Expression of active hen egg white lysozyme in transgenic tobacco

Plant Science, 87 (1992) 55-67 Elsevier Scientific Publishers Ireland Ltd.

55

Expression of active hen egg white lysozyme in transgenic tobacco Jean Trudel, Claude Potvin and Alain Asselin D~partement de Phytologie. Facult~ des Sciences de l'Agriculture et de I'Alimentation. Universit~ Laval. Ou~bec, GIK 7P4 (Canada) (Received June 24th, 1992; revision received August 14th, 1992; accepted August 18th, 1992)

A full-length complementary DNA clone of hen egg white lysozyme (HEWL) was inserted into pBII21 vector lacking the /3-glucuronidase (GUS) gene and used to transform tobacco. The HEWL gene had its own 18-amino acid signal peptide. HEWL activity was detected using a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) assay. The enzyme was active against Micrococcus luteus cells and migrated at the same molecular mass as purified mature HEWL. The protein was also found by immunodetection of HEWL after SDS-PAGE. Twenty-seven independent transgenic tobacco plants were analyzed for the expression of HEWL by a modified lysoplate assay for quantifying HEWL activity. Twenty-five plants exhibited HEWL activity up to 30 ng of HEWL per mg of leaf tissue. When using successive intercellular fluid (IF) extracts to study the localization of HEWL, it was found that no more than 10% of HEWL could be recovered in IF extracts. This is contrary to several extracellular proteins, such as the pathogenesis-related proteins. However, purified HEWL was recovered with the same yield as in transgenic tobacco leaves when it was injected into normal leaf tissue. Transgenic tobacco plants did not exhibit a phenotype change due to the expression of HEWL. The HEWL gene could be a useful reporter gene because the activity of the protein can be quantified by a simple assay.

Key words: chitinase; lysoplate; lysozyme; pathogenesis-related proteins; polyacrylamide gel electrophoresis; tobacco

Introduction

Lysozyme (muramidase or peptidoglycan Nacetylmuramoyl-hydrolase; EC 3.2.1.17) cleaves the peptidoglycan of bacterial cell walls and is widely distributed in nature [1]. Lysozyme activity is primarily assayed by hydrolysis of Micrococcus luteus (syn: lysodeikticus) cells. There are two types of animal lysozymes: the chicken (c)-type represented by hen egg white lysozyme (HEWL) and the goose (g)-type [1]. Several bacteriophage lysozymes, such as T4 lysozyme, are well characterized. Lysozymes are also present in invertebrates as well as in plants [1,2]. Some lysozymes, such as HEWL, display chitinase activity (EC 3.2.1.14) and plant lysozymes are usually more active as chitinases [3-8]. There has been Correspondence to: Alain Asselin, D6partement de Phytologie, Facult~ des Sciences de l'Agriculture et de l'Alimentation, Universit~ Laval, Ou6bec, GIK 7P4 Canada.

one attempt to express bacteriophage T4 lysozyme in transgenic tobacco [9]. However, several chitinases have been expressed in transgenic plants. Chitinases of bacterial origin with no lysozyme activity [10,11] and of plant origin with various levels of lysozyme activity [12-15] have been expressed in transgenic tobacco. In the case of plant chitinases expressed in transgenic tobacco, such chitinases were found to accumulate in the plant vacuole except when the protein was secreted by default [16-18] after removing the short C-terminal sequence necessary and sufficient for targeting of chitinase to the vacuole [14]. Avian and mammalian c-type lysozymes have been thoroughly studied as model enzymes and HEWL represents one of the best characterized secreted enzymes [1]. In addition to its lysozyme and chitinase activity, HEWL shows promising use as a pharmaceutical [19] and preservative for food [19,20]. Despite numerous studies involving HEWL and other c-type lysozymes, there has been

0168-9452/92/$05.00 © 1992 Elsevier Scientific Publishers Ireland Ltd. Printed and Published in Ireland

56 no report, to our knowledge, dealing with the expression of HEWL in transgenic plants. However, HEWL has been expressed in transgenic mice [21], in yeasts [22,23] and in Aspergillus niger [24]. In this report, it is shown that HEWL can be found in its mature form with its own signal sequence in various organs of transgenic tobacco. The activity of HEWL was quantified by a modified lysoplate assay allowing HEWL to be used as a reporter gene product. Materials and Methods

All standard recombinant DNA procedures used in this study were carried out as described [25], unless otherwise noted. DNA restriction and modifying enzymes were from Pharmacia or Bethesda Research Laboratories. Reagents for electrophoresis were obtained from Bio-Rad (Mississauga, Ontario, Canada). All other reagents, unless specified otherwise, were purchased from Sigma. Isolation of HEWL cDNA clone A chicken oviduct cDNA library in Lambda ZAP II ® (Stratagene, La Jolla, CA) was screened with a DNA probe corresponding to nucleotides 90-110 of HEWL sequence [26]. Lambda ZAP II ® phages and E. coli XL1-Blue (Stratagene) were incubated for 15 min at 37°C and plated on 150 mm NZY plates (5 g NaCI, 2 g MgSO4.7H20, 5 g yeast extract, 10 g NZ amine (casein hydrolysate) and 15 g agar per liter of water adjusted to pH 7.5 with NaOH) at a density of approx. 2000 plaques per plate. When plaques began to appear (5-7 h at 37°C), two nitrocellulose membranes (Schleicher and Schuell) were successively applied. DNA bound to nitrocellulose was denatured in 0.5 M NaOH for 5 min followed by 1 M Tris-HC1 (pH 7.5) for 2 min. After washing in 0.5 M Tris-HCl (pH 7.5) and 1.5 M NaCI for 15 min, membranes were dried by blotting and heated at 80°C for 1.5 h. Prehybridization was in 6 x saline sodium citrate (SSC: 150 mM sodium chloride and 15 mM sodium citrate, pH 7.0), 5 x Denhardt (Ficoll 400, polyvinylpyrrolidone and bovine serum albumin, all at 0.2% (w/v)), 20 mM NaH2PO 4 and 500 #g/ml of sonicated salmon

sperm DNA for 2 h at 42°C and overnight hybridization was in the same buffer containing 0.4% sodium dodecyl sulfate (SDS) and 106 counts/min per ml of 3zp-labeled DNA probe. Labeling was performed with polynucleotide kinase and [7-32p]dATP (ICN Biochemicals, Costa Mesa, CA). Membranes were rinsed three times (5 min) in 6 x SSC, 0.1% SDS at room temperature with a final wash (15 min) at 59°C in the same buffer and exposed to X-Ray film (Kodak) at -80°C. Eighteen clones gave strong positive signals. Corresponding phages were converted to pBluescript SK(-) plasmids (Stratagene) in E. coli XLI-Blue by in vivo phagemid excision using R408 helper phage. One clone (pSK4-4) was selected on the basis of the insert length and sequenced [271 using the T7 and T3 sequencing primers. This clone (pSK4-4) was converted to clone pSK4-22 by completing the signal sequence and adding BamHI sites on both ends. Briefly, pSK4-4 clone was digested with EcoRI and treated with T4 DNA polymerase in the presence of only dCTP and dTTP, using its 3' -- 5' exonuclease activity in order to eliminate some nucleotides at each end of the gene. S 1 nuclease was then used to blunt each end of the fragments and the HEWL insertion was purified from pBluescript on low melting agarose gel. In parallel to the HEWL preparation, pBluescript SK(-) vector was digested with BamHI. The reaction mixture was phenol extracted and the linearized vector was precipitated with ammonium acetate and ethanol before the partial filling-in reaction done according to Davies [28] with dATP and dGTP deoxynucleotides. Appropriate oligodeoxyribonucleotide pairs (AAAGACCTCATG and TCCATGAGGTCTTT) were added with T4 DNA ligase at each end of this vector and unreacted molecules were removed by ethanol precipitation. Finally, HEWL gene was inserted in the vector with T4 DNA ligase and the reaction mixture was used to transform [29] E. coli XL1-Blue cells. The resulting construction (pSK4-22) was selected by sequencing [27]. Vector construction for plant transformation The plant transformation vector pBIl21 (Clonetech, Palo Alto, CA) was digested with

57

BamHI and SacI restriction enzymes in order to remove the GUS gene. The resulting vector was recovered from low melting agarose gel and treated with T4 DNA polymerase in the presence of all dNTPs to blunt each end. The vector was then circularized with T4 DNA ligase and used to transform [29] E. coli XL1-Blue cells. The vector was selected by linearization with BamHI and was named pBI121.7. This vector was used to insert pSK4-22 HEWL full-length gene after BamHI digestions. The number of insertions was determined after HindlII/EcoRI digestions while the orientation of the insertion was investigated by DraI/EcoRI and DraI/HindlII digestions. The construct containing one HEWL gene under the control of CaMV 35S promoter was identified as pBI623. Another construct named pBI1023 containing the HEWL insert in reverse orientation was used as control for the original pBIl21. Tobacco transformation Transformation constructs pBI121, pBI623, pBI1023 in XLI-Blue were transferred in Agrobacterium tumefaciens LBA4404 harboring Ti plasmid pAL4404 using standard triparental mating procedures [30] with pRK2013 conjugative plasmid in E. coli HB101. Transformed A. tumefaciens cells were selected on LB medium (1% (w/v) tryptone, 0.5% (w/v) yeast extract and 1% (w/v) sodium chloride) containing 25 #g/ml streptomycin and 50 #g/ml kanamycin. Extracted plasmids were also analyzed by agarose gel electrophoresis to confirm transformation. Nicotiana tabacum cv. Xanthi nc leaf pieces were inoculated with A. tumefaciens using nurse culture plates With MS-104 medium [30]. Resulting kanamycin resistant calli were propagated in vitro before being transferred to soil [30] and grown under normal greenhouse conditions [8]. Lysozyme polyacrylamide gel electrophoresis assay Homogenates (1:3; w/v) of tissue were made in 2.5% (w/v) SDS, 10% (w/v) sucrose, 50 mM CaCI2, heated at 100°C for 5 min and clarified at 15 000 × g for 10 min at room temperature. Intercellular fluid (IF) extracts were made as previously described [31] in 50 mM CaCI2. Leaf pieces (2.5 x 2.5 era) were infiltrated in vacuo and

centrifuged at 1000 x g for 10 min. IF extracts were mixed with 4 x denaturing solution containing 10% (w/v) SDS and 40% (w/v) sucrose and heated to 100°C for 5 min. Lysozyme activity was assayed after SDS-polyacrylamide gel electrophoresis (PAGE) [32,33] in 0.1% (w/v) SDS-15% (w/v) polyacrylamide slab gels (0.75 mm in thickness) containing 0.1% (w/v) Micrococcus luteus (syn: M. lysodeikticus) (Sigma) cells as substrate. After electrophoresis, the gel was incubated at 37°C for 1.5 h in 50 mM sodium phosphate buffer (pH 7.0) containing purified 1% (v/v) Triton X-100 and clear lysis zones were visualized and photographed against a black background [33]. Lysis zones thus appeared as dark bands on photographs.

Lysozyme lysoplate assay Tobacco organ homogenates and leaf IF extracts were assayed for lysozyme activity in 1% (w/v) agarose slab gels containing 0.05% (w/v) lyophilized M. luteus cells as substrate. The gel also contained 60 mM 2-[N-morpholino]ethanesulfonic acid (MES)-NaOH buffer (pH 6.5) and 1% (v/v) purified Triton X-100 [32]. Agarose gels were made from 40 ml of agarose solution poured on 20.5 x 12.5 cm glass plates. Wells of 3.5 mm in diameter were punched out of the gels and 15 #1 of boiled samples were put in wells and the plates were incubated for 16 h at 37°C in closed boxes. Lysis zones were visualized, measured and photographed as for the lysozyme PAGE assay. lmmunodetection of HEWL Proteins were separated by SDS-PAGE as for the lysozyme PAGE assay. Proteins were transferred to 0.45/zm nitrocellulose membranes for 3 h at 375 mA in the Davis buffer [34] containing 20% (v/v) methanol. Nitrocellulose membranes were incubated overnight in 1% (w/v) bovine serum albumin (fraction V), 0.5% (w/v) non-fat dry milk (Amersham) and 0.001% (w/v) thimerosal in TBS (Tris buffered saline: 20 mM Tris-HC1, pH 7.5 and 150 mM NaCI) buffer and exposed to HEWL rabbit antiserum (1/250 in TBS) for 1 h at room temperature followed by goat anti-rabbit peroxidase conjugate (Bio-Rad) (1/1000 in TBS) for 1 h at room temperature. Reaction was revealed in

1

GCAG

i0

20

: . . . . . . . . . . . . . . . .

.A .........

G G A A ~ CCCTT TGCTAATCT TGGTGCTTTGCTTCC TGCCC CTGGC TGCT C T G G G G A A A G T~TTT G G A C G A T G T G A G C T G G C R ~ G G C T A T C d & A G 30 40 50 60 70 80 90 I00 ii0 120

....................................................

-18 -15 -5 -I 1 5 Met/%rg SerLe uLeu IleLe uValLouCys PheLeuPro L e u A l a A l a L e u G l y L y m V a l P h o G l y A r gCymGluLeuAlaAlaAlal4mt Ly m ................... TCCC~TG~ ......................... ~i~[~ii[i~i[i[~ ~ iiii[i[~[~[[[i[~[[~i~[[[[~[[[~[~ ..... [ a . . . . . . . . .

270

C ~ T GG T ff~"T ~ 2 ~

280

290

300

C ~ T GG C ~ . , , ~ C C C ~%G~-"~ ~ . I ~ , ~ T

310

~

320

330

~

340

~

350

~

360

370

...................................

85 95 SerAlaLeuLeuS erSe rAipI l e ~ a S o r V ~ m n ~ y s L y i i l e V a

CC G T ~-"T O ~ G ~ " ~ T ~

75 er~nLeuCyaAsnIleProCys

380

390

i S ~ y ~ n

ec.ce~

C~2C'~T

Fig, 1, Nucleotide sequences of HEWL clones. Only the DNA strand corresponding to the m R N A sequence is given, pSK4-4 is a clone, containing the EcoRl (underlined) HEWL insertion, obtained from a hen oviduct cDNA library. The boxed nucleotides correspond to the sequence of the oligonucleotide probe used to screen the library. The amino acid sequence of H E W L is from met-18 to leu-129. Numbers (1-580) below pSK4-4 correspond to n ucleotides of the genomic sequence obtained by Jung et al. [26]. Other cDNA sequences compared are pls-I [26] and pKK-I [36]. Dots are aligned when nucleotides are identical. Differences are noted by the corresponding nucleotides. Asterisks indicate nucleotide modifications that alter the amino acid sequence.

CGCTACCCGCTTGGCAGTTTTAAACGCATC C C T C A T T A A A A C G A C T A T A C G C A A A 3 7 ~ 530 540 550 560 570 580

....................................................

.......................................................

.......................................................

105Sot* 115 125 129 G~yMetAsnA~aTrpva~A~aTrpArgAsnArgCymLymG~yThrAspva~G~nA~aTrpI~aArgG~/sArgLeu~T~P ....... A ................................. C .................................................. A .......................................... ....... G* ................................ T .............................................. J...A .......................................... ....... A ................................. C .................................................. G .......................................... GGcATGAACGCGTGGGTCGCcTGGCGCAACCGCTGCAAGGGCACCGACGTCCAGGCGTGGATCAGAGGCTG~GGCTGT~~~C~~~C~~~ 400 410 420 430 440 450 460 470 480 490 500 510 520

260

~.~,C

65 As nS erArgTrpTrpCyRA~n/~pGlyArgThrProGlyS

15 25 Val* 35 45 55 ArgHil GIyLeuAIpAInTyrArgGIyTyrS e r L e u G l y A m n T r p V a l C y L E l a A l a L y s P h e G l u S e r A a n P h e A l n T h r G l ~ T ~ ~ n ~ y S e ~ ~ y i l ~ ~le ............................................ cc ................................... ii~ ................................. ~[iiii[i ........................................... ~, ..................................... " ................................ .................................................... CC ..................................................... CGTCACGGAcTTGATAACTATCGGGGATACAGCCTGGGAAACTGGGTGTGTGCTGCAAAATTCGAGAGTAAcTTCAAC~CCCAGGCTACAAACCGTAA .............. ~ ~ ~ . A ~ 130 140 150 160 170 180 190 200 210 220 230 240 250

pSK4-4

pls-1 pKK-1

g~ne

59 100 ml TBS containing 60/zl of 30% (v/v) hydrogen peroxide and 60 mg of 4-chloro-l-naphthol (Bio-Rad).

f3-Glucuronidase PAGE assay Tobacco samples (homogenates or IF extracts) were subjected to native P A G E using the Davis system [34] in 15% (w/v) polyacrylamide gels. EIectrophoresis was performed as previously described [8]. After electrophoresis, each gel was incubated for 5 min in 200 m M sodium phosphate (pH 7.0), transferred to a glass plate and overlayed with a 3-MM Whatman paper in 200 m M sodium phosphate buffer (pH 7.0) containing 1 m M 4methyl-umbelliferyl-/%glucuronide (4-MU-/~-glucuronide) (Sigma). After 1 h at 37°C in a closed container, the paper was removed and ~glucuronidase (GUS) activity was visualized by UV transillumination (302 nm, model TM-40, UV Products). GUS activity in solution was measured spectrophotometrically (GUS user manual, Clonetech) using p-nitrophenyl-fl-glucuronide as substrate. One unit is defined as the amount of enzyme that produces one nanomole of product per min at 37°C. This value represents about 5 ng of pure E. coli GUS as supplied by Clonetech.

Injection and recovery of purified H E W L into leaf tissue Non-transgenic tobacco leaves were injected [35] with purified H E W L (Sigma) using a 3-ml syringe with a 30-G 1/2 in. needle. The leaf tissue was allowed to recuperate for at least 2 h for evaporation of the injected liquid. Leaf tissue was then homogenized or infiltrated in vacuo for IF extracts to determine recovery of injected HEWL. Results

Isolation and construction of a full-length H E W L gene One probe was used to screen a commercial chicken oviduct c D N A library. Eighteen clones (out of approximately 30 000) were positive after hybridization with the probe. One clone (pSK4-4, Fig. 1) was sequenced and compared to other known H E W L sequences (Fig. 1, gene vs. pls-I vs. pKK-1 vs. pSK4-4). Only two nucleotide changes (nucleotides 176 and 485) were found between pSK4-4 and H E W L genomic D N A sequence [26] while four nucleotide changes were observed between clone pSK4-4 and the H E W L c D N A sequence of Jung et al. [26] at nucleotides 175, 400, ATG

NPT II (Kan R)

CaMV 35S

Pro ~

R-Glucuronidase (GUS)~

pBI121

i NPT

CaMVP3SS r

II (Kan R) o.

-

*

~ -

pBI623 :Io

Fig. 2. Schematicconstruction of pBI623. The upper section shows the arrangement of commercial pBI121 transformation vector (Clonetech) and the location of some restriction sites. The left (LB) and the right borders (RB) of the vector are indicated. NPT II gene, between the nopaline synthase promoter (NOS-Pro) and terminator (NOS-ter), confers kanamycin resistance both in bacteria and in plants. The GUS gene was excised, with BamHl and Sacl restriction enzymes and was replaced by the BamHI insertion of HEWL pSK4-22 clone. The resulting plasmid, containing the HEWL gene under the control of the CaMV 35S promoter and the nopaline synthase terminator (NOS-ter), was named pBI623 (lower section).

A

IF HB

1

2

3

4

HEWL (ng) 5

HA

6

10

100

Mr(kDa) --110 - 84 --47 - 33 - -

24

--16

--110 84 47 33 24

B

--16

ll~

B-GLUC 10 ng

I F

HB 1

2

3

4

5

6

HA

Fig. 3. Electrophoretic assay of HEWL and GUS in transgenic tobacco and immunodetection of HEWL in transgenic tobacco. Tobacco was transformed with pBll21 (Fig. 2, upper section) and pBI623 (Fig. 2, lower section). {A) Leaf tissue from transgenic tobacco no. 8 was homogenized before (HB) or after (HA) six successive intercellular fluid (IF) extracts (see Methods). Samples were subjected to SDS-PAGE in gels containing M. luteu~"cells as substrate (see Materials and Methods). After electrophoresis, HEWL activity was revealed as clear lysis zones in gels incubated with 1% (v/v) purified Triton X-100. Clear bands were photographed against a black background and lysis zones appear as dark bands. Known amounts of purified HEWL (1, 10 and 100 ng; upper right) were used as controls in addition to molecular mass markers indicated on the right ( M r in kDa). (B) Same as (A} except that HEWL was detected by an immunoblot assay (see Materials and Methods). (C) Electrophoretic detection of GUS activity after native PAGE separation. Homogenates before (HB) and after (HA) six successive IF (IF I-6) extracts and 10 ng of purified E. coli ~-Glucuronidase (B-Gluc., 10 ng) were subjected to native PAGE according to Davis [341 (see Materials and Methods). After PAGE, GUS activity was revealed by UV transillumination after incubating the gel in 4-MU-B-glucuronide (see Materials and Methods). Pre-stained molecular mass markers (Bio-Rad) are phosphorylase B (I 10 kDa), bovine serum albumin (84 kDa), ovalbumin (47 kDa), carbonic anhydrase (33 kDa), soybean trypsin inhibitor (24 kDa), and lysozyme (16 kDa). The difference in mobility between the lysozyme marker and the purified or expressed HEWL is explained by the fact that marker lysozyme is pre-stained.

61 434 and 485. There were only two nucleotide changes (nucleotides 113 and 175) when the pSK44 clone was compared to HEWL cDNA sequence reported by Kumagai et al. [36] (pKK-1 vs. pSK44, Fig. 1). Overall, clone pSK4-4 was identical in deduced amino acid sequence with the HEWL cDNA and genomic sequences reported by Kumagai et al. [36] and Jung et al. [26], respectively. It was, however, different in two amino acids (ala vs. val at amino acid residue 31 and asn vs. ser at residue 106) when compared to the deduced amino acid reported by Jung et al. [26] from their cDNA clone. Clone pSK4-4, corresponding to one oviduct clone coding for HEWL, was further modified to include the full sequence of the signal peptide (met-18 to gly-l) and bordering BamHI restriction sites. It was identified as pSK4-22.

Insertion of HEWL gene into pBI121 The BamHI insertion of pSK4-22 was transferred into commercial pB1121 transformation vector after removing the GUS gene (Fig. 2). The resulting vector (pBI623) contained the HEWL gene under the control of CaMV 35S promoter. One construct was also made of HEWL gene in reverse direction (not shown). Two constructs of altered HEWL signal peptide (one addition and one deletion of two and three amino acids, respectively) were also produced (not shown). Transformation of tobacco with pBIl21 and pB1623 Nicotiana tabacum cv. Xanthi-nc leaf pieces were transformed with pBI vectors expressing GUS or HEWL activity. Transgenie tobacco plants were first examined by a SDS-PAGE assay for lysozyme activity [32] in gels containing autoclaved lyophilized M. luteus cells as substrate for lysozyme. This technique was previously used for studying the expression of two cloned bacterial peptidoglycan hydrolases [33,37]. Results in Fig. 3A indicated that leaf tissue from transgenic tobacco no. 8 expressed lysozyme activity as detected by lysis of M. luteus embedded in the gel matrix. Such activity (Fig. 3A) was found in the homogenates of leaf tissue before (Fig. 3A, HB) or after (Fig. 3A, HA) six successive intercellular fluid extracts (Fig. 3A, IF 1-6). The estimated molecular mass of lysozyme activity corresponded

exactly in migration with mature active HEWL (Fig. 3A, extracts vs. HEWL). The results based on electrophoretic detection of HEWL activity were confirmed by immunodetection of HEWL after SDS-PAGE separation. Results of the immunoblot (Fig. 3B) were similar to those from the activity detection (Fig. 3A). The activity assay (Fig. 3A) exhibited an opaque smear below the HEWL band. This smear seemed to correspond to chlorophyll-binding aggregates (not shown). Results from activity and immunological detection after SDS-PAGE both indicated that HEWL was expressed correctly in its mature form in tobacco. However, six successive intercellular fluid (IF) extracts were not sufficient to remove all HEWL. This was somewhat different from the relative efficiency of successive IF washings to extract extracellular tobacco PR proteins [31]. In parallel experiments, transgenic tobacco plants containing pBI121 were also tested for intracellular GUS activity with the same electrophoretic approach for activity detection. In the case of GUS activity, denaturing SDS-PAGE was not suitable for assay of GUS because of enzyme inactivation. However, native PAGE using the Davis system allowed detection of GUS activity after separation (Fig. 3C). Interestingly, one minor and one major band were found to be active in the leaf homogenates and in commercial GUS standard (Fig. 3C, B-Glue., HB and HA). Contrary to HEWL activity, GUS activity was not found in the first IF extract (Fig. 3C, IF 1) and the successive IF extracts yielded more activity because of increasing leaking from broken cells (Fig. 3C, IF 2-6). This last result was consistent with the intracellular localization of GUS while HEWL behaved differently. However, HEWL did not behave like easily extracted soluble PR proteins.

Lysoplate assay of HEWL activity in transgenic tobacco plants and organs We modified a well-known [38] and routine [39] lysoplate assay of lysozyme activity in order to quantify the amounts of HEWL expressed in transgenic tobacco extracts. The modification was that the agarose slab contained 1% (v/v) purified Triton X-100 [33] to remove SDS from the extracts boiled in the presence of this detergent. Extraction

•

o

o

o

o

o

o o

o o

o o

o o

r-

Z

m

.,L

..A

mb

0

..L

63

a non-transgenic tobacco (Fig. 4B, NT). Various tobacco organs were also analyzed for HEWL activity (Fig. 4B, lower row). All lysis zones of extracts were measured in comparison with increasing amounts of purified HEWL (Fig. 4C, 0-500 ng).

500 400 {2) E v

300

--J

200

Quantifying HEWL by the lysoplate assay

100 0

. . . . . . . . .

0

| . . . . .

20

~...

i..q

40

. . . . . .

i . . . . . . . . .

60

| . . . . . . . . .

80

i . . . . . . . . .

100

i

120

Lysis z o n e a r e a (mm 2) Fig. 5. Relationship between the lysis zone area and the amount of HEWL. Data from Fig. 4C were used to analyse the relationship between the lysis zone and the increasing amounts of HEWL as determined by the lysoplate assay. The exponential curve can be described by the following formula: HEWL (ng)= 0.155 x 1010036 × LZA(mm2))with an R 2 correlation coefficient value of 0.988 where LZA is the lysis zone area.

of HEWL in the presence of SDS was found to be necessary because of strong binding of HEWL to tobacco cell component(s). After overnight incubation, lysis zones were measured (Fig. 4) and converted to HEWL amounts after determining the lysis zone area in mm 2 (Fig. 5). Results in Fig. 4A illustrate the lysis zones of foliar extracts from 27 independent transgenic tobacco plants (Fig. 4A, 1-27). Transgenic tobacco no. 8 was the plant previously used to provide data in Fig. 3. The same plant was also used to study the expression of HEWL in various extracts of foliar tissue and in various organs (Fig. 4B). Homogenates of foljar tissue before (Fig. 4B, HB) and after (Fig. 4B, HA) six successive IF extracts (Fig. 4B, IF 1-6) were analyzed by the lysoplate assay in comparison with

A correlation was established between the lysis zone area in the lysoplate assay (mm 2) and the amount of HEWL. The amount of HEWL in nanograms was found to be equal to 0.155 x 10(0.036 x lysiszonearea) with an R 2 correlation coefficient value of 0.988. From such calculations, histograms of HEWL amounts in 27 independent transgenic tobacco plants (Fig. 6A) and in several organ extracts of transgenic tobacco no. 8 (Fig. 6B) show the results from the lysoplate assay. Two out of 27 independent tobacco plants (plant no. 1 and 6) did not exhibit lysozyme activity after transformation with pBI623. All 25 other plants exhibited HEWL activity ranging from a few nanograms to close to 30 nanograms of HEWL equivalent per mg of fresh weight tissue (Fig. 6A). The organs yielding the highest amounts of HEWL were roots and petals (Fig. 6B, root and petal versus other organs). The data from the comparison of leaf homogenates versus successive IF extracts are also presented in Fig. 6B (HB, IF l-6, HA). Obviously, no HEWL was observed in nontransformed tobacco (Fig. 6). The same result was found in tobacco transformed with HEWL in reverse orientation (not shown) or using the construct with a three amino acid deletion (leu-15 to ile-13) in the signal peptide (not shown). However, a weak signal was detected when two amino acids (phe and pro) were added between ser-16 and leu15 in the HEWL signal peptide (not shown).

Fig. 4. Lysoplate assay of HEWL. Agarose (1%, w/v) gels containing 0.05% (w/v) M. luteus lyophilized cells as substrate were used to quantify lysozyme activity. Samples in 3.5-mm diameter wells in agarose slabs were incubated in the presence of I% iv/v) purified Triton X-100 (see Methods). As for acrylamide gels (Fig. 3, panel A), lysis zones were clear areas in the agarose gel containing the opaque bacterial substrate. Lysis zones were photographed (Fig. 3) as for acrylamide gels. Two perpendicular diameter measurements were used to calculate the area of the lysis zone. (A) Assay of 27 independent transgenic tobacco plants. I B) Assay of H EWL in various organs and extracts of transgenic tobacco no. 8. Leaf homogenates before (HB) or after (HA) six successive IF extracts (IF 1-6) were analyzed in comparison with a non-transgenic tobacco leaf extract (NT). Root (Rt), stem (St). mature leaf (ML), apical leaf (ALL sepal (Se), petal (Pe), ovary (Ov), pistil (Pi) and stamen (Sn) homogenates were also analyzed. (C) Assay of known amounts of purified HEWL. Commercial purified HEWL from 0 to 500 ng was tested by the lysoplate assay for determining the relationship between the surface of the lysis zone and the amount of HEWL.

64

A

30

Table I.

Recovery of HEWL from transgenic tobacco leaf tissue and of purified HEWL injected into tobacco leaf tissue. Leaves from transgenic tobacco plant no. 8 were analyzed for HEWL (Fig. 4). HEWL amounts (nanograms) from homogenates before (HB) or after (HA) six successive IF extracts (IF I-6) were calculated using the curve (Fig. 5) relating HEWL to lysis zone areas (LZA). In a separate experiment, HEWL was injected (see Materials and Methods) into nontransgenic tobacco leaf tissue. The amounts of recovered HEWL in homogenates and IF extracts were estimated by the lysoplate assay previously described.

2s

E

15

0

transgenic

tobacco

Extract

B

40 E =

30

._1

~

20

-r

10" 0 E ~

om_~

m

HB IF 1 IF IF 3 IF 4 IF 5 IF 6 HA

Tobacco leaf extracts from Transgenic plant no.8

Injected nontransgenic

LZA (mm 2)

HEWL (ng)

LZA (ram 2)

HEWL (ng)

73.8 36.1 2 36.4 36.1 30.6 26.9 70.1

76 3 33.6 3 3 2 I 56

84.9 54.4 3 41.3 30.4 29.2 22.2 81.5

195 15 46.9 5 2 2 1 148

organs lrom transgenic tobacco no 0

Fig. 6. Histograms of HEWL in transgenic tobacco plants. (A) By using data from Fig. 4 and the formula from Fig. 5, the amount of HEWL was estimated in 27 independent tobacco plants. (B) HEWL amount was estimated in various organs of transgenic tobacco no. 8. See Fig. 4 for the legends. All HEWL amounts were expressed as ng of HEWL per mg of fresh weight (FW) tissue.

Recovery of HEWL in transgenic foliar tissue and after its injection into leaves Despite the presence of mature, active HEWL in transgenic tobacco as detected by the PAGE assay and confirmed by immunoblotting, we found a very low recovery of H E W L in successive IF extracts (Fig. 6B). This is more evident in Table I where approx. 10% of H E W L was recovered in six successive IF extracts. In order to better understand this behavior, we injected purified HEWL into leaf tissue of non-transgenic tobacco [35]. It was found that injected H E W L mimicked exactly the fate of HEWL in transgenic tobacco (Table I, injected HEWL vs. HEWL in transgenic tobacco

no. 8). This result showed that injected HEWL is not easily extracted by successive IF extracts even if it did not have to go through the secretory pathway. A strong interaction between HEWL and some extracellular component(s) may explain the low recovery of HEWL from transgenic tobacco as well as after its injection in the same tissue. Discussion HEWL has a distinguished history being among the first enzyme to be sequenced, the first for which a three-dimensional crystal structure was determined by X-ray diffraction techniques and the first for which a mechanism of action was detailed [1]. HEWL is synthesized as a prelysozyme bearing an 18 amino acid signal peptide which is removed during the secretion process [40] and giving rise to a mature protein of 129 amino acids with four intramolecular disulfide bonds. Expression of HEWL in E. coli resulted in

65 enzymatically inactive insoluble aggregates [41] because of improper disulfide bond formation normally occurring during passage through the eukaryotic secretory pathway. The proper formation of disulfide bonds in eukaryotic secretory proteins is believed to be catalyzed by the enzyme, protein disulfide isomerase, present in the endoplasmic reticulum [421. Such an enzyme is found in eukaryotes and that is why HEWL was successfully expressed and secreted in yeasts [22,23,43] and in Aspergillus niger [24]. Human lysozyme is highly homologous to HEWL and it bears the same four intramolecular disulfide bonds. As in the case of HEWL, human lysozyme was successfully secreted by yeast (Saccharomyces cerevisiae) [44-47].

Production of HEWL in tobacco A full-length cDNA HEWL clone bearing its own signal peptide was expressed constitutively in various organs of tobacco as a mature active enzyme. The signal sequence of HEWL was thus removed to yield an enzyme displaying the same molecular mass as purified HEWL. Pre-HEWL (HEWL bearing its 18 amino acid-long signal sequence) was separated from mature HEWL by using SDS-PAGE [40]. We used 15% (w/v) SDSpolyacrylamide gels for easily distinguishing the precursor form of HEWL from the mature protein [48]. We did not find significant amounts of preHEWL after SDS-PAGE analysis suggesting that the HEWL signal sequence is efficiently processed in the tobacco cell. However, pre-HEWL was easily detected, after SDS-PAGE, in a Saccharomyces yeast expressing the same HEWL clone (unpublished results). Although signal sequences have a common function, their primary structures are not highly conserved [49]. It is thus implied that characteristics such as hydrophobicity and conformation are the determinant factors for their function. Tobacco cells are able to recognize the HEWL intact signal sequence and to allow production of mature active HEWL.

Comparative yields of active HEWL Despite rather large yields of HEWL expressed in E. coli, the enzyme was found to be intracellular and inactive [41]. In Saccharomyces cerevisiae

(baker's yeast), HEWL was secreted at 1-2 mg/l [36] and up to 12 mg/l by A. niger [24]. The highest reported yield of a c-type animal lysozyme was 550 mg/1 when a bovine lysozyme c2 was expressed in the methylotrophic yeast, Pichia pastoris [50]. Our results show that HEWL can be found at up to 30 ng/mg fresh weight tobacco tissue. Comparisons are difficult to make because the yields of HEWL from fungi are estimated from the volume of extracellular medium without reference to the amount of fungal cells.

Effects on phenotype We have previously shown that purified HEWL injected into tobacco leaves was stable and did not provoke a stress reaction leading to the synthesis of PR proteins. However, injected cytochrome c (a basic low molecular mass protein like HEWL) was degraded and induced PR accumulation [35]. In the present study, the same results were found with transgenic tobacco. HEWL did not induce PR protein accumulation (unpublished results) nor did it produce visible effects on tobacco phenotype (unpublished results).

Prospects Up to now, animal c-type lysozymes have been mostly studied in heterologous expression systems such as bacteria and yeasts or mold fungi. Higher plants, such as tobacco, could be useful and practical alternative heterologous expression systems. Although plants have several forms of lysozyme activity (reviewed in Ref. 2), these endogenous proteins do not preclude the specific detection of HEWL activity because there are no endogenous proteins migrating electrophoretically as HEWL. Moreover, plant lysozyme activities do not resist boiling in SDS as well as HEWL. For this reason, the lysoplate assay was used to quantify HEWL in tobacco without the interference of endogenous lysozymes. Numerous efforts to find the equivalent of an animal c-type lysozyme in plants gave negative results [1]. Except for histochemical analysis, HEWL could be as useful as GUS activity for monitoring enzyme activity. It is well known that HEWL is a rather stable enzyme easily detected in the nanogram range [1]. Additional studies are in progress to transform other plants

66

with HEWL and to study the fate of various HEWL constructs in transgenic tobacco. Such constructs are designed to create variant lysozyme molecules for studying their fate in addition to their antimicrobial potential.

II

Acknowledgments

13

This research was supported by the Conseil des recherches en p6ches et agro-alimentaire du Qu6bec (CORPAQ) and by the Natural Sciences and Engineering Research Council of Canada (NSERC). We thank Patrice Audy, Rodolphe Boivin, Nathalie Daigle, Christian Otis, Souad El Ouakfaoui, Jean Grenier and Ronald Maheux for their collaboration.

12

14

15

16

References 1 2

3

4

5

6

7

8

9

10

P. Joll~s and J. Jolles, What's new in lysozyme research? Mol. Cell. Biochem., 63 (1984) 165-189. P. Audy, D. Le Qu~:r& D. Leclerc and A. Asselin, Electrophoretic forms of lysozyme activity in various plant species. Phytochemistry, 29 (1990) 1143-1159. P. Audy, J. Trudel and A. Asselin, Purification and characterization of a lysozyme from wheat germ. Plant Sci., 58 (1988) 43-50. P. Bernasconi, R. Locher, P.E. Pilet, J. Joll6s and P. Joll~s, Purification and N-terminal amino acid sequence of a basic lysozyme from Parthenocissus quinquifolia cultured in vitro. Biochim. Biophys. Acta, 915 (19871 254-260. T. Boiler, Hydrolytic enzymes in plant disease resistance, in: T. Kosuge and E.W. Nester (Eds.), Plant-Microbe Interactions: Molecular and Genetic Perspectives, Vol. 2, Macmillan Publishing Co., New York, 1987, pp. 385-414. N. Majeau, J. Trudel and A. Asselin, Diversity of cucumber chitinase isoforms and characterization of one seed basic chitinase with lysozyme activity. Plant Sci., 68 (1990) 9-16. W.K. Roberts and C.P. Selitrennikoff, Plant and bacterial chitinases differ in antifungal activity. J. Gen. Microbiol.. 134 (1988) 169-176. J. Trudel, P. Audy and A. Asselin, Electrophoretic forms ofchitinase activity in Xanthi-nc tobacco, healthy and infected with tobacco mosaic virus. Mol. Plant-Microbe Interact., 2 (1989) 315-324. S. Hippe, K. Dfiring and F. Kreuzaler, In situ localization of a foreign protein in transgenic plants by immunoelectron microscopy following high pressure freezing. Freeze substitution and low temperature embedding. Eur. J. Cell Biol., 50 (1989) 230-234. P. Lund and P. Dunsmuir, A plant signal sequence enhances the secretion of bacterial ChiA in transgenic tobacco. Plant Mol. Biol., 18 (1992) 47-53.

17

18

19

20

21

22

23

24

25

P. Lund, R.Y. Lee and P. Dunsmuir, Bacterial chitinase is modified and secreted in transgenic tobacco. Plant Physiol., 91 (1989) 130-135. K. Broglie, I. Chet, M. Holliday, R. Cressman, P. Biddle, S. Knowlton, C.J. Mauvals and R. Broglie, Transgenic plants with enhanced resistance to the fungal pathogen Rhizoctonia solani. Science, 254 ( 1991 ) 1194-1197. J.M. Neuhaus, P. Ahl+Goy, U. Hinz, S. Flores and F. Meins, High-level expression of a tobacco chitinase gene in Nicotiana sylvestris. Susceptibility of transgenic plants to Cercospora nicotianae infection. Plant Mol. Biol., 16 (1991) 141-151. J.M. Neuhaus, L. Sticher, F. Meins and T. Boiler, A short C-terminal sequence is necessary and sufficient for the targeting of chitinases to the plant vacuole. Proc. Natl. Acad. Sci. USA, 88 (1991) 10362-10366. D. Roby, K. Broglie, R. Cressman, P. Biddle, I. Chet and R. Broglie, Activation of a bean chitinase promoter in transgenic tobacco plants by phytopathogenic fungi. Plant Cell, 2 (1990) 999-1007. S.Y. Bednarek and N.V. Raikhel, The barley lectin carboxy-terminal propeptide is a vacuolar protein sorting determinant in plants. Plant Cell, 3 ( 1991 ) 1195-1206. V. Denecke, J. Botterman and R. Deblaere, Protein secretion in plant cells can occur via a default pathway. Plant Cell, 2 (1990) 51-59. D.C. Hunt and M.J. Chrispeels, The signal peptide of a vacuolar protein is necessary and sufficient for the efficient secretion of a cytosolic protein. Plant Physiol., 96 (1991) 18-25. S. Nakumara, A. Kato and K. Kobayashi, Novel bifunctional lysozyme-dextran conjugate that acts on both Gram-negative and Gram-positive bacteria. Agric. Biol. Chem., 54 (1990) 3057-3059. V.A. Proctor and F.E. Cunningham, The chemistry of lysozyme and its use as a food preservative and a pharmaceutical. CRC Crit. Rev. Food Sci. Nutr., 26 (1988) 359-395. C. Bonifer, M. Vidal, F. Grosveld and A.E. Sippel, Tissue specific and position independent expression of the complete gene domain for chicken lysozyme in transgenic mice. EMBO J., 9 (1990) 2843-2848. B.A. Malcolm, S. Rosenberg, M.J. Corey, J.S. Allen, A. de Baetselier and J.F. Kirsch, Site-directed mutagenesis of the catalytic residues asp-52 and glu-35 of chicken egg white lysozyme. Proc. Natl. Acad. Sci. USA, 86 (1989} 133-137. J. Oberto and J. Davison, Expression of chicken egg white lysozyme by Saccharomyces cerevisiae. Gene, 40 (1985) 57-65. D.B. Archer, D.J. Jeenes, D.A. MacKenzie, G. Brightwell, N. Lambert, G. Lowe, S.E. Radford and C.M. Dobson, Hen egg white lysozyme expressed in and secreted from, Aspergillus niger is correctly processed and folded. Biotechnology, 8 (1990) 741-745. J. Sambrook, E.F. Fritsch and T. Maniatis, Molecular Cloning: A Laboratory Manual, 2nd edn., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989.

67 26

27

28

29 30

31

32

33

34

35

36

37

38

39

A. Jung, A.E. Sippel, M. Grez and G. Schutz, Exons encode functional and structural units of chicken lysozyme. Proc. Natl. Acad. Sci. USA, 77 (1980) 5759-5763. F. Sanger, S. Nicklen and A.R. Coulson, DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA, 56 (1977) 5463-5467. R.W. Davies, DNA sequencing, in: D. Rickwood and B.D. Hames (Eds.), Gel Electrophoresis of Nucleic Acids. A Practical Approach, IRL Press Oxford, 1982, pp. 117-172. D. Hanahan, Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol., 166 (1983) 557-580. S.G. Rogers, R.B. Horsch and R.T. Fraley, Gene transfer in plants: production of transformed plants using Ti plasmid vectors in: A. Weissbach and H. Weissbach (Eds.), Methods for Plant Molecular Biology, Academic Press Inc., San Diego, 1988, pp. 423-436. J.G. Parent and A. Asselin, Detection of pathogenesisrelated (PR or b) and of other proteins in the intercellular fluid of hypersensitive plants infected with tobacco mosaic virus. Can. J. Bot., 62 (1984) 564-569. P. Audy, J. Grenier and A. Asselin, Lysozyme activity in animal extracts after sodium dodecyl sulfate polyacrylamide gel electrophoresis. Comp. Biochem. Physiol., 92B (1989) 523-527. C. Potvin, D. Leclerc, G. Tremblay, A. Asselin and G. Bellemare, Cloning, sequencing and expression of a Bacillus bacteriolytic enzyme in Escherichia coli. Mol. Gen. Genet., 214 (1988) 241-248. B.J. Davis, Disc electrophoresis II. Method and application to human serum proteins. Ann. N.Y. Acad. Sci., 121 (1964) 404-427. J. Grenier, F. C6t6 and A. Asselin, Analysis of extracellular proteins by native polyacrylamide gel electrophoresis with infiltrated tissue; application to pathogenesis-related proteins. Can. J. Bot., 66 (1988J 1227-1229. I. Kumagai, S. Kojima, E. Tamaki and K.-i. Miura, Conversion of trp 62 hen egg-white lysozyme to tyr by sitedirected mutagenesis. J. Biochem., 102 (1987) 733-740. C. Potvin, D. Leclerc, G. Tremblay, A. Asselin and G. Bellemare, Cloning, sequencing and expression of a Bacillus bacteriolytic enzyme in Escherichia coli. Mol. Gen. Genet., 214 (1988) 241-248. E.F. Osserman and D.P. Lawlor, Serum and urinary lysozyme (muraminidase) in monocytic and monomyelocytic leukemia. J. Exp. Med., 124 (1966) 921-951. O. Lie, M. Syed and H. Solbu, Improved agar plate assays

40

41

42

43

44

45

46

47

48

49 50

of bovine lysozyme and haemolytic complement activity. Acta Vet. Scand., 27 (1986) 23-32. R.D. Palmiter, J. Gagnon, L.H. Ericsson and K.A. Walsh, Precursor of egg white lysozyme. Amino acid sequence of an NH2-terminal extension. J. Biol. Chem., 252 (1977) 6386-6393. T. Miki, T. Yasukochi, H. Nagatani, M. Furuno, T. Orita, H. Yamaka, T. Imoto and T. Horiuchi, Construction of a plasmid vector for the regulatable high level expression of eukaryotic genes in Escherichia coli: an application to overproduction of chicken lysozyme. Prot. Eng., 1 (1987) 327-332. G. Fischer and F.X. Schmid, The mechanism of protein folding. Implications of in vitro refolding models for de novo protein folding and translocation in the cell. Biochemistry, 29 (1990) 2205-2212. I. Kumagai and K.-i. Miura, Enhanced bacteriolytic activity of hen egg-white lysozyme due to conversion of trp 62 to other aromatic amino acid residues. J. Biochem., 105 (1989) 946-948. K. Inaka, Y. Taniyama, M. Kikuchi, K. Morikawa, M. Matsushima, The crystal structure of a mutant human lysozyme C77/95A with increased secretion efficiency in yeast. J. Biol. Chem., 266 (1991) 12599-12603. M. Muraki, K. Harata, Y. Hayashi, M. Machida and Y. Jigami, The importance of precise positioning of negatively charged carboxylate in the catalytic action of human lysozyme. Biochim. Biophys. Acta, 1079 (1991) 229-237. F. Omura, Y. Taniyama and M. Kikuchi, Behavior ofcysteine mutants of human lysozyme in de novo synthesis and in vivo secretion. Eur. J. Biochem., 198 (1991) 477-484. Y. Taniyama, R. Kuroki, F. Omura, C. Seko and M. Kikuchi, Evidence for intramolecular disulfide bond shuffling in the folding of mutant human lysozyme. J. Biol. Chem., 266 (1991) 6456-6461. A. Kohara, Y. Yamamoto and M. Kikuchi, Alteration of N-terminal residues of mature human lysozyme affects its secretion in yeast and translocation into canine microsomal vesicles. J. Biol. Chem., 266 11991) 20363-20368. L.M. Gierasch, Signal sequences. Biochemistry, 28 (1989) 923-930. M.E. Digan, S.V. Lair, R.A. Brierley, R.S. Siegel, M.E. Williams, S.B. Ellis, P.A. Kellaris, S.A. Provow, W.S. Craig, G. Veliqelibi, M.M. Harpold and G.P. Thill, Continuous production of a novel lysozyme via secretion from the yeast. Pichia pastoris. Biotechnology, 7 (1989) 160-164.