Expression of a group II phospholipase A2 from the venom of Agkistrodon piscivorus piscivorus in Escherichia coli: Recovery and renaturation from bacterial inclusion bodies

PROTEIN

EXPRESSION

3,512~517

AND PURIFICATION

(1992)

Expression of a Group II Phospholipase A, from the Venom of Agkistrodon piscivorus piscivorus in Escherichia co/i: Recovery and Renaturation from Bacterial Inclusion Bodies’ Brian

K. Lathrop,*

W. Richard

Burack,*

Rodney

L. Biltonen,*

and Gordon

S. Rulets2

Departments of *Pharmacology and fBiochemistry, University of Virginia Health Sciences Center, Charlottesville, Virginia 22908

Received

June

25, 1992,

and

in revised

form

August

18, 1992

A synthetic gene encoding the Group II phospholipase Az (PLAz) from the venom of Agkistrodon piscivorus piscivorus has been constructed and expressed with high efficiency in Eecherichia coli. No enzymatic activity was recovered when the polypeptide contained the initiator Met residue. Replacement of an Asn residue penultimate to the initiator Met with Ser or Gly permitted removal of the initiator Met by the endogenous methionine aminopeptidase. The amino-terminal serine (N-Ser) and amino-terminal glycine PLAz’s were isolated from intracellular inclusion bodies and were renatured with 25% recovery. Automated Edman degradation confirmed the removal of the initiator Met and confirmed the sequence of the first 40 residues of N-Ser PLA,. The recombinant proteins were purified to apparent homogeneity and showed the same specific activity as the wild-type protein. N-Ser PLA, demonstrated the same kinetics of activation as the wild type enzyme on large VeSiCleS Of ZWitteriOniC lipid. 0 1992 Academic Press,

Inc.

Phospholipase A, (PLA2,3 E.C. 3.1.1.4) catalyzes the hydrolysis of phospholipids at the sn-2 acyl ester bond.

’ This work was supported by grants from the National Sciences Foundation (NSF DMB 90053374) and the National Institutes of Health (2ROl GM37658). ’ To whom correspondence should be addressed. ’ Abbreviations used: PLA,, phospholipase A,; AppD49, phospholipase A, from the venom of Agkistrodon pisciuorus pisciuorus; N-Ser PLA,, recombinant enzyme with an amino-terminal Ser; N-Gly PL4, recombinant enzyme with an amino-terminal Gly; IPTG, isopropyl-b-D-thiogalactopyranoside; DiC,PC, dicaprylphosphatidylcholine; DPPC, dipalmitoylphosphatidylcholine; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; NTSB, 2nitro-5-(sulfothio)benzoate. 512

PLA,-catalyzed hydrolysis of micelle and vesicle substrates has been studied extensively as a model for enzymatic reactions occurring on a lipid-water interface. PLA, shows a catalytic rate toward aggregated lipid structures much higher than that observed for monodisperse substrates (reviewed in 1,2). On monolayer and vesicle substrates of zwitterionic lipids, the rate of hydrolysis is initially low but is followed by a sudden increase, reflecting an activation process occurring on the vesicle surface. The rate of activation depends on the structure of the lipid and is apparently dependent on the state of enzyme aggregation (3-10). PLA,‘s from pancreas, synovial fluid, placenta, and the venom of Naja naja naja have been expressed in a variety of systems (11-20). Mutational analysis of heterologously expressed PLAz has yielded important information regarding active site structure and the interaction of the enzyme with aggregated lipid (21-26). This report details the expression of a PLA, of the Group II family of homologous PLA,‘s (27) from the venom of Agkistrodon piscivorus piscivorus, AppD49. This enzyme was chosen for the study of PLA2 activation on vesicles because the rapid change in catalytic rate upon activation is temporally correlated with a readily observable change in intrinsic fluorescence of the enzyme (8). Moreover, this enzyme has an intrinsic activity toward vesicular substrates much higher than that of the pancreatic enzyme, and it shows a more distinct lag phase before activation, thus allowing the duration of the lag phase to be used as an indirect measure of the rate of activation (28). We therefore sought to express this enzyme in a bacterial host to facilitate its biophysical characterization. We have constructed a synthetic gene encoding a recombinant AppD49 and have expressed this enzyme in Escherichia coli. The problems inherent in this type of 1046-5928192 $5.00 Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

EXPRESSION

OF

PHOSPHOLIPASE

expression such as low yield of native protein have been largely overcome by efficient expression and renaturation of the peptide from inclusion bodies. Removal of the initiator Met residue is required to obtain an active form of the enzyme. Alteration of the residue penultimate to the initiator Met by cassette mutagenesis of the synthetic gene has been used to effect the removal of the initiator Met by endogenous enzymes. EXPERIMENTAL

PROCEDURES

AND

RESULTS

Reagents. The bacterial strain BLBl(DE3)pLysS and the pETlla expression vector (29) were from Novagene (Madison, WI). Oligonucleotides were obtained from the Protein and Nucleic Acid Sequencing Facility at the University of Virginia. DNA-modifying enzymes were from Boehringer-Mannheim and New England BioLabs. The replicative form of M13mp19 was from Boehringer-Mannheim. Low-gelling-temperature agarose, isopropyl-p-D-thiogalactopyranoside (IPTG), bicinchoninic acid reagent, reduced glutathione, and venom from A. p. piscivorus were from Sigma. Spectrophotometric-grade guanidine - HCl and guanidine * SCN were from Fluka. Sodium sulfite and 5,5’-dithiobis(2-nitrobenzoic acid) were from Aldrich. Oxidized glutathione and dodecyl-/3-D-maltoside were from Calbiochem. AppD49 was purified by the method of Maraganore et al. from the venom of A. p. piscivorus (30). Dicaprylphosphatidylcholine (DiC,PC) and dipalmitoylphosphatidylcholine (DPPC) were from Avanti. Construction of a synthetic gene for A. p. piscivorus PLA,. In designing the synthetic AppD49 gene, the codons used were selected on the basis of abundance in highly expressed E. coli proteins (31). In addition, the 5’ and 3’ nucleotides adjacent to each codon were also selected to reflect the distribution found in highly expressed genes (31). The synthetic gene was assembled in three parts (EcoRI to Sal, Sal to BglII, BglII to HindIII) using synthetic DNA oligonucleotides 30 residues in length. The sequence of each segment was confirmed by dideoxy sequencing with the Taq polymerase according to the manufacturer’s instructions (Promega, Madison, WI) before assembly of the final gene. First, a BamHI site was introduced 3’ to the Hind111 site by ligating the synthetic AppD49 gene into the EcoRI and Hind111 sites of pBR322. This plasmid was then used as the source of the NdeI-BarnHI fragment for insertion into the T7 expression plasmid, pETlla. The nucleotide sequence of the synthetic gene which encodes the sequence of the mature AppD49 is shown in Fig. 1. The initial strategy Expression of mature AppD49. was to produce a fusion protein between the ompA leader sequence (32) and the mature AppD49 gene. This method has been used by Tsai and co-workers to export pancreatic proPLA, and mature PLA, into the periplasmic space of E. coli (19). The gene encoding the ompAAppD49 fusion protein was inserted into the T7 expres-

A,

IN

E. coli

513

sion vector pETlla and transformed into the host strain BL21(DES)pLysS. A 250-ml culture of M9 (33) containing 1% casamino acids and 50 pg/ml ampicillin was inoculated with 1:lOO vol of the overnight culture from a single freshly transformed colony and was grown at 37°C. The culture was induced by the addition of 0.4 mM IPTG when the A,, nm = 1.00. The culture was incubated 4 h at 37°C and cells were harvested at 2OOOg,, X 15 min at 4°C. Induction of the ompA-AppD49 protein with IPTG resulted in poor cell growth, and analysis of the culture supernatant by SDS-PAGE revealed no exported AppD49. It is possible that the ompA-AppD49 fusion protein interferes with normal cell export. Consequently, a strategy for expressing the mature form of AppD49 and recovering the protein from intracellular inclusion bodies was adopted. The AppD49 gene encoding the mature protein was inserted into pETlla and transformed into BLBl(DE3)pLysS. Procedures for growth of cultures and induction were described above. Inclusion body protein was isolated and sulfonated. The same conditions for renaturation which produced active enzyme from denatured venom AppD49 failed to produce active recombinant protein. An analysis of the amino-terminal sequence of the recombinant protein demonstrated that the amino terminal was not blocked but still retained the initiator Met residue. It is possible that the aminoterminal Met residue either inhibits folding of the recombinant enzyme or markedly affects the activity of the folded protein. In E. coli, the initiator Met is removed when the adjacent residue is either Ala, Ser, Gly, Pro, Thr, or Val(34). The second residue in AppD49 is Asn, which prevents removal of the initiator Met (34). To remove this residue, the Asn codon was altered to encode Gly (GGT) or Ser (AGT) by cassette mutagenesis using the EcoRI site at position 1 and an AseI site at position 32. The resultant expression vectors for the N-Gly and N-Ser proteins (pETlla-N-Gly and pETlla-N-Ser) contain the synthetic PLA, gene plus the HindIII-BamHI fragment of pBR322 inserted between the NdeI and BamHI sites of pETlla. Expression, renaturation, and purification of aminoterminal modified recombinant enzymes. Cultures of BLBl(DE3)pLysS containing pETlla-N-Ser or pETlla-N-Gly were grown in 250 ml M9 containing 1% casamino acids and 50 pg/ml ampicillin and induced with IPTG as described. Cells were harvested at 2OOOg,, X 15 min at 4°C and resuspended in 10 ml of ice-cold 50 mM Tris, pH 7.5 (pH determined at room temperature), 20 mM EDTA, and 0.1% Triton X-100. Cells were incubated 10 min on ice to allow lysis. The lysate was immersed in an ice-water bath and pulse sonicated with a sapphire-tipped probe (Branson) for 6 min using an 80% duty cycle. Inclusion bodies were pelleted at 5OOOg,, x 30 min at 4°C. The pellet was drained and resuspended in approximately 1 ml of 4 M guanidine * SCN,

514

LATHROP

ET

21

1

AL.

41

61

81

Eco RI NdeI Asel GAATTCCATATGAGTCTGTTCCAGTTTGAGElAATTAATCGGTACTCCGCG MetSerLeuPheGlnPheGluLysLeuIleLysLysMetThrGlyLysSerGlyMetLeuTrpTyrSerAla 101

121

141

161

SalI TATGGTTGCTACTGTGGTTGGGGTGGCCAAGGTCGACCTACCGACCGCTGCTGCTTCGTACACGACTGCTGC TyrGlyCysTyrCysGlyTrpGlyGlyGlnGlyArgProLysAspAlaThrAspArgCysCysPheValHisAspCysCys 181

221

201

241

TACGGTAAGGTTACCGGCTGTAACCCCG~GATATCTTATTGTGTGTGGTGGT TyrGlyLysValThrGlyCysAsnProLysMetAspIleTyrThrTyrSerValGluAsnGlyAsnIleValCysGlyGly 321 261 281 301 Bgl II ACCAACCCGTGTAAGAAACAGATCTGTGAGTGCGACCGTGCTGCCGCGATTTGCTTCCGCGAC~CCTGCTCACCTACGAT ThrAsnProCysLysLysGlnIleCysGluCysAspArgAlaAlaAlaIleCysPheArgAspAsnLeuLeuThrTyrAsp 341

361

381 Hind III

TCGAAGACCTACTGGAAGTACCCGAAGAACTGTACTAAAGCTT SerLysThrTyrTrpLysTyrProLysAsnCysThrLysGluGluSerGluProCys FIG. 1. Nucleotide sequence of the synthetic AppD49 The sequence of the expressed polypeptide is also shown. facilitate removal of the initiator Met residue. Restriction the AppD49-pETlla construct.

gene: The synthetic gene for N-Ser phospholipase The Asn residue found at position 1 of the venom sites referred to in the text are shown. The NcfeI

0.2 M Tris, pH 8.5,3 mM EDTA. This solution was clarified by centrifugation at 14,000g for 5 min at room temperature; 12 mg of protein was recovered based on a bicinchoninic acid assay (35) on trichloroacetic acidprecipitable material using bovine serum albumin as a standard. SDS-PAGE revealed an intensely staining protein with M, = 14,000 which appeared following induction with IPTG and comigrated with AppD49. Inclusion body protein was sulfonated by a modification of the procedure of Thannhauser et al. (36). A stock solution of disodium 2-nitro-&(sulfothio)benzoate (NTSB) was prepared by bubbling 0, through a solution of 25 mM 5,5’-dithiobis(2-nitrobenzoic acid), 1 M sodium sulfite, pH 8 (36). This NTSB stock solution was diluted into the resuspended inclusion body solution to give a final concentration of 15 mM NTSB and 0.3 M sodium sulfite. The absorbance at 412 nm was measured every 5 min from a 5-~1 aliquot to determine the extent of sulfonation by the appearance of nitrothiobenzoic acid. Sulfonation was complete by 20 min. The reaction was then loaded on a 15-ml column of SBOO-HR Sepharose (Sigma) equilibrated in 2 M guanidine. HCI, 50 mM Tris, pH 7.8, 3 mM EDTA and eluted at 20 ml/h. Protein was pooled as indicated in Fig. 2A. SDS-PAGE indicated that the predominant protein had a M, = 14,000. These pooled fractions contained 6.2 mg of protein based on absorption at 280 nm (Q~ = 31,000 M-’ cm-*). The conditions for renaturation of the sulfonated protein were determined by optimizing activity toward DiCsPC in trial reactions. Activity was measured by di-

A, is shown in the 5’ to 3’ direction. protein has been replaced by Ser to and BumHI sites are unique sites in

luting the reaction mix 1000-fold into 50 mM KCl, 5 mM CaCl,, and 1.2 mM DiC,PC, pH 8, and measuring hydrolysis with an autotitrator in the pH-stat mode (Radiometer). Sulfonated protein was renatured by dilution to 14 pg/ml in a solution of 25 mM Tris, pH 7.8,15 mM CaCl,, 1 mM EDTA, 2.5 mM reduced glutathione, 0.5 mM oxidized glutathione, and 5 mM dodecyl-P-D-maltoside. Renaturation proceeded for 40 h, at which point protein was dialyzed overnight against 2 X 10 vol of 25 mM Tris, pH 7.8, 1 mM NaN,. The solution was clarified by centrifugation at 2OOOg,, X 30 min at 15°C. The supernatant was filtered through a G25 column at 60 ml/h to remove remaining traces of precipitate before it was loaded onto a lo-ml SP-Sepharose (Sigma) column equilibrated against 25 mM Tris, pH 7.8, 1 mM NaN,. No activity was detected in the load eluant. The column was washed with an excess of 25 mM Tris, pH 7.8,l mM NaN,, and protein was eluted with a 50-ml gradient of NaCl from 0 to 0.4 M in a buffer of 25 mM Tris, pH 7.8,l mM NaN, at a flow rate of 20 ml/h. Protein was assayed using the bicinchoninic reaction with AppD49 as a standard. Fractions were pooled on the basis of constant specific activity for the hydrolysis of DiC,PC (Fig. 2B). SDS-PAGE was performed on 2 pg of this protein, and the only protein visible by Coomassie staining had an A& = 14,000 and comigrated with AppD49. The yield of N-Ser PLA, was 1.6 mg, representing a 25% recovery of PLA, from the inclusion bodies. The yield of N-Gly PLA, was 0.6 mg. Characterization of the amino-terminal AppD49 mutants. N-Ser PLA, eluted from SP-Sepharose was fur-

EXPRESSION

OF

PHOSPHOLIPASE

A,

IN

E.

515

coli

.lO s -2 .05

5 Fraction

10 number

15

0

0 0

5

10 15 Fraction

20 number

25

30

FIG. 2. (A) Elution profile of sulfonated inclusion body protein: 1.5 ml of sulfonated inclusion body protein was loaded on a l&ml S-POO-HR Sephacryl column equilibrated in 2 M guanidine * HCl, 50 mM Tris, pH 7.8,3 mM EDTA. One-milliliter fractions were collected at a flow rate of 20 ml/h. Protein was measured by absorbance at 280 nm. Pooled fractions 13-14 are shaded. (B) Purification of renatured PLA, by ion-exchange chromatography: Protein was loaded at 60 ml/h on a g-ml SP-Sepharose column and washed in a buffer of 25 mM Tris, pH 7.8,l mM EDTA, 1 mu NaN,. Elution was at 20 ml/h in the same buffer with a linear gradient of NaCl from 0 to 0.4 M; l&ml fractions were collected, and protein was assayed by the bicinchoninic acid assay as described. Pooled fractions 20-26 are shaded.

ther purified on a reverse-phase C8 column prior to automated Edman degradation. The elution profile from the C8 column revealed that the protein eluted as a single peak. Automated Edman degradation showed that the first 40 residues of purified N-Ser PLA, agreed with the predicted sequence, and that the amino-terminal residue was Ser. Specific activities of N-Ser and N-Gly PLA,‘s were determined for the hydrolysis of DiC,PC using a pHstat. Reactions were catalyzed with 0.33 pg enzyme in 2 ml of 1.2 InM DiC,PC, 50 mM KCl, 5 mM CaCl,, pH 8, at 23’C. The specific activities of N-Ser and N-Gly were identical within experimental error to the specific activity of AppD49 (73 + 14 nmole/min/pg). N-Ser PLA, was further characterized by determining the KM for the hydrolysis of small unilamellar vesicles of DPPC as described previously (37). The KM, 0.04 + 0.01 mM, was found to be identical within experimental error to the value determined for AppD49 (0.06 t- 0.02 mM). AppD49-catalyzed hydrolysis of large multilamellar vesicles of DPPC, as has been shown for large unilamellar DPPC vesicles, proceeds through a lag phase before a sudden increase in the rate of hydrolysis (8). Hydrolysis of multilamellar vesicles was examined in the presence of N-Ser PLA, to ascertain whether a similar activation process occurred with this enzyme as well. As shown in Fig. 3, the hydrolysis time course was similar to those seen previously with AppD49. The apparent binding constant to small unilamellar vesicles of DPPC was determined for N-Ser PLA, and AppD49. Measurement of the lipid concentration dependence of the change in intrinsic tryptophan fluorescence (37) was made on an SLM 8000 fluorometer in a buffer of 10 mM Hepes, pH 8, 50 mM KCl, 500 PM EDTA. The temperature was controlled at 25’C, and the emission and excitation wavelengths were 340 and 280 nm, respectively. The apparent binding constant for

N-Ser PLA, was equal within determined for AppD49,0.06

experimental mM (37).

error to that

DISCUSSION

A synthetic gene encoding PLA, from A. p. piscivorus has been constructed, and this protein has been efficiently expressed in a bacterial host and renatured with high yields. Traditionally, proteins with a large number of disulfides have been expressed with low yield in bacteria (38). One solution to this problem has been to allow export of the expressed protein as a fusion protein into the oxidative environment of the periplasmic space (32); however, this technique was unsuccessful in the case of AppD49. Therefore, unfolded PLA, was isolated from intracellular aggregates and then solubilized and renatured. Attempts to renature the heterologously expressed mature AppD49 under the same conditions as those used to renature venom PLA, were unsuccessful. The expressed protein was found to contain an amino-ter-

;

loo-

E f

50.

-0

5 Time

10 (min)

15

20

FIG. 3. Hydrolysis of DPPC multilamellar vesicles catalyzed by N-Ser PLA,: 0.3 mM DPPC multilamellar vesicles were hydrolyzed in the presence of 35 nM N-Ser PLA, in 2 ml of 50 mM KCl, 5 mM CaCl,, pH 8, at 41°C. Product accumulation is shown by the moles of OHtitrated to maintain the pH at 8.

516

LATHROP

minal Met residue, and the inability to obtain enzymatic activity was attributed to the presence of the initiator Met. Limited proteolysis in vitro has been used to remove the initiator Met from an expressed PLA, (17), but to enhance the yield and simplicity of this procedure, we opted to generate amino-terminal mutants which would allow endogenous enzymes to remove the Met. Substitution of Asn, normally found at the amino terminus of the native protein, with Ser or Gly allowed the bacterial methionine aminopeptidase to remove the amino-terminal methionine (34) to generate a form of the enzyme which could be renatured with full activity. Replacement of the amino-terminal Asn with either Ser or Gly did not affect the activity or substrate binding properties of the enzyme. This observation argues that the technique of amino acid replacement to remove an amino-terminal methionine can be used as a general method of preparing active PLA2’s and presumably other proteins as well. The final yield of N-Ser PLA, was significantly improved over that of similar purification procedures for Group I PLA,‘s, while the yield of N-Gly PLA, was comparable (17,18). Reduction of disulfide bonds formed during the isolation of inclusion bodies was accomplished by sulfonation to improve the solubility of the reduced protein. Removal of bacterial debris from the sulfonated protein prior to renaturation resulted in about a 25% improvement in the final yield. Ca2+ was added to a sixfold molar excess above the KDCa (30) to increase the thermodynamic stability of the native enzyme. Irreversible aggregation of folding intermediates can be a source of loss of yield during renaturation, and a nonionic detergent was therefore added to mitigate this problem (39). The addition of dodecyl-P-D-maltoside resulted in a fourfold increase in recoverable activity as well as in a stabilization of activity over time. Even so, PLA, was kept dilute in the renaturation reaction to prevent precipitation. This report describes the efficient expression of a Group II PLA, in E. coli. The enzymatic properties of the recombinant PLA, are identical to those of the venom PLA,. The activation process on lipid surfaces is preserved in the recombinant protein, as exhibited by the lag phase when hydrolysis of multilamellar vesicles is catalyzed by N-Ser PLA,. Expression of this enzyme in bacteria will facilitate mutagenic analysis and isotopic labeling for such applications as NMR technology. With the availability of recombinant Group I and Group II enzymes, it is now possible to perform biophysical studies on both groups of PLA,‘s to ascertain whether there is a common mechanism of activation for these enzymes on the lipid surface. ACKNOWLEDGMENT We thank the Protein and Nucleic University of Virginia for performing and automated Edman degradation.

Acid Sequencing Facility at the reverse-phase chromatography

ET

AL.

Note added in proof. Following acceptance of this manuscript for publication, we discovered differences between the NMR spectrum of the recombinant enzyme and the enzyme purified from venom. The reasons for these differences are not clear and they are currently under investigation. Nevertheless, the results reported here on the production of a class II PLA, in E. coli with identical enzymatic properties to the venom enzyme are valid.

REFERENCES 1. Verheij, H. M., Slotboom, A. J., and de Haas, G. H. (1981) Structure and function of phospholipase A,. Rev. Physiol. B&hem. Pharmacol. 91,91-203. 2. Dennis, E. A. (1983) Phospholipases, in “The Enzymes” (Boyer, P., Ed.), Vol. XVI, pp. 307-357, Academic Press, New York. 3. Op den Kamp, J. A. F., de Gier, J., and van Deenen, L. L. M. (1974) Hydrolysis of phosphatidylcholine liposomes by pancreatic phospholipase A, at the transition temperature. Biochim. Biophys. Acta 346,253-256. 4. Verger, R., Meiras, M. C. E., and de Haas, G. H. (1973) Action of phospholipase A at interfaces. J. Biol. Chem. 246,4023-4034. 5. Apitz-Castro, R., Jain, M. K., and de Haas, G. H. (1982) Origin of the latency phase during the action of phospholipase A, on unmodified phosphatidylcholine vesicles. Biochim. Biophys. Acta 688,349-356. 6. Lichtenberg, D., Romero, G., Menashe, M., and Biltonen, R. L. (1986) Hydrolysis of dipalmitoylphosphatidylcholine large unilamellar vesicles by porcine pancreatic phospholipase 4. J. Biol. Chem. 26 1,5334-5340. 7. Romero, G., Thompson, K., and Biltonen, R. L. (1987) The activation of porcine pancreatic phospholipase A, by dipalmitoylphosphatidylcholine large unilamellar vesicles. J. Biol. Chem. 262,13476-13482. 8. Bell, J. D., and Biltonen, R. L. (1989) The temporal sequence of events in the activation of phospholipase A, by lipid vesicles. J. Biol. Chem. 264,12194-12200. 9. Cho, W., Tomasselli, A. G., Heinrickson, R. L., and Kezdy, F. J. (1988) The chemical basis for interfacial activation of monomeric phospholipase A*. J. Bid. Chem. 263, 11237-11241. A. G., Hui, J., Fisher, J., Zilrcher-Neely, H., Reardon, 10. Tomasselli, I. M., Oriaku, E., Kezdy, F. J., and Heinrickson, R. L. (1989) Dimerization and activation of porcine pancreatic phospholipase A, via substrate level acylation of lysine 56. J. Biol. Chem. 264, 10041-10047. 11. Noel, J. P., and Tsai, M. D. (1989) Phospholipase A, engineering: Design, synthesis, and expression of a gene for bovine(pro)phospholipase A,. J. Cell. Biochem. 40, 309-320. 12. Seilhamer, J. J., Pruzanski, W., Vadas, P., Plant, S., Miller, J. A., Kloss, J., and Johnson, L. K. (1989) Cloning and recombinant expression of phospholipase A, present in rheumatoid arthritic synovial fluid. J. Biol. Chem. 264, 5335-5338. 13. Tanaka, T., Kimura, proenzyme and active zyme by Saccharomyces gene. Gene 64,257-264.

S., and Ota, Y. (1988) Secretion of the bovine pancreatic phospholipase Az encerevisine: Design and use of a synthetic

14.

Kramer, R. M., Hession, C., Johansen, Chow, E. P., Tizard, R., and Pepinsky, properties of a human non-pancreatic Chem. 264,5768-5775.

B., Hayes, G., McGray, P., R. B. (1989) Structure and phospholipase 4. J. Biol.

15.

Bekkers, A. C., Franken, P. A., van den Bergh, C. J., Verbakel, J. M., Verheij, H. M., and de Haas, G. H. (1991) The use of genetic engineering to obtain efficient production of porcine pancreatic phospholipase A, by Saccharomyces cerevisiae. B&him. Biophys. Actu 1089,345-351.

EXPRESSION

OF

PHOSPHOLIPASE

16. Verheij, H. M., and de Haas, G. H. (1991) Cloning, expression, and purification of porcine pancreatic phospholipase & and mutants, in “Methods in Enzymology” (Dennis, E. A., Ed.), Vol. 197, pp. 214-223, Academic Press, New York. 17.

Kelly, M. J., Crowl, R. M., and Dennis, E. A. (1992) Renaturation of cobra venom phospholipase A, expressed from a synthetic gene in Escherichia coli. B&him. Biophys. Acta 1118, 107-115.

C. J., Kuipers, O., Verheij, H. M., 18. de Geus, P., van den Bergh, Hoekstra, W. P. M., and de Haas, G. H. (1987) Expression of porcine pancreatic phospholipase Generation of active enzyme by sequence-specific cleavage of a hybrid protein from Escherichia coli. Nucleic Acids Res. 15,3743-3759. expression protein phospholi-

28.

0. P., Marjolein, M. G. M., Thunnissen, M. M. G. M., de Geus, P., Dijkstra, B. W., Drenth, J., Verheij, H. M., and de Haas, G. H. (1989) Enhanced activity and altered specificity of phospholipase A1 by deletion of a surface loop. Science 244,82-85.

22. Kuipers,

0. P., Vincent, M., Brochon, J. C., Verheij, H. M., and de Haas, G. H. (1991) Insight into the conformational dynamics of specific regions of procine pancreatic phospholipase A, from a time-resolved fluorescence study of a genetically inserted single tryptophan residue. Biochemistry 30,8771-8785.

23. Kuipers,

0. P., Franken, P. A., Hendriks, de Haas, G. H. (1990) Function of the Asp99, Tyr52 and Tyr73 in phospholipase 199-204.

24. Dupureur, M. D. (1990) aspartate-99

R., Verheij, H. M., and fully conserved residue A,. Protein Eng. 4,

C. M., Deng, T., Kwak, J. G., Noel, J. P., and Tsai, Phospholipase A2 engineering. 4. Can the active-site function alone? J. Am. Chem. Sot. 112,7074-7076.

29.

30.

26. Dekker,

N., Peters, A. R., Slotboom, R., and de Haas, G. (1991) Porcine

A. J., Boelens, R., Kaptein, pancreatic phospholipase A,:

and secondary

R. L., Krueger, E. T., and Keim, P. S. (1977) Amino acid sequence of phospholipase AZ-o from the venom of Crotalus adamanteus. J. Bial. Chem. 252,4913-4921. Biltonen, R. L., Heimburg, T. R., Lathrop, B. K., and Bell, J. D. (1990) Molecular aspects of phospholipase A, activation, in “Biochemistry, Molecular Biology, and Physiology of Phospholipase and Its Regulatory Factors” (Mukherjee, A. B., Ed.), pp. 85103, Plenum, New York. Studier, F. W., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. (1990) Use of T7 polymerase to direct expression of cloned genes, in “Methods in Enzymology” (Goeddel, D. V., Ed.), Vol. 185, pp. 60-89, Academic Press, New York. Maraganore, J. M., Merutka, G. M., Cho, W., Welches, W., KBzdy, F. J., and Heinrikson, R. L. (1984) A new class of phospholipase A, with lysine in place of aspartate 49. J. Bial. Chem.

259.13839-13843. 31.

32. 33.

Shpaer, E. G. (1986) Constraints on codon context in Escherichia coli genes. Their possible role in modulating the efficiency of translation. J. Mol. Bial. 188, 555-564. Mowa, N. R., Nakamura, K., and Inouye, M. (1980) Amino acid sequence of the signal peptide of ompA protein, a major outer membrane protein of Escherichia coli. J. Biol. Chem. 255,27-29, Perbal, B. (1988) “A Practical Guide to Molecular Cloning,” p. 304, Wiley, New York.

34. Tsunasawa, 35.

S., Stewart, J. W., and Sherman, F. (1985) Aminoterminal processing of mutant forms of yeast iso-1-cytochrome c. J. Biol. Chem. 260,5382-5391. Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M. D.,Fujimoto, E. K., Goeke, N. M., Olson, B. J., and Klenk, D. C. (1985) Measurement of protein using bicinchoninic acid. Anal. Biockem. 150, 76-85.

36. Thannhauser, 37.

25. Noel, J. P., Bingman,

C. A., Deng, T., Dupureur, C. M., Hamilton, K. J., Jiang, R. T., Kwak, J. G., Chandra, S., Sundaralingam, M., and Tsai, M. D. (1991) Phospholipase A2 engineering. X-ray structural and functional evidence for the interaction of lysine-56 with substrates. Biochemistry 30,11801-11811.

assignments

4

20. Levin,

21. Kuipers,

517

E. coli

27. Heinrikson,

in

W., Daniel, R. F., Stoner, C. R., Stoller, T. J., WardwellSwanson, J. A., Angelillo, Y. M., Familletti, P. C., and Crowl, R. M. (1992) Purification of recombinant human secretory phospholipase A, (Group II) produced in long-term immobilized cell culture. Protein Expression Purif. 3, 27-35.

IN

Sequence-specific ‘H and “N NMR structure. Biochemistry 30,3135-3146.

4.

19. Deng, T., Noel, J. P., and Tsai, M. D. (1990) A novel vector for high-level synthesis and secretion of foreign Esckerichia coli: Overproduction of bovine pancreatic pase A,. Gene 93,229-234.

A,

38. 39.

T. W., Konishi, Y., and Scheraga, H. A. (1984) Sensitive quantitative analysis of disulfide bonds in polypeptides and proteins. Anal. Biochem. 138, 181-188. Bell, J. D., and Biltonen, R. L. (1989) Thermodynamic and kinetic studies of the interaction of vesicular dipalmitoylphosphatidylcholine with Agkistrodon piscivorus piscivorus phospholipase A,. J. Biol. Chem. 264,225-230. Marston, A. 0. (1986) The purification of eucaryotic polypeptides in Escherichia coli. Biockem. J. 240, 1-12. Tandon, S., and Horowitz, P. (1986) Detergent-assisted refolding of guanidine chloride-denatured rhodanese. J. Bial. Ckem. 261, 15615-15681.