sonic model UR-20P, TOMY SEIKO Co. Ltd., Tokyo) for 20 x 15 s at 15 s intervals. The lysate was centrifuged at 100,000 x g for 1.5 h at 4”C, and the supernatant was used for the subsequent experiments. GUS assays The fluorescence assay of GUS activity was performed using 4-methylumbelliferyl glucuronide as described by Jefferson et al. (10). GUS activity was expressed as nanomoles of methylumbelliferone per minute per mg of protein. Western blot analysis of the GUS protein SDSpolyacrylamide gel electrophoresis (SDS-PAGE) was performed with a 7.5% acrylamide gel (17) and the separated proteins were immunoblotted (8) with rabbit polyclonal antibodies raised against E. coli GUS (Molecular probes Inc., Eugene, OR, USA, #A-5790) and then with a goat anti-rabbit IgG alkaline phosphatase conjugate according to the method of the manufacturer (Promega Co., Madison, WI, USA). Protein concentration was measured by the Coomassie blue dye-binding method (18). RNA isolation and Northern blot analysis of uidA About 3 x lo9 cells were lysed by extensive transcript grinding with a pestle and mortar in 10ml of 50 mM Tris-HCl buffer (pH 8.0) containing 300mM NaCI, 5 mM EDTA, 2 mM aurin tricarboxylic acid (Sigma Chemical Co., St. Louis, MO, USA), 2% SDS, 2% Natriisopropylnaphtalene sulfonate (Kant0 Chemical Co. Inc., Tokyo), and 12.8mM 2-mercaptoethanol in liquid nitrogen. The homogenate was supplemented with 1.4 ml of 3 M KC1 and stored on ice for 15 min. After centrifu-
VOL.
EXPRESSION
87, 1999
GENE IN CHLOROPLAST
309
NcoI-SphI fragment containing the entire uidA coding region was labeled with [(w-32P]dCTP and BcaBestTM (Takara Shuzo Co. Ltd., Kyoto) and used to probe the filter. 16s rRNA used as the internal control was hybridized with a 16s rRNA gene probe consisting of a 0.48kb NcoI-Sac11 fragment (14) labeled with [a-32P]dCTP. Prehybridization and hybridization were performed in hybridization buffer [250mM NaHP04 (pH 7.2), 1 mM EDTA, 1% bovine serum albumin, 250 mM NaCl, and 7% SDS] at 65°C (8, 19). The filter was washed once with Wash A [40 mM NaHP04 (pH 7.2), 1 mM EDTA, 0.5% bovine serum albumin, and 5%] for 30min at
gation at 2OOOxg for 20min at 4°C 7.3 ml of 10M LiCl were added to the supernatant and stored on ice for 30 min. Insolubilized RNA was precipitated by centrifugation at 30,000 x g for 25 min at 4”C, redissolved in 4ml of water, and then extracted two times each with phenol/chloroform and chloroform, to remove proteins in the RNA solution. Purified RNA was recovered by precipitation with ethanol and dissolved in 50~1 of water. The purified RNA (5 pg) was fractionated by electrophoresis in a 2% agarose-formaldehyde gel and transferred onto a Hybond-N+ (Amersham Pharmacia Biotech Ltd., Uppsala, Sweden) membrane (8). A 1%kb A
OF FOREIGH
pUCEB EV
HP
Ca
pUCEBaadA E I
__ ‘A#&
promoter S&CL
pGpsbA
5’PSbA .
SatpA --__
EV 1
(HP)
1
uidA gene
tsta
--__ I
-- 1
__--
*-
N,C
pGrbcL
E
--
I
Ca
pGatpA
cassett
4 8dA --__
EV I
SP
NC
-
puc19
terminator SP
__---_
--
_---
(HP)
1
Ba
Ba
-
puc19
pUCEBdrbcL
B GUS3R
PR
PG AG
transformed chloroplast genome
chloroplast
genome
chloroplasi
benome
FIG. 1. Construction of plasmids for chloroplast transformation. (A) GUS expression plasmids, pGrbcL, pGpsbA, and pGatpA, and related plasmids, pUCEB and pUCEBaadA, are shown. In the chimeric gene, the ui&l coding region (filled boxes) was placed between a region upstream of the chloroplast genes (open boxes) and the 3’-region of the &CL gene (stippled boxes, &CL); 5’rbcL (0.37-kb), 5jlsb.4 (0.25kb), and S’afpA (0.58-kb) are the S’-segments of the rbcL, psbA, and atpA genes, respectively. The chimeric ui&l genes were inserted into a EcoRI-BumHI chloroplast DNA fragment (thick line) between the rbcL and psuB genes (coding regions are shown by shaded boxes). pUCEBdrbcL is the rbcL-deletion plasmid, in which the rbcL gene was replaced by an n&A cassette consisting of the a@4 promoter, au&I coding region, and rbcL terminator. Plasmid pUC19 is shown by a thin line. (B) Primers for confirming the homoplasmicity of transformants. Location and direction of primers are indicated by arrowheads. E, EcoRl; EV, EcoRV; Ca, CM; NC, NcoI; Sp, SphI; Hp, HpuI; Ba, BumHI.
310
ISHIKURA
ET
AL.
J. B~oscl. TABLE
Gene
Oligo:
uidA
CUSS: GUS3: GUS3R: RBCLS: RBCL3: PF: PR: PSBAS: PSBA3: PSBA30: ATPAS : ATPA3: ATPASO: ATPA30: 16S5: 16S3: PC6: AAD3:
rbcL
psbA
afpA
16s rRNA psaB aadA
1.
Oligonucleotides
used in this work
Sectuencea,b
Position
CAGTCCCCCATGGTACGTCCTGTAGAA GCGGCATGCTTATTGTTTGCCTCCC CCGCAGCAGGGAGGCAAACAATAA GCACATCGATGGGTTTATAGGTATT AACCATGGATATAAATAAATGTAAC TTATTTTAGGATCGTCAAAAGAAG ATGCTATTCACATAAACATCATG CGTCCTATATCGATACTCCGAAGGA GCTGCCATGGGTTAATTTTTTTAAA CAACCGATGTATAAACGGTTTTCAG AATATCGATGACTTTATTAGAGGCAGTG ATTGCCATGGAAAAGAAAAAATAAATAA ATGGTAGATTTCGGTATCGTTTTCC AGCAGCTTTAGCTTGAGATTTAAATTC ATCCATGGAGAGTTTGATCCTGGCTC CCTCTGTATTACCGCGGCTGCTGGCA TCCTTATTGAGCCTGTATTTGCTC GATCACTAAGGTAGTTGGCAAATAA
a The oligonucleotides used as primers b The linkers are underlined.
for the PCR
are listed
2543-2569 436994345 4331-4360 823- 847 1196-1172 1149-1172 2652-2630 I25 259- 235 346- 322 920- 893 329- 356 261- 237 1362-1336 1455-1480 1947-1922 1501-1524 1172-1196 in 5-3’
65”C, several times with Wash B [40mM NaHP04 (pH 7.2), 1 mM EDTA, and 1% SDS] at 65°C (19), and then exposed to X-ray film with an intensifying screen at -80°C. The filter was also exposed to an imaging plate (Fuji Photo Film Co. Ltd., Kanagawa). The hybridization signals were quantified by a bio-imaging analyzer (BAS 2000, Fuji Photo Film). In vivo labeling of RNA A fifty-ml cell suspension of C. reinhardtii grown to a density of approximately 4 x 106 cells/ml in TAP medium was inoculated in 600 ml of low-phosphate TAP medium in which the phosphate concentration was reduced from 1 mM to 0.05 mM. Cells were grown for four to five generations under light (10001x) at 27°C with a doubling time of 5 to 6 h (7), and harvested by centrifugation at 3000 x g for 5 min at 4°C. Then, the cells were suspended in prewarmed fresh TAP medium without phosphate at a concentration of 2 x 10’ cells/ml. After incubation of the cell suspension for 30min at 27”C, 32P-orthophosphate (ICN Biochemicals Ins., Costa Mesa, CA, USA, in dilute HCl) was added at a concentration of 2 nM (175 kBq/ml). A 3.5-ml portion of the labeled culture was withdrawn at 10min after the initiation of the labeling to a centrifugation tube containing 2 volumes of ice-cold TAP medium. The cells were pelleted by centrifugation at 3000 X g for 3 min at 4°C and frozen in liquid nitrogen. Total Hybridization analysis of 32P-labeled RNA RNA was isolated from pulse-labeled cells by using FastPrep FP120 (BIO 101, Vista, CA, USA) and FastRNA KIT-RED (BIO 101) according to the recommendations of the supplier (BIO 101). Plasmid DNAs, pUCGUS, pUCrbcL, pUCpsbA, pUCatpA, pUC16S, and pUC19 (1 pg/slot) were applied to a Zeta-probe GT membrane (Bio-Rad, Hercules, CA, USA) in a Bio-Dot SF Microfiltration Apparatus (Bio-Rad), and were covalently linked to the membrane by exposure to UV light. Hybridization and prehybridization were carried out as described above. Prehybridization was carried out for 1 h after which total radioactive RNA was applied to the membrane and hybridization was performed for 70 h at 60°C. Autoradiography was carried out as described above.
HIOENC,.,
Linkerb
Reference
NcoI SphI
(10) (10) (10)
Clal NcoI
(9) (91 (91 (91 (11) (11) (11) (9, 121 (9, 12) (9) (131 (14) (14) (15)
CIaI NcoI CIaI NcoI
(16)
orientation.
RESULTS Construction of GUS expression vectors Three plasmids, pGrbcL, pGpsbA, and pGatpA, have been constructed for expression of the uidA gene in the C. reinhardtii chloroplast (Fig. 1A). The uidA gene was placed between the 5’-upstream region of the C. reinhardtii chloroplast genes, rbcL, psbA , or atpA, and the 3’-end of the rbcL gene. These 5’-upstream regions contain the promoter, Sluntranslated region, and the translation initiation AUG codon. As a result, the expression of the uidA gene would be controlled by the transcriptional and translational signals in the Chlamydomonas chloroplast. These chimeric genes were placed between the chloroplast genes, rbcL and psaB, so that the donor genes would be inserted into the target region in the chloroplast genome by homologous recombination (Fig. 1A). Transformation and selection of transformants In general, antibiotic-resistance marker genes are used for the selection of transformed plant cells. For the selection of chloroplast-transformed cells, we tried to use not only the spectinomycin-resistance gene, but also the rbcL gene, which is essential for photosynthesis and allows photoautotrophic growth of transformants when incorporated into a rbcl-deficient host cell. We constructed the rbcl-deletion plasmid pUCEBdrbcL, in which rbcL was replaced by an aadA cassette (4) (Fig. 1A). The plasmid pUCEBdrbcL was introduced into the chloroplast genome of C. reinhardtii strain 137~ by particle gun bombardment, and a transformant was selected by its resistance to spectinomycin in the dark. The transformant generated was designated DEVL. DEVL could not grow photoautotrophically at all (Fig. 3), and was used as a host cell for the subsequent chloroplast transformation. The GUS expression vectors were introduced into the chloroplast genome of DEVL, and transformants were selected by their ability to grow photosynthetically via rescue of rbcL. It was confirmed by PCR using GUS3R and PC6 as primer sets (Fig. lB, Table 1) that the donor genes were inserted into the target region in these transformants. A 1.4-kb amplified fragment was detected in all three transformants (Fig. 2A). Primer PC6 anneals to the chloroplast genome, but not to the integrated plasmid DNA. The transformants were subcultured on M
EXPRESSION
OF FOREIGH
WT
GENE IN CHLOROPLAST
DEVL
RG
PG
311
AG
FIG. 3. Growth of the transformants and control strains. C. reinhardtii wild-type 137~ (WT), rbcl-deleted nonphotosynthetic mutant (DEVL), and the transformants (RG, PC, and AG) were grown on various agar media. TAP, TAP medium; TAP 50, TAP medium containing 50 ,eg/ml spectinomycin; M 100, M medium containing 0.01% (v/v) acetic acid. Cells were incubated in the dark on TAP or TAP 50, or under light (1000 lx) on M 100 at 25°C for 10 d.
C
Ml2345
FIG. 2. The homoplasmicity of the transformants. Fragments amplified by PCR were analyzed by 1% agarose gel electrophoresis and detected by ethidium bromide staining. Total DNA was purified from the transformants, and the uidA gene using primer sets GUS3R and PC6 (A), the rbcL gene using primer sets PF and PR (B), and the aadA gene using primer setsAAD and PC6 (C) were amplified. Lanes l-5 were derived from the following cells; lane 1, C. reinhurdtii wild-type 137~; lane 2, DEVL; lane 3, RG; lane 4, PC; lane 5, AG. Lane M indicates R/Sty1 digest.
plates three or four times until they became homoplasmic. The transformants containing the rbcL-uidA, psbAuidA, and atpA-uidA chimeric genes were designated RG, PG, and AG, respectively. To confirm the homoplasmicity of the chloroplast genomes in the transformants, DNA segments of the entire rbcL, aadA, and uidA genes were amplified by PCR using primer sets PF/PR, AAD3/PC6, and GUS3R/PC6, respectively (Figs. 1B and 2, Table 1). When the primer sets PF and PR were used, the same 1.5kb fragments corresponding to rbcL were amplified in wild-type cells and all transformants except DEVL (Fig. 2B). In RG, an additional 2.0-kb amplified fragment was observed (Fig. 2B, lane 3). As shown in Fig. IB, PF and PR primers could also anneal to the 5’- and 3’-untranslated regions of the uidA gene in RG. A 1.9-kb amplified fragment in DEVL corresponding to the replacement of rbcL by the aadA cassette was also detected (Fig. 2B, lane 2). When the primer sets AAD and PC6 were used, amplified fragments were not detected in any of the three transfor-
mants (Fig. 2C). The transformants generated were sensitive to spectinomycin and could grow photoautotrophitally (Fig. 3). There were no differences in growth between the wild-type and transformant cells (Fig. 3). These results indicate that every transformant was homoplasmic and did not have any portion of the aadA gene. The accumulation of GUS protein in the transformants To examine the expression of the uidA gene in each transformant, proteins prepared from mixotrophitally grown cells were resolved by 7.5% acrylamide SDSPAGE, and the GUS protein was detected by Western blotting with the anti-GUS antibody. Two independent clones from each of the transformants were examined. A clear band was detected at the position corresponding to the molecular size of the GUS protein (68 kDa) in RG and AG, but not in PG (Fig. 4). Two nonspecific bands were detected in wild-type and the 3 transformants. The GUS activity in crude extracts of the transformants grown photoautotrophically is shown in Fig. 5. The AG and RG transformants showed 13Ok6.6 and 1625.5 nmol/min/mg protein in 3 independent transformants, respectively. The activity in wild-type and PG transformants was less than 0.4 nmol/min/mg protein. These results were consistent with the amount of GUS protein in the transformants, as shown in Fig. 4. The accumulation of uidA mRNA in the transforTo confirm the expression of the uidA gene at mants the transcriptional level, total RNA was extracted from W-f
a
RG b
a
PG b
a
AG
b
FIG. 4. Western blot analysis of the crude extracts. Proteins (3 pg) prepared from mixotrophically grown cells were resolved by 7.5% acrylamide SDS-PAGE, and the GUS proteins were detected by Western blotting. C. reinhardtii wild-type 137~ (WT) and two independent clones (a and b) in each of the transformants (RG, PG, and AG) were analyzed. The arrow indicates the position of the GUS protein.
312
ISHIKURA
ET AL.
.I B~osct. BIOEN(;.,
*
lWT
RG
AG
PG
FIG. 5. GUS activities of the transformants. Crude extracts were prepared from cells in photoautotrophic culture, and GUS activities were measured by fluorescent assay using 4-methylumbelliferyl glucuronide as the substrate. The data are the means *SD of three independent clones.
photoautotrophically grown cells and subjected to Northern blot analysis using the ui&I gene as the probe (Fig. 6). A single band of approximately 2.0 kb hybridized in RG, which was the expected size for a mRNA beginning at the same rbcL transcription start point as the normal transcripts, extending through the uidA coding sequence and ending at the position of the rbcL 3’-end. In AG, a 2.3 kb RNA, with the expected size from the atpA promoter to the rbcL 3’-end, was observed in abundance. The uidA transcript was scarcely detected in PG. The amount of uidA mRNA in AG was approximately 13-fold more than that in RG calculated relative to the amount of 16s rRNA. These results together with the amount and activity of GUS protein shown in Figs. 4 and 5, respectively, indicate that the differences in the accumulation of GUS protein among the transformants were the result of differences in the amounts of transcripts. By a pulse-labeling experiment (Fig. 7), rapid labeling of the uidA mRNA in the AG transformant was detected, but labeling was slow in RG, indicating that the WT
RG
PG
AG
FIG. 7. Transcriptional activity of the chimeric uidA gene in the transformants. Phosphate-starved cells of C. reinhnrdtii wild-type 137~ (WT) and the transformants (RG, PG, and AG) were labeled in vivo for 10 min with 32P-orthophosphate, and 32P-labeled RNA was hybridized to immobilized specific DNA on a membrane. Not only the uidA mRNA, but the endogenous atpA, rbcL, and psbA mRNAs and 16s rRNA were used as positive controls. pUCl9 DNA was used as the negative control.
amount of transcripts in AG and RG transformants might be controlled by the rate of transcription, not the stability of the mRNA. However, pulse-labeled uidA mRNA in PG was similar to that in RG, in spite of the significantly lower accumulation of the uidA mRNA (Fig. 6). This result suggests that rapid degradation of uidA mRNA occurred in the PG transformant. Pulselabeled RNAs of endogenous genes were almost the same in wild-type and transformant cells (Fig. 7). The Effect of culture conditions on GUS activity specific activity of GUS was higher in AG than in RG, and was not detected in PC grown under photoautotrophic conditions (Fig. 5). The endogenous enzymes encoded by rbcL and psbA were the most abundant proteins in the chloroplast (1). Since the state of chloroplast development and chloroplast gene expression were influenced by environmental conditions, especially light (20, 21), we investigated the effect of culture conditions on GUS activity in these transformants (Table 2). GUS specific activity in cells grown in a photoautotrophic culture was 1.5 to 4.5fold higher than that in a heterotrophic culture. But, ratio of GUS activity among RG, PG, and AG was similar under both culture conditions. DISCUSSION
uidA mRNA
Genetic manipulation of the chloroplast genome might be an important technique for construction of useful transgenic plants in the future. Since transformation of chloroplasts of higher plants is still difficult (22), we chose a green alga, C. reinhardtii, as the model plant. Transformation of the C. reinhardtii chloroplast genome
16s rRNA TABLE
GUS specific activitya (nmol/min/mg protein) Photoautotrophic Heterotrophic conditions conditions WT 0.36kO.076 0.08110.028 16k5.5 1123.6 RG PG 0.35kO.074 o.o77t-0.020 62211 AG 130t6.6 a Mean (fS.D.) of three independent clones.
Strains FIG. 6. Northern blot analysis of u&I mRNA in the transformants. Total RNA was extracted from photoautotrophically grown cells and 5 ,ug of total RNA was separated on a 2% formaldehyde/agarose gel, transferred to a membrane, and probed with the oligonucleotide corresponding to the #idA or 16s rRNA genes, as described in Materials and Methods. C. reinhardtii wild-type 137~ (WT) and the transformants (RG, PG, and AG) were analyzed.
2. Effect of culture conditions on GUS activity
VOL.87, 1999 was obtained by particle bombardment followed by homologous recombination (3-5). About 102 to lo3 transformant colonies could be obtained in one week of cultivation after bombardment, and homogenous selection of transformants was established within 1 to 2 months under suitable selection conditions. In our attempt to construct an efficient gene expression system in chloroplasts, three candidates for promoter were selected from the chloroplast genes in C. reinhardtii, namely, the rbcL, psbA, and atpA genes, since transcripts of these genes were abundant in C. reinhardtii cells (6). An aproximately 0.5kb 5’-upstream region of each gene was linked to the uidA reporter gene and introduced into the C. reinhardtii chloroplast genome. The chimeric uidA genes with the atpA and rbcL promoters showed 130 and 16nmol/min/mg protein GUS activity, respectively, but that with the psbA promoter showed scarcely detectable GUS activity (Fig. 5). The GUS activity level was basically consistent with the amount of uidA transcript (Fig. 6). The RG transformant accumulated a small amount of the chimeric uidA mRNA compared with that of the atpA-uidA mRNA, and PG accumulated no p.sbA-uidA mRNA. The endogenous rbcL and psbA genes are represented by the largest mRNA pools in the C. reinhardtii chloroplast (6). This means that the pattern of chimeric gene expression is not the same as that of endogenous genes. The transcriptional activities of the endogenous chloroplast genes (rbcL, psbA, and atpA) have been measured (6). The rbcL gene is transcribed about 2.3-fold more actively than psbA, and 17-fold more rapidly than the mRNA in atpA. We also measured the transcriptional activity of the chimeric uidA genes in the transformants (Fig. 7). Although we replaced only the rbcL and psbA coding region with uidA, the transcriptional activities of the rbcL-uidA and psbA-uidA chimeric genes were lower than that of the atpA-uidA chimeric gene, and did not proceed at the same rate as with the endogenous chloroplast genes. The activity of the rbcL promoter is enhanced by a sequence lying between positions + 126 and + 170 in the coding region of the rbcL, in which position + 1 is the site of initiation of transcription and position +93 is the site of initiation of translation (23). Therefore we assume that the rbcL-uidA chimerit gene construct may not have had full transcriptional activity. There are several possibilities to explain the difference in psbA gene expression between the endogenous and chimeric uidA genes. In the psbA-uidA chimeric gene, the 240-bp upstream region of the psbA gene was ligated to the uidA coding sequence. It is thought that the full promoter activity of the psbA gene requires the 240-bp upstream sequence, and/or the coding region as dose the rbcL gene. Although the psbA-uidA chimeric gene had transcriptional activity, the transcripts did not accumulate in the PG transformant (Figs. 6 and 7). The transcripts from the psbA-uidA chimeric gene may be rapidly degraded. Several chloroplast-encoded mRNAs contain sequences within the S/-untranslated region that have the potential to form stem-loop structures, and these may play a role in mRNA stability (1, 24). Probably the 5’-untranslated region of the psbA-uidA mRNA could not make a correct structure for high mRNA stability. In addition to the 5’-untranslated region, the coding region of the psbA gene might need to form a stem-loop structure for mRNA stability. These data sug-
EXPRESSIONOFFOREIGH GENEINCHLOROPLAST 313 gest that the rbcL and psbA promoters and 5’-untranslated regions are not sufficient to express a foreign gene, and their coding regions may be needed for complete gene expression. The AG transformant accumulated the most GUS protein of the various transformants examined in this experiment (Fig. 5), and their GUS specific activity was about 200-fold that in the pDG3 transformant (0.57 nmol/min/ mg protein) harboring the petD-uidA chimeric gene; petD encodes subunit IV of the cytochrome bs/f complex (25), which has the highest GUS activity so far reported in Chlamydomonas. The accumulated GUS protein accounted for 0.08% of the soluble protein in the AG transformant cells calculated on the basis of the specific activity of purified ,&glucuronidase (168,000 nmol/ min/mg protein, #G7646, Sigma). When a useful foreign gene is introduced into the C. reinhardtii chloroplast in an expression cassette using the atpA gene promoter and S/-untranslated region, it may be expected that the presence of the gene product is enough to alter the function of the chloroplast. We also measured the GUS activity under heterotrophic conditions (Table 2), but little difference was noted between two culture conditions. This result shows that the expression of a foreign gene using these expression cassettes is not influenced much by environmental conditions, such as carbon source or light. In the advancement of the metabolic engineering of plants and plant cells, manipulation of the chloroplast genome will become more important for improvement of plant metabolism. At present, metabolic modification of the chloroplast is done by insertion of a foreign gene into the nuclear chromosome and translocation of the expressed protein equipped with a targetting signal to the chloroplast from the cytoplasm. Direct transformation of the chloroplast genome is a simpler system. In the transformation of plants by bacterial genes, integration in the chloroplast genome must be emphasized, since the gene expression system in chloroplasts is basically the prokaryotic type. Study on the control mechanisms of gene expression of the Chlamydomonas chloroplast genome in detail will be applied to transformation of the chloroplast genome in higher agriculturally and industrially important plants in the near future. ACKNOWLEDGMENTS We wish to thank Dr. Michel Goldschmidt-Clermont (University of Geneva) for kindly providing the aadA cassette and plasmid R15. This work was supported in part by the “Research for the Future” Program from the Japan Society for the Promotion of Science (JSPS) (Project JSPS-RFTF97R16001) and Grants-in-Aid for scientific research, No. 09450305 and No. 10170221, to A.S. from the Ministry of Education, Science and Culture, Japan. REFERENCES Rochaix, J.-D.: Post-transcriptional regulation of chloroplast gene expression in Chlamydomonas reinhardtii. Plant Mol. Biol., 32, 327-341 (1996). Harris, E. H.: The Chlamydomonas Sourcebook. Academic Press Inc., San Diego (1989). Boynton, J. E. and Gillham, N. W.: Chloroplast transformation in Chlamydomonas, p. 510-536. In Wu, R. (ed.), Methods in enzymology, vol. 217. Academic Press Inc., San Diego (1993). Goldschmidt-Clermont, M.: Transgenic expression of aminoglycoside adenine transferase in the chloroplast; a selectable
314
5. 6.
I.
8. 9.
ISHIKURA
ET AL.
marker for site-directed transformation of Chlamydomonas. Nucl. Acids Res., 19, 4083-4089 (1991). Zhu, G. and Spreitzer, R. J.: Directed mutagenesis of chloroplast ribulosebisphosphate carboxylase/oxygenase. J. Biol. Chem., 269, 3952-3956 (1994). Blowers, A. D., Ellmore, G. S., Klein, U., and Bogorad, L.: Transcriptional analysis of endogenous and foreign genes in chloroplast transformants of Chlamydomonas. Plant Cell, 2, 1059-1070 (1990). Rochaix, J.-D., Mayfield, S., Goldschmidt-Clermont, M., and Erickson, J.: Molecular biology of Chlamydomonas, p. 253275. In Shaw, C. H.(ed.), Plant molecular biology, IRL Press, Oxford (1988). Sambrook, J., Fritsch, E. F., and Maniatis, T.: Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989). Dron, M., Rahire, M., and Rochaix, J.-D.: Sequence of the chloroplast DNA region of Chlamydomonas reinhardtii containing the gene of the large subunit of ribulose bisphosphate carboxylase and part of its flanking genes. J. Mol. Biol., 162, 775-793
.f
15.
16.
17.
18. 19. 20.
(1982).
10. Jefferson, R. A., Kavanagh, T. A., and Bevan, M. W.: GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J., 6, 3901-3907 (1987). 11. Erickson, J. M., Rahire, M., and Rochaix, J.-D.: Chlamydomonas reinhardtii gene for the 32,OOOmol. wt. protein of photosystem II contains four large iontrons and is located entirely within the chloroplast inverted repeat. EMBO J., 3, 2753-2762 (1984). 12. Fiedler, H. R., Schmid, R., Leu, S., Shavit, N., and Strotmann, H.: Isolation of CFOCFl from Chlamydomonas reinhardtii cw15 and the N-terminal amino acid sequences of the CFOCFl subunits. FEBS Lett., 337, 163-166 (1995). 13. Leu, S., Schlesinger, J., Michaels, A., and Shavit, N.: Complete DNA sequence of the Chlamydomonas reinhardtii chloroplast atpA gene. Plant Mol. Biol., 18, 613-616 (1992). 14. Dron, M., Rahire, M., and Rochaix, J.-D.: Sequence of the chloroplast 16s rRNA gene and its surrounding regions of
21.
Chlamydomonas reinhardtii. Nucl. Acids Res., 10, 7609-7620 (1982). Kueck, U., Choquet, Y., Schneider, M., Dron, M., and Bennoun, P.: Structural and transcription analysis of two homologous genes for the P700 chlorophyll a-apoproteins in Chlumydomonas reinhardtii: evidence for in vivo trans-splicing. EMBO J., 6, 2185-2195 (1987). Hollingshead, S. and Vapnek, D.: Nucleotide sequence analysis of a gene encoding a streptomycin/spectinomycin adenylyltransferase. Plasmid, 13, 17-30 (1985). Laemmli, U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680.-685 (1970). Bradford, M. M.: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem., 72, 248-254 (1976). Church, G.M. and Gilbert, W.: Genomic sequencing. Proc. Natl. Acad. Sci. USA, 81, 1991-1995 (1984). Hauser, C. R., Gillham, N. W., and Boynton. J. E.: Translational regulation of chloroplast genes. J. Biol. Chem., 271, 1486-1497 (1996). Salvador, M. L., Klein, U., and Bogorad, L.: Light-regulated and endogenous fluctuations of chloroplast transcript level in Chlamydomonas. Regulation by transcription and RNA degradation. Plant J., 3, 213-219 (1993) Zoubenko, 0. V., Allison, L. A., Svab, Z., and Maliga, P.: Efficient targeting of foreign genes into the tobacco olastid genome. Nucl. Acids Res., 22, 3819-3824 (1994). . Klein, U., Salvador, M. L., and Bogorad, L.: Activity of the Chlamydomonas chloroplast rbcL gene promoter is enhanced by a remote sequence element. Proc. Natl. Acad. Sci. USA, 91, 10819-10823 (1994). Rocbaix, J.-D.: Post-transcriptional steps in the expression of chloroplast genes. Annu. Rev. Cell Biol., 8, l-28 (1992). Sakamoto, W., Kindle, K. L., and Stern. D. B.: In vivo analvsis of Chlamydomonas chloroplast petD gene expression using stable transformation of $glucuronidase translational fusions. Proc. Natl. Acad. Sci. USA, 90, 497-501 (1993). -I.
22.
23.
24. 25.
Brosc~. BIOEN<;.