- Email: [email protected]
Expression of a glycine decarboxylase complex H-protein in non-photosynthetic tissues of Populus tremuloides
Biochimica et Biophysica Acta 1676 (2004) 266 – 272 www.bba-direct.com
Short sequence-paper
Expression of a glycine decarboxylase complex H-protein in non-photosynthetic tissues of Populus tremuloides Yuh-Shuh Wang 1, Scott A. Harding, Chung-Jui Tsai * Plant Biotechnology Research Center, School of Forest Resources and Environmental Science, Michigan Technological University, Houghton, MI 49931, USA Received 25 September 2003; received in revised form 12 December 2003; accepted 22 December 2003
Abstract The Gly decarboxylase complex (GDC) is abundant in mitochondria of C3 leaves and functions in photorespiratory carbon recovery. However, expression of GDC component proteins has generally been less evident in non-green tissues. Here we report an aspen (Populus tremuloides Michx.) PtgdcH1 gene, encoding a GDC subunit H-protein that is phylogenetically distinct from previously characterized photorespiratory H-proteins. Strong expression of PtgdcH1 in root tips and developing xylem suggests that GDC supports a very active C1 metabolism in non-photosynthetic tissues of aspen. D 2004 Elsevier B.V. All rights reserved. Keywords: Glycine decarboxylase complex; H-protein; One-carbon metabolism; Populus
The mitochondrial Gly decarboxylase complex (GDC) supports the Gly-Ser interconversion of photorespiration in plants, and is considered to represent an important route for the generation of one-carbon (C1) units for biosynthetic reactions in all organisms [1,2]. In photosynthetic leaves of pea, GDC is abundant and cooperates with Ser hydroxymethyltransferase (SHMT, also known as Gly hydroxymethyltransferase) to salvage high fluxes of photorespiratory Gly for synthesis of C3 units that can reenter the Calvin cycle [3 –5]. In non-photosynthetic tissues such as pea roots, GDC is detected at comparatively low levels [6 – 8], but SHMT is readily detected [9,10]. This led to the notion that SHMT can act without GDC for the catabolism of Ser into Gly and C1 units in non-photosynthetic tissues [11]. However, inhibition of GDC by victorin caused cell death in both photosynthetic and non-photosynthetic tissues, indicating that GDC may be required for non-photorespiratory biochemical functions in non-green tissues [12]. Later, GDC was shown to be tightly coupled to SHMT for glycine-serine
* Corresponding author. Tel.: +1-906-487-2914; fax: +1-906-4872915. E-mail address: [email protected] (C.-J. Tsai). 1 Current address: Plant Biology Division, Samuel Roberts Nobel Foundation, Ardmore, OK 73401, USA. 0167-4781/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.bbaexp.2003.12.004
catabolism associated with C1 pathways in non-photosynthetic sycamore cell cultures by 13C-NMR [13]. More recently, 13C-NMR confirmed that GDC/SHMT mediated the generation of most C1 units in non-photosynthetic Arabidopsis roots, accounting for nine-fold higher serine conversion than the alternative, GDC-independent C1-tetrahydrofolate synthase/SHMT pathway [14]. The involvement of GDC in C1 metabolism of nonphotosynthetic tissues, however, has not been supported at the transcript level. GDC is composed of four proteins, designated P, H, T and L, encoded by nuclear genes with N-terminal mitochondrial targeting presequences [5]. Genes encoding GDC component proteins have been isolated from green tissues of pea, Arabidopsis and Flaveria (reviewed in Ref. [15]). Expression of these genes is regulated in a light-dependent manner and, with the exception of the L-protein, which also functions in other multienzyme complexes [10], is strongest in green leaves but weak to undetectable in non-photosynthetic tissues [6 – 8,16,17]. Molecular evidence to support a role for GDC in non-green tissues thus remains scarce. Here we report the cloning of an aspen (P. tremuloides Michx.) PtgdcH1 cDNA that exhibits the conserved motif signatures of GDC H-subunit sequences and is abundantly expressed in nonphotosynthetic tissues of aspen where C1 metabolic demand is high.
Y.-S. Wang et al. / Biochimica et Biophysica Acta 1676 (2004) 266–272
A partial PtgdcH1 cDNA fragment was originally isolated as a xylem up-regulated (relative to phloem) clone by differential display. Xylem cDNA library screening yielded a full-length PtgdcH1 cDNA (GenBank accession no. AY229875) that is 783-bp long with a short open reading frame (ORF) of 468 bp. Southern blot analysis of four aspen genomic DNA digests with 3V-UTR or full-length PtgdcH1 cDNA probes suggested that PtgdcH1 belongs to a small gene family, most likely consisting of two members (data no shown). The predicted protein sequence of PtgdcH1 shares 65 –85% similarity with GDC H-subunit proteins found in bacteria, yeasts, animals and plants. It is most similar (85%) to an Arabidopsis H-protein At2g35120 that has not been characterized, but it exhibits only 72– 73% sequence homology to the previously reported photorespiratory H-proteins of pea [6] and Arabidopsis At2g35370 [18,19]. The protein sequence alignment of PtgdcH1 with several other plant H-proteins, including all three gdcH members of the Arabidopsis genome and representative Flaveria H-proteins [20], is shown in Fig. 1. Analysis of the translated PtgdcH1 protein sequence using the TargetP server v1.01 [21] predicted a 24-aa mitochondrial targeting sequence at the Nterminus, with a characteristic R-3 proteolytic cleavage motif R-X-X-A/S-T/S [22], as shown in Fig. 1. The predicted mature PtgdcH1 protein of 131 aa with a calculated Mr of 14.2 kDa matches the mature H-protein of pea [6], but the mitochondrial targeting sequence of PtgdcH1 is 10 aa shorter than that of the pea H-protein (Fig. 1). The uncharacterized At2g35120, likely orthologous to PtgdcH1, is also predicted to possess a short mitochondrial targeting sequence (Fig. 1). The lipoate-binding Lys residue (K-63) required for GDC-related H-protein function [6,23] is conserved in PtgdcH1 (Fig. 1, highlighted in black). In addition, several amino acid residues of pea H-protein (S-12, E-14, V62, A-64 and D/E-67), determined on the basis of X-ray crystal structure to interact with the methylamine group
267
during P-protein-catalyzed methylamination [24,25], are also conserved (Fig. 1, shaded in gray). The sequence analysis data confirm that the predicted PtgdcH1 protein possesses the sequence elements known to be essential for GDC H-protein function. Expression of PtgdcH1 in various aspen tissues was analyzed by Northern blot analysis using full-length PtgdcH1 cDNA as a probe. PtgdcH1 transcripts were most abundant in root tips and developing xylem of aspen (Fig. 2A). Unlike other previously characterized gdcH genes from pea and Arabidopsis (At2g35370) that were highly expressed in green tissues [6,19,26], PtgdcH1 transcript levels in apices, leaves and young stems were surprisingly low (Fig. 2A), and could only be detected after prolonged exposure. To confirm successful RNA transfer in all lanes, the blot was stripped and re-probed with a full-length cDNA encoding a cytosolic isoform of cyclophilin, designated PtCyP (AY229877). PtCyP was originally isolated from the same differential display experiment as PtgdcH1 (Y.-S. Wang and C.-J. Tsai, unpublished), and exhibited a more ubiquitous, although variable, expression pattern than PtgdcH1 on Northern blots (Fig. 2A). Seasonal expression patterns of PtgdcH1 were analyzed in developing xylem and phloem tissues harvested from field-grown aspen trees at monthly, biweekly and weekly intervals during the growing seasons of 1998, 1999 and 2000, respectively (Fig. 2B and data not shown). As exemplified by the 2000 growing season data, PtgdcH1 was highly expressed in xylem from mid-June to mid-August in 2000, but was barely detectable in phloem throughout the investigation period (Fig. 2B). In contrast, PtCyP was more abundantly expressed in phloem than xylem from late May to mid-August (Fig. 2B). Overall, it appears that the low transcript abundance of PtgdcH1 in green tissues is inadequate to support photorespiration based on reports of high gdcH gene expression in photosynthetic tissues of pea and Arabidopsis [5]. Instead, the high expression level of
Fig. 1. Sequence alignment of predicted H-proteins from aspen and other plant species. The predicted mitochondrial targeting sequences are boxed, and the Arg residue at 3 of the conserved proteolytic cleavage motif R-X-X-A/S-T/S is shown in bold face. The lipoate-binding Lys residue is highlighted in black, amino acid residues involved in methylamine-binding are shaded in gray. Amino acid numbers are based on predicted mature proteins. GenBank accession numbers are: pea, CAA45978; F. primglei, CAB16914; F. anomala, CAB16710; and F. trinervia, CAA85760.
268
Y.-S. Wang et al. / Biochimica et Biophysica Acta 1676 (2004) 266–272
Fig. 2. Northern hybridization and RT-PCR analyses. (A) Total RNA (10 Ag per lane) was resolved by denaturing agarose gel electrophoresis, blotted onto a nylon membrane, and hybridized consecutively with 32P-labeled fulllength PtgdcH1 and PtCyP cDNA probes at high stringency. Photographs of ethidium bromide-stained rRNAs were used to confirm similar RNA loading. (B) Seasonal regulation of PtgdcH1 in vascular tissues of fieldgrown trees during the 2000 growing season. (C) RT-PCR analysis of PtgdcH1 and PtgdcH3 in aspen tissues using total RNA from apices, young leaves, developing xylem and root tips, and gene-specific, ORF-flanking primers (ATGGCTTCAAGATTGTTGTGGGCTTCAAGG and TCA ATGCTTTGCATCTTCTTCTTCACAGAACTTAGC for PtgdcH1; ATG G C A C T G A G G T T G T G G G C T T C T T C A A C G a n d CTAAT G A GATTCTTCTTCCTCGCAGAATTTTGTG for PtgdcH3). RT-PCR amplification of PtCyP cDNA was also included as a control using ATG GCAAACCCTAAAGTCTACTTCGATATG and TCA AGAAAGCTGACCACAATCAGCAACAACAAC primers.
PtgdcH1 in root tips and developing xylem of aspen, particularly during the period of most active wood formation as manifested by active lignin gene expression [27,28] in fieldgrown trees, suggests a close association of PtgdcH1 with phenolic metabolism and lignification in these tissues.
To investigate the spatial association of PtgdcH1 with lignification during aspen stem development, in situ hybridization experiments were conducted. Semi-thin (8 Am) paraffin stem sections of greenhouse-grown aspen were hybridized with DIG-labeled, full-length antisense PtgdcH1 RNA probes. During primary growth, PtgdcH1 transcripts were localized to protoxylem elements, as shown for the first internode in Fig. 3A. At internode 6 where secondary growth had begun, PtgdcH1 transcripts were detected in newly developed xylem fibers, ray parenchyma, phloem fibers, as well as in the perimedullary zone (Fig. 3B). At internode 15, PtgdcH1 was abundantly expressed in developing fibers and ray parenchyma of xylem (Fig. 3C). PtgdcH1 transcripts were also detected in primary and secondary phloem fibers of internode 15, but were less abundant than in xylem cells. Hybridization with sense PtgdcH1 riboprobes yielded no signal (data not shown). In situ hybridization results thus provide evidence that PtgdcH1 expression is localized to lignifying rather than photosynthetic tissues in aspen stem. Preliminary phylogenetic analysis indicated that aspen gdcH1 is evolutionarily distinct from previously reported Hproteins of photosynthetic tissues. We therefore performed a search of the public Populus EST database for additional Populus gdcH gene members, including those that encode the photorespiratory isoforms. GenBank currently houses in excess of 120,000 Populus ESTs, including more than 11,000 from our laboratory, from a wide range of tissues types [29,30]. BLAST search of GenBank ESTs using the PtgdcH1 cDNA sequence identified more than 30 Populus ESTs that are nearly identical to PtgdcH1, but failed to identify additional H-proteins. A modified in silico approach was then employed based on the highly conserved Nterminal mitochondrial targeting sequences of photorespiratory H-proteins (Fig. 1). A 30-bp cDNA sequence downstream from ATG of Arabidopsis At2g35370 was successfully used to identify two poplar ESTs (BU883461 and BU869151) from the GenBank EST database, which led to 13 additional Populus ESTs when they were used as bait. Sequence assembly of the 15 ESTs by the CAP3 program [31] resulted in two contigs with complete ORFs, and one singleton containing a partial ORF. The predicted proteins of the two contigs were highly similar to each other (99%), and to the photorespiratory H-proteins of pea and Arabidopsis (>90%), but exhibited a lower degree of similarity (74%) to PtgdcH1. A sense primer, corresponding to the region immediately downstream of ATG that is identical between the two contigs, was used in conjunction with an oligo-dT primer for RT-PCR cloning of the aspen ortholog from young leaf RNA. A 700-bp clone, designated PtgdcH3, was amplified, cloned and sequenced (AY369261). Like other photorespiration-associated H-proteins, PtgdcH3 also contains a longer N-terminal mitochondrial targeting sequence that is highly conserved (Fig. 1). The results indicated that PtgdcH3 is a likely ortholog of the photorespirationassociated pea H-protein and Arabidopsis At2g35370.
Y.-S. Wang et al. / Biochimica et Biophysica Acta 1676 (2004) 266–272
269
Fig. 3. In situ localization of PtgdcH1 transcripts in aspen stem tissues. Transverse stem sections (8 Am thickness) were hybridized with digoxygenin-labeled antisense PtgdcH1 RNA probes and photographed in bright field. Shown are transverse section of 1st internode (A), 6th internode (B), and 15th internode (C). Scale bar: 200 Am for A and C and 100 Am for B. co, cortex; cz, cambial zone; ppf, primary phloem fiber; spf secondary phloem fiber; xyl xylem.
Tissue-specific expression of PtgdcH3 and PtgdcH1 in aspen was compared by RT-PCR analysis of cDNAs derived from apices, young leaves, root tips and developing xylem using gene-specific primers flanking their respective ORFs. As seen in Fig. 2C, PtgdcH3 transcripts were amplified from apex and young leaf cDNAs, but not from root tip and xylem cDNAs. In contrast, PtgdcH1 transcripts were amplified from xylem and root tips, but the yield from green tissues was much lower (Fig. 2C), as expected based on the Northern hybridization (Fig. 2A). Expression levels of PtgdcH1 and PtgdcH3 are similar in their respective tissues, suggesting high levels of GDC activity to support distinct metabolic needs of these tissues. A phylogenetic tree was constructed to determine the relatedness of the two aspen H-proteins to other known Hproteins. Nineteen representative full-length gdcH mature protein sequences from bacteria, fungi, animal and plants, including all known members from the Arabidopsis and rice genomes, were analyzed. PtgdcH1 clustered with Arabidopsis At2g35120 as expected, and with two members of the rice H-protein family. Together these sequences formed a branch that is phylogenetically more closely related to the bacterial H-protein than to the photorespiration-associated H-proteins from pea, Arabidopsis (At2g35370) and Flaveria (Fig. 4). In contrast, PtgdcH3 clustered with all previously characterized photorespiratory H-proteins. At least 15 Hproteins have been reported from various C3, C4 or C3-C4 intermediate species of the genus Flaveria [20,32], and these sequences clustered nearer pea gdcH and Arabidopsis At2g35370 (data not shown), as exemplified by the three representative Flaveria H-proteins shown in Fig. 4. The phylogenetic data support our argument for the presence of a previously undescribed and phylogenetically distinct Hprotein in non-photosynthetic tissues of aspen and other higher plants. Sequence homology, expression pattern and phylogenetic analyses thus provide evidence that PtgdcH1 and PtgdcH3 encode structurally and perhaps functionally distinct Hprotein isoforms. The high level of PtgdcH1 transcripts in aspen root tips and developing xylem is consistent with the high demand for C1 units in phenolic-rich tissues. Aspen
root tips accumulate an abundance of condensed tannins, indicative of a high level of phenolic metabolism supported by strong 4-coumarate:CoA ligase and phenylalanine ammonia-lyase expression not observed in other meristematic tissues such as shoot apices [33,34]. Lignification in woody stems is perhaps the most C1-demanding metabolic activity in higher plants, requiring over 2000 Amol C1 units per gram of dry weight as calculated by Hanson and Roje [35] for birch wood. Consistent with the association of PtgdcH1 with GDC in lignifying tissues, Populus ESTs encoding the P-, T- and L-proteins from wood-forming (cambial, xylem or wood) tissues have also been identified in the GenBank EST database (data not shown). Moreover, gdcH and SHMT comprise large xylem EST clusters in wood forming tissues of loblolly pine [36,37]. SHMT was also identified as one of the most abundant xylem proteins in poplar by comparative 2-D polyacrylamide gel electrophoresis coupled with peptide micro-sequencing [38]. According to Vander Mijnsbrugge et al. [38], the most abundant SHMT species in both cases exhibited much higher sequence homology to a group of Arabidopsis SHMT-like proteins than to the pea [10] or Arabidopsis At5g26780 [39] and At4g37390 [40] photorespiratory SHMTs. Thus, it appears that the plant SHMT gene family also contains divergent, tissue-adapted members that may cooperate with specific GDC isoforms. Our findings of two tissue-specific and structurally distinct H-proteins (hence distinct GDCs) in higher plants can account for why mutant Arabidopsis and barley lacking photorespiratory GDC survive only under non-photorespiratory conditions [41 – 43]. Evidently, the C1 pathway-associated H-protein isoform of GDC was not affected and would sustain GDC-SHMT activity to support mutant growth under elevated CO2 concentrations. The low abundance of PtgdcH1 in green tissues (Fig. 2) along with its segregation into lignifying or otherwise C1-active cells (Fig. 3) may also reflect a compartmentalization of its associated GDC away from photosynthetic cells and photorespiration, and a concomitant failure to support photorespiration in such mutants. The Arabidopsis genome contains two gdcP, three gdcH, one gdcT and two ldh (lipoamide dehydrogenase,
270
Y.-S. Wang et al. / Biochimica et Biophysica Acta 1676 (2004) 266–272
Fig. 4. Phylogenetic analysis of representative H-proteins across kingdoms. The dendrogram was created using the Clustalw (www.ebi.ac.uk/clustalw) and the Treeview programs (http://taxonomy.zoology.gla.ac.uk/rod/treeview). Bootstrap values were determined using the GeneBee’s TreeTop program (http:// www.genebee.msu.su/genebee.html) with 100 replicates. Sequences are the same as Fig. 1, with the following additions: mouse, BAB31951; human, P23434; chicken, P11183; fruit fly, Q9U616; yeast, CAC19751; bacteria, BAB41997; common iceplant, P93255; rice, 903.t00001, 1956.t00012 and 3710.t00012 (The Institute of Genome Research, http://www.tigr.org/).
L-protein) genes [44,45]. The gdcP and ldh families each contain two gene members encoding highly similar P- and L-proteins (94% and 96% similarity, respectively). In contrast, the gdcH family is more variant, containing two highly (95%) similar gene members and a more divergent (75% similar) isoform At2g35120 that is orthologous to PtgdcH1. This raises the possibility that the differentially expressed H-proteins may possess structural differences that somehow modulate GDC activities differently in photorespiratory versus non-photorespiratory tissues. As described earlier, the sequence differences between PtgdcH1 and PtgdcH3 do not involve amino acid residues thought to be key for interaction with other GDC component proteins [15], pointing to functional conservation. However, their overall low degree of sequence similarity does not exclude the possibility that the two aspen H-proteins may exhibit differential flexibility in their interactions with other GDC component proteins. Interestingly, in this regard, the two Arabidopsis mitochondrial L-proteins (ldh1 and ldh2) also exhibit differential, though overlapping, expression patterns in photosynthetic and non-photosynthetic tissues, and this has been taken to suggest their differential association with GDC and a-ketoacid dehydrogenase complexes, respectively [45]. Genetic study, however, revealed that
ldh2 also functions in GDC, suggesting functional flexibility [45]. The potential for functionally distinct associations of these two L-proteins in photorespiring and C1demanding tissues, however, has not been explored. The soon-to-be-completed Populus genome sequencing project by the United States Department of Energy [30] will enable rapid identification of all gene members of the GDC component proteins in Populus, and will facilitate investigation into whether non-photosynthetic tissues of tree species contain distinct isoforms of other GDC component proteins, along with PtgdcH1, to support C1 metabolism. In sum, the present study provides new insights into an old pathway, and should trigger additional efforts to further our understanding of C1 metabolism in non-photosynthetic tissues. The plant C1 metabolism provides numerous opportunities for metabolic engineering, and results derived from this and future research should be of value in this endeavor.
Acknowledgements We thank Professor Vincent Chiang (North Carolina State University) for providing the aspen xylem cDNA library. This work was supported by a USDA-NRI grant (no.
Y.-S. Wang et al. / Biochimica et Biophysica Acta 1676 (2004) 266–272
98-35106-6630) to CJT and by a graduate student fellowship from the Michigan Technological University Graduate School.
References [1] G. Kikuchi, The glycine cleavage system: composition, reaction mechanism and physiological significance, Mol. Cell. Biochem. 1 (1973) 169 – 187. [2] E.A. Cossins, One-carbon metabolism, in: D.D. Davies (Ed.), The Biochemistry of Plants, vol. 2, Academic Press, New York, 1980, pp. 365 – 418. [3] D.J. Oliver, M. Neuburger, J. Bourguignon, R. Douce, Interaction between the component enzymes of the glycine decarboxylase multienzyme complex, Plant Physiol. 94 (1990) 833 – 839. [4] A.J. Keys, Synthesis and interconversion of glycine and serine, in: P.K. Stumpf, E.E. Conn (Eds.), The Biochemistry of Plants, vol. 5, Academic Press, New York, 1980, pp. 359 – 374. [5] D.J. Oliver, The glycine decarboxylase complex from plant mitochondria, Annu. Rev. Plant Physiol. Plant Mol. Biol. 45 (1994) 323 – 338. [6] D. Macherel, M. Lebrun, J. Gagnon, M. Neuburger, R. Douce, cNDA cloning, primary structure and gene expression for H-protein, a component of the glycine-cleavage system (glycine decarboxylase) of pea (Pisum sativum) leaf mitochondria, Biochem. J. 268 (1990) 783 – 789. [7] S.R. Turner, R. Ireland, S. Rawsthorne, Cloning and characterization of the P subunit of glycine decarboxylase from pea (Pisum sativum), J. Biol. Chem. 267 (1992) 5355 – 5360. [8] J. Bourguignon, P. Vauclare, V. Merand, E. Forest, M. Neuburger, R. Douce, Glycine decarboxylase complex from higher plants-Molecular cloning, tissue distribution and mass spectrometry analyses of the T protein, Eur. J. Biochem. 217 (1993) 377 – 386. [9] N.J. Walton, H.W. Woolhouse, Enzymes of serine and glycine metabolism in leaves and non-photosynthetic tissues of Pisum sativum L, Planta 167 (1986) 119 – 128. [10] S.R. Turner, R. Ireland, C. Morgan, S. Rawsthorne, Identification and localization of multiple forms of serine hydroxymethyltransferase in pea (Pisum sativum) and characterization of a cDNA encoding a mitochondrial isoform, J. Biol. Chem. 267 (1992) 13528 – 13534. [11] R.J. Ireland, D. Hiltz, Glycine and serine synthesis in non-photosynthetic tissues, Semin. Ser. 56 (1995) 111 – 118. [12] D.A. Navarre, T.J. Wolpert, Inhibition of the glycine decarboxylase multienzyme complex by the host-selective toxin victorin, Plant Cell 7 (1995) 462 – 463. [13] J.-M. Mouillon, S. Aubert, J. Bourguignon, E. Gout, R. Douce, F. Re´beille´, Glycine and serine catabolism in non-photosynthetic higher plant cells: their role in C1 metabolism, Plant J. 20 (1999) 197 – 205. [14] R. Li, M. Moore, J. King, Investigating the regulation of one-carbon metabolism in Arabidopsis thaliana, Plant Cell Physiol. 44 (2003) 233 – 241. [15] R. Douce, J. Bourguignon, M. Neuburger, F. Re´beille´, The glycine decarboxylase system: a fascinating complex, Trends Plant Sci. 6 (2001) 167 – 176. [16] Y. Kim, D. Oliver, Molecular cloning, transcriptional characterization and sequencing of the cDNA encoding the H-protein of the glycine decarboxylase complex in peas, J. Biol. Chem. 265 (1990) 848 – 853. [17] Y. Kim, K. Shah, D.J. Oliver, Cloning and light-dependent expression of the gene coding for the P-protein of the glycine decarboxylase complex from peas, Physiol. Plant. 81 (1991) 501 – 506. [18] R. Srinivasan, D.J. Oliver, H-Protein of the glycine decarboxylase multienzyme complex. Complementary DNA encoding the protein from Arabidopsis thaliana, Plant Physiol. 98 (1992) 1518 – 1519. [19] R. Srinivasan, D.J. Oliver, Light-dependent and tissue-specific expression of the H-protein of the glycine decarboxylase complex, Plant Physiol. 109 (1995) 161 – 168.
271
[20] S. Kopriva, C.-C. Chu, H. Bauwe, H-protein of the glycine cleavage system in Flaveria: alternative splicing of the pre-mRNA occurs exclusively in advanced C4 species of the genus, Plant J. 10 (1996) 369 – 373. [21] O. Emanuelsson, H. Nielsen, S. Brunak, G. von Heijne, Predicting subcellular localization of proteins based on their N-terminal amino acid sequence, J. Mol. Biol. 300 (2000) 1005 – 1016. [22] E. Glaser, S. Sjo¨ling, M. Tanudji, J. Whelan, Mitochondrial protein import in plants, Plant Mol. Biol. 38 (1998) 311 – 338. [23] S. Pares, C. Cohen-Addad, L. Sieker, M. Neuburger, R. Douce, X-ray ˚ -resolution of a lipoate-containing structure determination at 2.6 A protein: The H-protein of the glycine decarboxylase complex from pea leaves, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 4850 – 4853. [24] C. Cohen-Addad, M. Faure, M. Neuburger, R. Ober, L. Sieker, J. Bourguignon, D. Macherel, R. Douce, Structural studies of the glycine decarboxylase complex from pea leaf mitochondria, Biochimie 79 (1997) 637 – 644. [25] V. Gueguen, D. Macherel, M. Neuburger, C. Saint Pierre, M. Jaquinod, P. Gans, R. Douce, J. Bourguignon, Structural and functional characterization of H protein mutants of the glycine decarboxylase complex, J. Biol. Chem. 274 (1999) 26344 – 26352. [26] P. Vauclare, N. Diallo, J. Bourguignon, D. Macherel, R. Douce, Regulation of the expression of the glycine decarboxylase complex during pea leaf development, Plant Physiol. 112 (1996) 1523 – 1530. [27] R.C. Bugos, V.L. Chiang, W.H. Campbell, cDNA cloning, sequencing analysis and seasonal expression of lignin-bispecific caffeic acid/5hydroxyferulic acid O-methyltransferase of aspen, Plant Mol. Biol. 17 (1991) 1203 – 1215. [28] H. Meng, W.H. Campbell, Substrate profiles and expression of caffeoyl coenzyme A and caffeic acid O-methyltransferases in xylem of aspen during seasonal development, Plant Mol. Biol. 38 (1998) 513 – 520. [29] E. Sterky, S. Regan, J. Karlsson, M. Hertzberg, A. Rohde, A. Holmberg, B. Amini, R. Bhalerao, M. Larsson, R. Villarroel, M. Van Montagu, G. Sandberg, O. Olsson, T.T. Teeri, W. Boerjan, P. Gustafsson, M. Uhle´n, B. Sundberg, L. Lundeberg, Gene discovery in the woodforming tissues of poplar: analysis of 5, 692 expressed sequence tags, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 13330 – 13335. [30] S.D. Wullschleger, S. Jansson, G. Taylor, Genomics and forest biology – Populus emerges as the perennial favorite, Plant Cell 14 (2002) 2651 – 2655. [31] X. Huang, A. Madan, CAP3: a DNA sequence assembly program, Genome Res. 9 (1999) 868 – 877. [32] S. Kopriva, R. Cossu, H. Bauwe, Alternative splicing results in two different transcripts for H-protein of the glycine cleavage system in the C4 species Flaveria trinervia, Plant J. 8 (1995) 435 – 441. [33] S.A. Harding, J. Leshkevich, V.L. Chiang, C.-J. Tsai, Differential substrate inhibition couples kinetically distinct 4-coumarate: coenzyme a ligases with spatially distinct metabolic roles in quaking aspen, Plant Physiol. 128 (2002) 428 – 438. [34] Y.-Y. Kao, S.A. Harding, C.-J. Tsai, Differential expression of two distinct phenylalanine ammonia-lyase genes in condensed tannin-accumulating and lignifying cells of quaking aspen, Plant Physiol. 130 (2002) 796 – 807. [35] A.D. Hanson, S. Roje, One-carbon metabolism in higher plants, Annu. Rev. Plant Physiol. Plant Mol. Biol. 52 (2001) 119 – 137. [36] I. Allona, M. Quinn, E. Shoop, K. Swope, J. Carlis, J. Riedl, E. Retzel, M.M. Campbell, R. Sederoff, R.W. Whetten, Analysis of xylem formation in pine by cDNA sequencing, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 9693 – 9698. [37] R. Whetten, Y.-H. Sun, Y. Zhang, R. Sederoff, Functional genomics and cell wall biosynthesis in loblolly pine, Plant. Mol. Biol. 47 (2001) 275 – 291. [38] K. Vander Mijnsbrugge, H. Meyermans, M. Van Montagu, G. Bauw, W. Boerjan, Wood formation in poplar: identification, characterization, and seasonal variation of xylem proteins, Planta 210 (2000) 589 – 598.
272
Y.-S. Wang et al. / Biochimica et Biophysica Acta 1676 (2004) 266–272
[39] C.-L. Ho, M. Noji, M. Saito, K. Saito, Regulation of serine biosynthesis in Arabidopsis, J. Biol. Chem. 274 (1999) 397 – 402. [40] C.R. McClung, M. Hsu, J.E. Painter, J.M. Gagne, S.D. Karlsberg, P.A. Salome, Integrated temporal regulation of the photorespiratory pathway. Circadian regulation of two Arabidopsis genes encoding serine hydroxymethyltransferase, Plant Physiol. 123 (2000) 381 – 391. [41] C.R. Somerville, W.L. Orgen, Mutants of the cruciferous plant Arabidopsis thaliana lacking glycine decarboxylase activity, Biochem. J. 202 (1982) 373 – 380. [42] D. Blackwell, A.J.S. Murray, P.J. Lea, Photorespiratory mutants of the mitochondrial conversion of glycine to serine, Plant Physiol. 94 (1990) 1316 – 1322.
[43] N.N. Artus, S. Naito, C.R. Somerville, A mutant of Arabidopsis thaliana that defines a new locus for glycine decarboxylation, Plant Cell Physiol. 35 (1994) 879 – 885. [44] Arabidopsis Genome Initiative, Analysis of the genome sequence of the flowering plant Arabidopsis thaliana, Nature 408 (2000) 796 – 815. [45] I. Lutziger, D.J. Oliver, Characterization of two cDNAs encoding mitochondrial lipoamide dehydrogenase from Arabidopsis, Plant Physiol. 127 (2001) 615 – 623.
Short sequence-paper
Expression of a glycine decarboxylase complex H-protein in non-photosynthetic tissues of Populus tremuloides Yuh-Shuh Wang 1, Scott A. Harding, Chung-Jui Tsai * Plant Biotechnology Research Center, School of Forest Resources and Environmental Science, Michigan Technological University, Houghton, MI 49931, USA Received 25 September 2003; received in revised form 12 December 2003; accepted 22 December 2003
Abstract The Gly decarboxylase complex (GDC) is abundant in mitochondria of C3 leaves and functions in photorespiratory carbon recovery. However, expression of GDC component proteins has generally been less evident in non-green tissues. Here we report an aspen (Populus tremuloides Michx.) PtgdcH1 gene, encoding a GDC subunit H-protein that is phylogenetically distinct from previously characterized photorespiratory H-proteins. Strong expression of PtgdcH1 in root tips and developing xylem suggests that GDC supports a very active C1 metabolism in non-photosynthetic tissues of aspen. D 2004 Elsevier B.V. All rights reserved. Keywords: Glycine decarboxylase complex; H-protein; One-carbon metabolism; Populus
The mitochondrial Gly decarboxylase complex (GDC) supports the Gly-Ser interconversion of photorespiration in plants, and is considered to represent an important route for the generation of one-carbon (C1) units for biosynthetic reactions in all organisms [1,2]. In photosynthetic leaves of pea, GDC is abundant and cooperates with Ser hydroxymethyltransferase (SHMT, also known as Gly hydroxymethyltransferase) to salvage high fluxes of photorespiratory Gly for synthesis of C3 units that can reenter the Calvin cycle [3 –5]. In non-photosynthetic tissues such as pea roots, GDC is detected at comparatively low levels [6 – 8], but SHMT is readily detected [9,10]. This led to the notion that SHMT can act without GDC for the catabolism of Ser into Gly and C1 units in non-photosynthetic tissues [11]. However, inhibition of GDC by victorin caused cell death in both photosynthetic and non-photosynthetic tissues, indicating that GDC may be required for non-photorespiratory biochemical functions in non-green tissues [12]. Later, GDC was shown to be tightly coupled to SHMT for glycine-serine
* Corresponding author. Tel.: +1-906-487-2914; fax: +1-906-4872915. E-mail address: [email protected] (C.-J. Tsai). 1 Current address: Plant Biology Division, Samuel Roberts Nobel Foundation, Ardmore, OK 73401, USA. 0167-4781/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.bbaexp.2003.12.004
catabolism associated with C1 pathways in non-photosynthetic sycamore cell cultures by 13C-NMR [13]. More recently, 13C-NMR confirmed that GDC/SHMT mediated the generation of most C1 units in non-photosynthetic Arabidopsis roots, accounting for nine-fold higher serine conversion than the alternative, GDC-independent C1-tetrahydrofolate synthase/SHMT pathway [14]. The involvement of GDC in C1 metabolism of nonphotosynthetic tissues, however, has not been supported at the transcript level. GDC is composed of four proteins, designated P, H, T and L, encoded by nuclear genes with N-terminal mitochondrial targeting presequences [5]. Genes encoding GDC component proteins have been isolated from green tissues of pea, Arabidopsis and Flaveria (reviewed in Ref. [15]). Expression of these genes is regulated in a light-dependent manner and, with the exception of the L-protein, which also functions in other multienzyme complexes [10], is strongest in green leaves but weak to undetectable in non-photosynthetic tissues [6 – 8,16,17]. Molecular evidence to support a role for GDC in non-green tissues thus remains scarce. Here we report the cloning of an aspen (P. tremuloides Michx.) PtgdcH1 cDNA that exhibits the conserved motif signatures of GDC H-subunit sequences and is abundantly expressed in nonphotosynthetic tissues of aspen where C1 metabolic demand is high.
Y.-S. Wang et al. / Biochimica et Biophysica Acta 1676 (2004) 266–272
A partial PtgdcH1 cDNA fragment was originally isolated as a xylem up-regulated (relative to phloem) clone by differential display. Xylem cDNA library screening yielded a full-length PtgdcH1 cDNA (GenBank accession no. AY229875) that is 783-bp long with a short open reading frame (ORF) of 468 bp. Southern blot analysis of four aspen genomic DNA digests with 3V-UTR or full-length PtgdcH1 cDNA probes suggested that PtgdcH1 belongs to a small gene family, most likely consisting of two members (data no shown). The predicted protein sequence of PtgdcH1 shares 65 –85% similarity with GDC H-subunit proteins found in bacteria, yeasts, animals and plants. It is most similar (85%) to an Arabidopsis H-protein At2g35120 that has not been characterized, but it exhibits only 72– 73% sequence homology to the previously reported photorespiratory H-proteins of pea [6] and Arabidopsis At2g35370 [18,19]. The protein sequence alignment of PtgdcH1 with several other plant H-proteins, including all three gdcH members of the Arabidopsis genome and representative Flaveria H-proteins [20], is shown in Fig. 1. Analysis of the translated PtgdcH1 protein sequence using the TargetP server v1.01 [21] predicted a 24-aa mitochondrial targeting sequence at the Nterminus, with a characteristic R-3 proteolytic cleavage motif R-X-X-A/S-T/S [22], as shown in Fig. 1. The predicted mature PtgdcH1 protein of 131 aa with a calculated Mr of 14.2 kDa matches the mature H-protein of pea [6], but the mitochondrial targeting sequence of PtgdcH1 is 10 aa shorter than that of the pea H-protein (Fig. 1). The uncharacterized At2g35120, likely orthologous to PtgdcH1, is also predicted to possess a short mitochondrial targeting sequence (Fig. 1). The lipoate-binding Lys residue (K-63) required for GDC-related H-protein function [6,23] is conserved in PtgdcH1 (Fig. 1, highlighted in black). In addition, several amino acid residues of pea H-protein (S-12, E-14, V62, A-64 and D/E-67), determined on the basis of X-ray crystal structure to interact with the methylamine group
267
during P-protein-catalyzed methylamination [24,25], are also conserved (Fig. 1, shaded in gray). The sequence analysis data confirm that the predicted PtgdcH1 protein possesses the sequence elements known to be essential for GDC H-protein function. Expression of PtgdcH1 in various aspen tissues was analyzed by Northern blot analysis using full-length PtgdcH1 cDNA as a probe. PtgdcH1 transcripts were most abundant in root tips and developing xylem of aspen (Fig. 2A). Unlike other previously characterized gdcH genes from pea and Arabidopsis (At2g35370) that were highly expressed in green tissues [6,19,26], PtgdcH1 transcript levels in apices, leaves and young stems were surprisingly low (Fig. 2A), and could only be detected after prolonged exposure. To confirm successful RNA transfer in all lanes, the blot was stripped and re-probed with a full-length cDNA encoding a cytosolic isoform of cyclophilin, designated PtCyP (AY229877). PtCyP was originally isolated from the same differential display experiment as PtgdcH1 (Y.-S. Wang and C.-J. Tsai, unpublished), and exhibited a more ubiquitous, although variable, expression pattern than PtgdcH1 on Northern blots (Fig. 2A). Seasonal expression patterns of PtgdcH1 were analyzed in developing xylem and phloem tissues harvested from field-grown aspen trees at monthly, biweekly and weekly intervals during the growing seasons of 1998, 1999 and 2000, respectively (Fig. 2B and data not shown). As exemplified by the 2000 growing season data, PtgdcH1 was highly expressed in xylem from mid-June to mid-August in 2000, but was barely detectable in phloem throughout the investigation period (Fig. 2B). In contrast, PtCyP was more abundantly expressed in phloem than xylem from late May to mid-August (Fig. 2B). Overall, it appears that the low transcript abundance of PtgdcH1 in green tissues is inadequate to support photorespiration based on reports of high gdcH gene expression in photosynthetic tissues of pea and Arabidopsis [5]. Instead, the high expression level of
Fig. 1. Sequence alignment of predicted H-proteins from aspen and other plant species. The predicted mitochondrial targeting sequences are boxed, and the Arg residue at 3 of the conserved proteolytic cleavage motif R-X-X-A/S-T/S is shown in bold face. The lipoate-binding Lys residue is highlighted in black, amino acid residues involved in methylamine-binding are shaded in gray. Amino acid numbers are based on predicted mature proteins. GenBank accession numbers are: pea, CAA45978; F. primglei, CAB16914; F. anomala, CAB16710; and F. trinervia, CAA85760.
268
Y.-S. Wang et al. / Biochimica et Biophysica Acta 1676 (2004) 266–272
Fig. 2. Northern hybridization and RT-PCR analyses. (A) Total RNA (10 Ag per lane) was resolved by denaturing agarose gel electrophoresis, blotted onto a nylon membrane, and hybridized consecutively with 32P-labeled fulllength PtgdcH1 and PtCyP cDNA probes at high stringency. Photographs of ethidium bromide-stained rRNAs were used to confirm similar RNA loading. (B) Seasonal regulation of PtgdcH1 in vascular tissues of fieldgrown trees during the 2000 growing season. (C) RT-PCR analysis of PtgdcH1 and PtgdcH3 in aspen tissues using total RNA from apices, young leaves, developing xylem and root tips, and gene-specific, ORF-flanking primers (ATGGCTTCAAGATTGTTGTGGGCTTCAAGG and TCA ATGCTTTGCATCTTCTTCTTCACAGAACTTAGC for PtgdcH1; ATG G C A C T G A G G T T G T G G G C T T C T T C A A C G a n d CTAAT G A GATTCTTCTTCCTCGCAGAATTTTGTG for PtgdcH3). RT-PCR amplification of PtCyP cDNA was also included as a control using ATG GCAAACCCTAAAGTCTACTTCGATATG and TCA AGAAAGCTGACCACAATCAGCAACAACAAC primers.
PtgdcH1 in root tips and developing xylem of aspen, particularly during the period of most active wood formation as manifested by active lignin gene expression [27,28] in fieldgrown trees, suggests a close association of PtgdcH1 with phenolic metabolism and lignification in these tissues.
To investigate the spatial association of PtgdcH1 with lignification during aspen stem development, in situ hybridization experiments were conducted. Semi-thin (8 Am) paraffin stem sections of greenhouse-grown aspen were hybridized with DIG-labeled, full-length antisense PtgdcH1 RNA probes. During primary growth, PtgdcH1 transcripts were localized to protoxylem elements, as shown for the first internode in Fig. 3A. At internode 6 where secondary growth had begun, PtgdcH1 transcripts were detected in newly developed xylem fibers, ray parenchyma, phloem fibers, as well as in the perimedullary zone (Fig. 3B). At internode 15, PtgdcH1 was abundantly expressed in developing fibers and ray parenchyma of xylem (Fig. 3C). PtgdcH1 transcripts were also detected in primary and secondary phloem fibers of internode 15, but were less abundant than in xylem cells. Hybridization with sense PtgdcH1 riboprobes yielded no signal (data not shown). In situ hybridization results thus provide evidence that PtgdcH1 expression is localized to lignifying rather than photosynthetic tissues in aspen stem. Preliminary phylogenetic analysis indicated that aspen gdcH1 is evolutionarily distinct from previously reported Hproteins of photosynthetic tissues. We therefore performed a search of the public Populus EST database for additional Populus gdcH gene members, including those that encode the photorespiratory isoforms. GenBank currently houses in excess of 120,000 Populus ESTs, including more than 11,000 from our laboratory, from a wide range of tissues types [29,30]. BLAST search of GenBank ESTs using the PtgdcH1 cDNA sequence identified more than 30 Populus ESTs that are nearly identical to PtgdcH1, but failed to identify additional H-proteins. A modified in silico approach was then employed based on the highly conserved Nterminal mitochondrial targeting sequences of photorespiratory H-proteins (Fig. 1). A 30-bp cDNA sequence downstream from ATG of Arabidopsis At2g35370 was successfully used to identify two poplar ESTs (BU883461 and BU869151) from the GenBank EST database, which led to 13 additional Populus ESTs when they were used as bait. Sequence assembly of the 15 ESTs by the CAP3 program [31] resulted in two contigs with complete ORFs, and one singleton containing a partial ORF. The predicted proteins of the two contigs were highly similar to each other (99%), and to the photorespiratory H-proteins of pea and Arabidopsis (>90%), but exhibited a lower degree of similarity (74%) to PtgdcH1. A sense primer, corresponding to the region immediately downstream of ATG that is identical between the two contigs, was used in conjunction with an oligo-dT primer for RT-PCR cloning of the aspen ortholog from young leaf RNA. A 700-bp clone, designated PtgdcH3, was amplified, cloned and sequenced (AY369261). Like other photorespiration-associated H-proteins, PtgdcH3 also contains a longer N-terminal mitochondrial targeting sequence that is highly conserved (Fig. 1). The results indicated that PtgdcH3 is a likely ortholog of the photorespirationassociated pea H-protein and Arabidopsis At2g35370.
Y.-S. Wang et al. / Biochimica et Biophysica Acta 1676 (2004) 266–272
269
Fig. 3. In situ localization of PtgdcH1 transcripts in aspen stem tissues. Transverse stem sections (8 Am thickness) were hybridized with digoxygenin-labeled antisense PtgdcH1 RNA probes and photographed in bright field. Shown are transverse section of 1st internode (A), 6th internode (B), and 15th internode (C). Scale bar: 200 Am for A and C and 100 Am for B. co, cortex; cz, cambial zone; ppf, primary phloem fiber; spf secondary phloem fiber; xyl xylem.
Tissue-specific expression of PtgdcH3 and PtgdcH1 in aspen was compared by RT-PCR analysis of cDNAs derived from apices, young leaves, root tips and developing xylem using gene-specific primers flanking their respective ORFs. As seen in Fig. 2C, PtgdcH3 transcripts were amplified from apex and young leaf cDNAs, but not from root tip and xylem cDNAs. In contrast, PtgdcH1 transcripts were amplified from xylem and root tips, but the yield from green tissues was much lower (Fig. 2C), as expected based on the Northern hybridization (Fig. 2A). Expression levels of PtgdcH1 and PtgdcH3 are similar in their respective tissues, suggesting high levels of GDC activity to support distinct metabolic needs of these tissues. A phylogenetic tree was constructed to determine the relatedness of the two aspen H-proteins to other known Hproteins. Nineteen representative full-length gdcH mature protein sequences from bacteria, fungi, animal and plants, including all known members from the Arabidopsis and rice genomes, were analyzed. PtgdcH1 clustered with Arabidopsis At2g35120 as expected, and with two members of the rice H-protein family. Together these sequences formed a branch that is phylogenetically more closely related to the bacterial H-protein than to the photorespiration-associated H-proteins from pea, Arabidopsis (At2g35370) and Flaveria (Fig. 4). In contrast, PtgdcH3 clustered with all previously characterized photorespiratory H-proteins. At least 15 Hproteins have been reported from various C3, C4 or C3-C4 intermediate species of the genus Flaveria [20,32], and these sequences clustered nearer pea gdcH and Arabidopsis At2g35370 (data not shown), as exemplified by the three representative Flaveria H-proteins shown in Fig. 4. The phylogenetic data support our argument for the presence of a previously undescribed and phylogenetically distinct Hprotein in non-photosynthetic tissues of aspen and other higher plants. Sequence homology, expression pattern and phylogenetic analyses thus provide evidence that PtgdcH1 and PtgdcH3 encode structurally and perhaps functionally distinct Hprotein isoforms. The high level of PtgdcH1 transcripts in aspen root tips and developing xylem is consistent with the high demand for C1 units in phenolic-rich tissues. Aspen
root tips accumulate an abundance of condensed tannins, indicative of a high level of phenolic metabolism supported by strong 4-coumarate:CoA ligase and phenylalanine ammonia-lyase expression not observed in other meristematic tissues such as shoot apices [33,34]. Lignification in woody stems is perhaps the most C1-demanding metabolic activity in higher plants, requiring over 2000 Amol C1 units per gram of dry weight as calculated by Hanson and Roje [35] for birch wood. Consistent with the association of PtgdcH1 with GDC in lignifying tissues, Populus ESTs encoding the P-, T- and L-proteins from wood-forming (cambial, xylem or wood) tissues have also been identified in the GenBank EST database (data not shown). Moreover, gdcH and SHMT comprise large xylem EST clusters in wood forming tissues of loblolly pine [36,37]. SHMT was also identified as one of the most abundant xylem proteins in poplar by comparative 2-D polyacrylamide gel electrophoresis coupled with peptide micro-sequencing [38]. According to Vander Mijnsbrugge et al. [38], the most abundant SHMT species in both cases exhibited much higher sequence homology to a group of Arabidopsis SHMT-like proteins than to the pea [10] or Arabidopsis At5g26780 [39] and At4g37390 [40] photorespiratory SHMTs. Thus, it appears that the plant SHMT gene family also contains divergent, tissue-adapted members that may cooperate with specific GDC isoforms. Our findings of two tissue-specific and structurally distinct H-proteins (hence distinct GDCs) in higher plants can account for why mutant Arabidopsis and barley lacking photorespiratory GDC survive only under non-photorespiratory conditions [41 – 43]. Evidently, the C1 pathway-associated H-protein isoform of GDC was not affected and would sustain GDC-SHMT activity to support mutant growth under elevated CO2 concentrations. The low abundance of PtgdcH1 in green tissues (Fig. 2) along with its segregation into lignifying or otherwise C1-active cells (Fig. 3) may also reflect a compartmentalization of its associated GDC away from photosynthetic cells and photorespiration, and a concomitant failure to support photorespiration in such mutants. The Arabidopsis genome contains two gdcP, three gdcH, one gdcT and two ldh (lipoamide dehydrogenase,
270
Y.-S. Wang et al. / Biochimica et Biophysica Acta 1676 (2004) 266–272
Fig. 4. Phylogenetic analysis of representative H-proteins across kingdoms. The dendrogram was created using the Clustalw (www.ebi.ac.uk/clustalw) and the Treeview programs (http://taxonomy.zoology.gla.ac.uk/rod/treeview). Bootstrap values were determined using the GeneBee’s TreeTop program (http:// www.genebee.msu.su/genebee.html) with 100 replicates. Sequences are the same as Fig. 1, with the following additions: mouse, BAB31951; human, P23434; chicken, P11183; fruit fly, Q9U616; yeast, CAC19751; bacteria, BAB41997; common iceplant, P93255; rice, 903.t00001, 1956.t00012 and 3710.t00012 (The Institute of Genome Research, http://www.tigr.org/).
L-protein) genes [44,45]. The gdcP and ldh families each contain two gene members encoding highly similar P- and L-proteins (94% and 96% similarity, respectively). In contrast, the gdcH family is more variant, containing two highly (95%) similar gene members and a more divergent (75% similar) isoform At2g35120 that is orthologous to PtgdcH1. This raises the possibility that the differentially expressed H-proteins may possess structural differences that somehow modulate GDC activities differently in photorespiratory versus non-photorespiratory tissues. As described earlier, the sequence differences between PtgdcH1 and PtgdcH3 do not involve amino acid residues thought to be key for interaction with other GDC component proteins [15], pointing to functional conservation. However, their overall low degree of sequence similarity does not exclude the possibility that the two aspen H-proteins may exhibit differential flexibility in their interactions with other GDC component proteins. Interestingly, in this regard, the two Arabidopsis mitochondrial L-proteins (ldh1 and ldh2) also exhibit differential, though overlapping, expression patterns in photosynthetic and non-photosynthetic tissues, and this has been taken to suggest their differential association with GDC and a-ketoacid dehydrogenase complexes, respectively [45]. Genetic study, however, revealed that
ldh2 also functions in GDC, suggesting functional flexibility [45]. The potential for functionally distinct associations of these two L-proteins in photorespiring and C1demanding tissues, however, has not been explored. The soon-to-be-completed Populus genome sequencing project by the United States Department of Energy [30] will enable rapid identification of all gene members of the GDC component proteins in Populus, and will facilitate investigation into whether non-photosynthetic tissues of tree species contain distinct isoforms of other GDC component proteins, along with PtgdcH1, to support C1 metabolism. In sum, the present study provides new insights into an old pathway, and should trigger additional efforts to further our understanding of C1 metabolism in non-photosynthetic tissues. The plant C1 metabolism provides numerous opportunities for metabolic engineering, and results derived from this and future research should be of value in this endeavor.
Acknowledgements We thank Professor Vincent Chiang (North Carolina State University) for providing the aspen xylem cDNA library. This work was supported by a USDA-NRI grant (no.
Y.-S. Wang et al. / Biochimica et Biophysica Acta 1676 (2004) 266–272
98-35106-6630) to CJT and by a graduate student fellowship from the Michigan Technological University Graduate School.
References [1] G. Kikuchi, The glycine cleavage system: composition, reaction mechanism and physiological significance, Mol. Cell. Biochem. 1 (1973) 169 – 187. [2] E.A. Cossins, One-carbon metabolism, in: D.D. Davies (Ed.), The Biochemistry of Plants, vol. 2, Academic Press, New York, 1980, pp. 365 – 418. [3] D.J. Oliver, M. Neuburger, J. Bourguignon, R. Douce, Interaction between the component enzymes of the glycine decarboxylase multienzyme complex, Plant Physiol. 94 (1990) 833 – 839. [4] A.J. Keys, Synthesis and interconversion of glycine and serine, in: P.K. Stumpf, E.E. Conn (Eds.), The Biochemistry of Plants, vol. 5, Academic Press, New York, 1980, pp. 359 – 374. [5] D.J. Oliver, The glycine decarboxylase complex from plant mitochondria, Annu. Rev. Plant Physiol. Plant Mol. Biol. 45 (1994) 323 – 338. [6] D. Macherel, M. Lebrun, J. Gagnon, M. Neuburger, R. Douce, cNDA cloning, primary structure and gene expression for H-protein, a component of the glycine-cleavage system (glycine decarboxylase) of pea (Pisum sativum) leaf mitochondria, Biochem. J. 268 (1990) 783 – 789. [7] S.R. Turner, R. Ireland, S. Rawsthorne, Cloning and characterization of the P subunit of glycine decarboxylase from pea (Pisum sativum), J. Biol. Chem. 267 (1992) 5355 – 5360. [8] J. Bourguignon, P. Vauclare, V. Merand, E. Forest, M. Neuburger, R. Douce, Glycine decarboxylase complex from higher plants-Molecular cloning, tissue distribution and mass spectrometry analyses of the T protein, Eur. J. Biochem. 217 (1993) 377 – 386. [9] N.J. Walton, H.W. Woolhouse, Enzymes of serine and glycine metabolism in leaves and non-photosynthetic tissues of Pisum sativum L, Planta 167 (1986) 119 – 128. [10] S.R. Turner, R. Ireland, C. Morgan, S. Rawsthorne, Identification and localization of multiple forms of serine hydroxymethyltransferase in pea (Pisum sativum) and characterization of a cDNA encoding a mitochondrial isoform, J. Biol. Chem. 267 (1992) 13528 – 13534. [11] R.J. Ireland, D. Hiltz, Glycine and serine synthesis in non-photosynthetic tissues, Semin. Ser. 56 (1995) 111 – 118. [12] D.A. Navarre, T.J. Wolpert, Inhibition of the glycine decarboxylase multienzyme complex by the host-selective toxin victorin, Plant Cell 7 (1995) 462 – 463. [13] J.-M. Mouillon, S. Aubert, J. Bourguignon, E. Gout, R. Douce, F. Re´beille´, Glycine and serine catabolism in non-photosynthetic higher plant cells: their role in C1 metabolism, Plant J. 20 (1999) 197 – 205. [14] R. Li, M. Moore, J. King, Investigating the regulation of one-carbon metabolism in Arabidopsis thaliana, Plant Cell Physiol. 44 (2003) 233 – 241. [15] R. Douce, J. Bourguignon, M. Neuburger, F. Re´beille´, The glycine decarboxylase system: a fascinating complex, Trends Plant Sci. 6 (2001) 167 – 176. [16] Y. Kim, D. Oliver, Molecular cloning, transcriptional characterization and sequencing of the cDNA encoding the H-protein of the glycine decarboxylase complex in peas, J. Biol. Chem. 265 (1990) 848 – 853. [17] Y. Kim, K. Shah, D.J. Oliver, Cloning and light-dependent expression of the gene coding for the P-protein of the glycine decarboxylase complex from peas, Physiol. Plant. 81 (1991) 501 – 506. [18] R. Srinivasan, D.J. Oliver, H-Protein of the glycine decarboxylase multienzyme complex. Complementary DNA encoding the protein from Arabidopsis thaliana, Plant Physiol. 98 (1992) 1518 – 1519. [19] R. Srinivasan, D.J. Oliver, Light-dependent and tissue-specific expression of the H-protein of the glycine decarboxylase complex, Plant Physiol. 109 (1995) 161 – 168.
271
[20] S. Kopriva, C.-C. Chu, H. Bauwe, H-protein of the glycine cleavage system in Flaveria: alternative splicing of the pre-mRNA occurs exclusively in advanced C4 species of the genus, Plant J. 10 (1996) 369 – 373. [21] O. Emanuelsson, H. Nielsen, S. Brunak, G. von Heijne, Predicting subcellular localization of proteins based on their N-terminal amino acid sequence, J. Mol. Biol. 300 (2000) 1005 – 1016. [22] E. Glaser, S. Sjo¨ling, M. Tanudji, J. Whelan, Mitochondrial protein import in plants, Plant Mol. Biol. 38 (1998) 311 – 338. [23] S. Pares, C. Cohen-Addad, L. Sieker, M. Neuburger, R. Douce, X-ray ˚ -resolution of a lipoate-containing structure determination at 2.6 A protein: The H-protein of the glycine decarboxylase complex from pea leaves, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 4850 – 4853. [24] C. Cohen-Addad, M. Faure, M. Neuburger, R. Ober, L. Sieker, J. Bourguignon, D. Macherel, R. Douce, Structural studies of the glycine decarboxylase complex from pea leaf mitochondria, Biochimie 79 (1997) 637 – 644. [25] V. Gueguen, D. Macherel, M. Neuburger, C. Saint Pierre, M. Jaquinod, P. Gans, R. Douce, J. Bourguignon, Structural and functional characterization of H protein mutants of the glycine decarboxylase complex, J. Biol. Chem. 274 (1999) 26344 – 26352. [26] P. Vauclare, N. Diallo, J. Bourguignon, D. Macherel, R. Douce, Regulation of the expression of the glycine decarboxylase complex during pea leaf development, Plant Physiol. 112 (1996) 1523 – 1530. [27] R.C. Bugos, V.L. Chiang, W.H. Campbell, cDNA cloning, sequencing analysis and seasonal expression of lignin-bispecific caffeic acid/5hydroxyferulic acid O-methyltransferase of aspen, Plant Mol. Biol. 17 (1991) 1203 – 1215. [28] H. Meng, W.H. Campbell, Substrate profiles and expression of caffeoyl coenzyme A and caffeic acid O-methyltransferases in xylem of aspen during seasonal development, Plant Mol. Biol. 38 (1998) 513 – 520. [29] E. Sterky, S. Regan, J. Karlsson, M. Hertzberg, A. Rohde, A. Holmberg, B. Amini, R. Bhalerao, M. Larsson, R. Villarroel, M. Van Montagu, G. Sandberg, O. Olsson, T.T. Teeri, W. Boerjan, P. Gustafsson, M. Uhle´n, B. Sundberg, L. Lundeberg, Gene discovery in the woodforming tissues of poplar: analysis of 5, 692 expressed sequence tags, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 13330 – 13335. [30] S.D. Wullschleger, S. Jansson, G. Taylor, Genomics and forest biology – Populus emerges as the perennial favorite, Plant Cell 14 (2002) 2651 – 2655. [31] X. Huang, A. Madan, CAP3: a DNA sequence assembly program, Genome Res. 9 (1999) 868 – 877. [32] S. Kopriva, R. Cossu, H. Bauwe, Alternative splicing results in two different transcripts for H-protein of the glycine cleavage system in the C4 species Flaveria trinervia, Plant J. 8 (1995) 435 – 441. [33] S.A. Harding, J. Leshkevich, V.L. Chiang, C.-J. Tsai, Differential substrate inhibition couples kinetically distinct 4-coumarate: coenzyme a ligases with spatially distinct metabolic roles in quaking aspen, Plant Physiol. 128 (2002) 428 – 438. [34] Y.-Y. Kao, S.A. Harding, C.-J. Tsai, Differential expression of two distinct phenylalanine ammonia-lyase genes in condensed tannin-accumulating and lignifying cells of quaking aspen, Plant Physiol. 130 (2002) 796 – 807. [35] A.D. Hanson, S. Roje, One-carbon metabolism in higher plants, Annu. Rev. Plant Physiol. Plant Mol. Biol. 52 (2001) 119 – 137. [36] I. Allona, M. Quinn, E. Shoop, K. Swope, J. Carlis, J. Riedl, E. Retzel, M.M. Campbell, R. Sederoff, R.W. Whetten, Analysis of xylem formation in pine by cDNA sequencing, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 9693 – 9698. [37] R. Whetten, Y.-H. Sun, Y. Zhang, R. Sederoff, Functional genomics and cell wall biosynthesis in loblolly pine, Plant. Mol. Biol. 47 (2001) 275 – 291. [38] K. Vander Mijnsbrugge, H. Meyermans, M. Van Montagu, G. Bauw, W. Boerjan, Wood formation in poplar: identification, characterization, and seasonal variation of xylem proteins, Planta 210 (2000) 589 – 598.
272
Y.-S. Wang et al. / Biochimica et Biophysica Acta 1676 (2004) 266–272
[39] C.-L. Ho, M. Noji, M. Saito, K. Saito, Regulation of serine biosynthesis in Arabidopsis, J. Biol. Chem. 274 (1999) 397 – 402. [40] C.R. McClung, M. Hsu, J.E. Painter, J.M. Gagne, S.D. Karlsberg, P.A. Salome, Integrated temporal regulation of the photorespiratory pathway. Circadian regulation of two Arabidopsis genes encoding serine hydroxymethyltransferase, Plant Physiol. 123 (2000) 381 – 391. [41] C.R. Somerville, W.L. Orgen, Mutants of the cruciferous plant Arabidopsis thaliana lacking glycine decarboxylase activity, Biochem. J. 202 (1982) 373 – 380. [42] D. Blackwell, A.J.S. Murray, P.J. Lea, Photorespiratory mutants of the mitochondrial conversion of glycine to serine, Plant Physiol. 94 (1990) 1316 – 1322.
[43] N.N. Artus, S. Naito, C.R. Somerville, A mutant of Arabidopsis thaliana that defines a new locus for glycine decarboxylation, Plant Cell Physiol. 35 (1994) 879 – 885. [44] Arabidopsis Genome Initiative, Analysis of the genome sequence of the flowering plant Arabidopsis thaliana, Nature 408 (2000) 796 – 815. [45] I. Lutziger, D.J. Oliver, Characterization of two cDNAs encoding mitochondrial lipoamide dehydrogenase from Arabidopsis, Plant Physiol. 127 (2001) 615 – 623.