Expression of amyloid precursor protein mRNAs in endothelial, neuronal and glial cells: modulation by interleukin-1

128

Molecular Brain Research, ~~ (1992) 128- i,~ t, 1992 Elsevier Science Publishers B.V. All rights reserved 0169-328x/t,~2/$05.

BRESM 70510

Expression of amyloid precursor protein mRNAs in endothelial, neuronal and glial cells: modulation by interleukin-I Gianluigi Forloni, Federica Demicheli, Susanna Giorgi, Caterina Bendotti and Nadia Angeretti Istituto di Ricerche Farmacologiche 'Mario Negri', Milan (Italy) (Accepted 30 June 1992)

Key words." Alzheimer's disease; fl-Amyloid; Astrocyte; Gene expression; Cytokine

The origin of/3-amyloid deposited in senile plaques in Alzheimer's disease (AD) is not known. We compared the expression of protein precursor of/3-amyloid (APP) in the cell types involved in plaque formation. The levels of APP mRNA were determined in primary rat neurons and glial cells in culture, human endothelial cells and in a murine brain-derived endothelial cell line. Northern blot analysis was performed using an APP cDNA probe to detect the general APP sequence and an oligonucleotide (40 met) complementary to the sequence of the Kunitz protease inhibitor (APP-KPI). The APP mRNA transcripts were abundant in all three cell types. The highest level of APP, normalized to/3-actin mRNA content, was expressed in neurons, followed by glial cells, where the APP expression was similar (94%) while in endothelial cells was lower (53%). The proportion between APP-KPI mRNA and total APP mRNA was high in endothelial, intermediate in glial and low in neuronal cells. We compared the effects of exposure to intedeukin-1 (IL-1), a cytokine involved in several biological processes and elevated in AD. on APP mRNA expression in neuronal, glial and endothelial cells. In human endothelial and in brain-derived murine endothelial cells we observed a similar increase (50%) of total APP mRNA or APP-KPI mRNA after treatment with human recombinant IL-1/3. In neuronal cells, IL-1 ~200 ng/ml) substantially increased APP mRNA (175%), detected with both probes. In glial cells, the expression of APP mRNA did not appear to be altered by IL-1 (50-400 ng/ml). The results suggest a role of IL-1 in the neuronal mechanisms related to ~-amyloid protein deposition in A D

INTRODUCTION Alzheimer's disease (AD) is neuropathologically characterized by senile plaques, neurofibrillary tangles and cerebrovascular amyloidosis (for review see Wisniesky et al.6°). The filaments of the/3-amyloid protein are the major component of the senile plaques and are deposited in cortical and meningeal blood vessels. /3Amyloid peptide (4.2 kDa) 2° is derived, through a presumably altered metabolism, from a larger transmembrane glycoprotein precursor known us 'amyloid precursor protein' (APP) 26. Cloning of the APP gene 29, mapped on human cromosome 21 and highly conserved across different species, has shown APP mRNA in almost all tissues examined 47'54. Although previous reports excluded that the APP gene and the gene altered in familial AD were the same 56'57, a segregation of mutation in the APP gene with some cases of familial A D 21'42 has now been demonstrated. The gene coding the precursor of/3-amyloid can be

expressed as APP695 or APP563/751/770, depending on the presence of a Kunitz family protease inhibitor (KPI) sequence 14'32'46'55. The use of molecular probes specific for the different APP mRNA indicated that APP695 predominates in mammalian brain tissue 3°'44, In AD and Down's syndrome (DS) brains, an alteration of APP expression in the cerebral cortex has been reported 52 and in the presence of plaques the ratio of APP751 to APP695 appears to be higher s3. Neve et al. 45 showed a specific increase of APP563 mRNA in the nucleus basalis and other regions of AD brain. This 'Alzheimer amyloid precursor, related transcript' lacks the /3-amyloid sequence and it has been suggested that it may interfire with proteolytic breakdown of APP. However, other authors have found no changes in APP splicing 34 or increase of the APP 695 sequence in A D 27. The importance of/3-amyloid in the pathogenesis of AD is further suggested by Yankner et al. 62, who described a neurotoxic effect of synthetic /3-amyloid

Correspondence: G. Forloni, Istituto di Ricerche Farmacologiche 'Mario Negri', Via Eritrea 62, 20157 Milan, Italy. Fax: (39) 2-3546277.

129 and its fragments in primary tissue culture and in rat hippocampus after intracerebral injection 35. Neuronal degeneration has also been observed after intracerebral injection of purified /3-protein from the core of senile plaques 16. There is evidence that /3-amyloid deposition is a consequence of an aberrant proteolytic process combined with an alteration of APP expression (for a review see Selkoe49). However the cellular origin of /3-amyloid in plaques is still not known. The production of APP in cerebral parenchyma was originally attributed only to neuronal c e l l s 5'37, but other authors have shown APP immunoreactivity in glial cells9'5°, other cellular components of neuritic plaques 24'39. Berkenbosch et al. 7 found APP mRNA expression in astrocyte cultures. APP is also expressed in endothelial cells, where the expression is enhanced by interleukin-1 (IL-1) 22 through stimulation of the APP promoter 14. This is interesting since IL-1 immunoreactivity was substantially increased in AD and DS brain 23. To investigate the differences in APP expression, we compared APP transcripts in neuronal, endothelial and glial cells, using two different probes recognizing the total APP mRNA and the Kunitz domain sequence (APP-KPI) mRNA. We also investigated the modulatory role of IL-1 on APP expression in the three cell types involved in plaque formation. MATERIALS AND METHODS

Cortical neuronal culture Brains were removed from fetal rats at embryonic day 17. Cortical cells were dissociated in serum-free medium containing 0.1% trypsin (Difco) and 25 t~g/ml deoxTribonuclease for 5 mln at room temperature, and plated in Primaria (Falcon) 35 mm dishes, precoated with poly-D-lysine (50 p,g/ml; Sigma), 106 cells/dish, in basal medium Eagle (BME-Hanks' salt, Gibco) supplemented with 10% fetal calf serum (FCS, Gibco) and glutamine (2 raM). Cultures were kept at 37"C in a humidified CO 2 atmosphere. After 5-7 days in vitro, non-neuronal cell division was halted by exposure to 10 -5 M cytosine arabinoside, an inhibitor of mitosis, to prevent overgrowth by glial cells. All results reported were obtained from cells cultured for two weeks.

incubated overnight with antiserum anti GFAP (Dako) or neuronspecific enolase monoclonal antibody (Dako). The cells were then washed and incubated for 60 vain with fluorescein-labeled secondary antibody (Jackson Lab.).

Endothelial cell culture Endothelial cells from human umbilical cords were obtained and cultured as described elsewhere 4 The cells were grown to confluence (2-3 weeks) on plastic flasks (Falcon) in Medium 199 supplemented with 20% FCS. The cells were cultured at 37 *C in a water-saturated atmosphere of 95% air-5% CO 2. Similar conditions (15% FCS) were used to culture a mouse endothelioma cell line originally derived from a brain hemangioma ss'59. A recent study indicated this cell line and routine brain capillary endothelial cells had similar biological characteristics s.

mRNA extraction Total cellular RNA was isolated according to the acid guanidinium-phenol-ehloroform (AGPC) method described by Chomczynski and Sacchi 11. Using a denaturing solution containing 4 M guanidinium thiocyanate, 25 mM sodium citrate pH 7.0, 0.5% sarcosyl, 0.1 M 2-mercaptoethanol, the lysate was extracted twice with phenol/isoamyl alcohol/chloroform 24:1: 24 and nucleic acids were precipitated with equal volumes of isopropyl alcohol.

Northern blot analysis This was done as described by Maniatis et al. 4°. Total RNA was separated on 1.2% agarose-formaldehyde gels, transferred to Nylon 66 filters (Gene Screen Plus, Du Pont). On the basis of spectrophometric analysis an equal amount of total RNA was loaded on each line (15-20 ~g). The total APP mRNA probe was a 1.0-kb EcoRI fragment of a mouse eDNA clone representing the /3-amyioid and the proximal 3'-untranslated portion of the / k i p mRNA, and the APP-KPI probe was a 40-base oligodeoxynucleotide specific for the Kunitz protease insert (CACI'ITCCITCAGTGACATCAAAGTACCAGCGGGAGATCA) made on a Beckman 200 A DNA synthesizer. The /3-actin probe was a 0.8 kb fragment from a human eDNA clone corresponding to the sequence published by Hanukiogu et al. 25. The GFAP probe was a 2.5 kb fragment of mouse clone 38, GAP 43 was a 0.7 kb mRNA derived from GA11B clone 6'43. eDNA probes were labeled using a randomly primed DNA labeling kit from Amersham and 32p-dCTP; the oligonucleotide was labeled by 3'-end labeling deoxynucleotidyltransferase (Bethesda Research Laboratories) 32p-dATP. The GAP-43 riboprobe was labeled by the Promega protocol for RNA transcription using 32p-UTP and the specific DNA-dependent RNA polymerase. The labeled probes were purified through a Sephadex 650 column (Pharmacia). The membranes were hybridized to 32p-labeled specific probes, washed in 0.1 × SSC and 0.1% SOS (1% for the oligonucleotide) at 65"C. The blots were exposed to X-ray film at - 80"C with intensifying screens for the time necessary for the signal to be in a linear range for quantification. The exposure time was the same in all experiments for each probe.

Northern blot quantification Glial cell culture Glial cell cultures were taken from newborn rat pups. Using a sterile technique, each pup was decapitated, and the brain was removed and placed in a Petri dish. The ti~ue was separated from meninges and dissociated by trituration with a Pasteur pipette. Glial cells were grown to confluence (three weeks) in Primaria (Falcon) dishes, in Dulbe,cco's modified minimal essential medium (DMEM; Gibco) supplemented with 10% FCS and 2 mM glutamine, and were cultured at 37"C in a water-saturated atmosphere of 95% air-5% CO z. The massive presence of astroo/tes in our preparation was investigated by glial fibrillary acidic protein (GFAP) immunocytochemistry.

lmmunocytochemistry The neuronal and glial cells were washed in phosphate-buffered saline (PBS), pH 7.4, fixed in 4% paraformaldebyde for 90 min and

Densitometric analysis of autoradiograms was done with a RAS 3000 image analyzer (Loats System); the optical density integrated for the area of the hybridized bands was calculated. The signal associated with the presence of/3-actin mRNA was used as internal standard to normalize the APP expression. Similar results were obtained when in some blots the APP mRNA expression was norrealized on mRNA encoding eyclopbylin, an other structural protein 13, or 28S ribosomial RNA. RESULTS

Cell culture characterization To establish the cellular source of APP mRNA cell c u l t u r e h a d t o b e c h a r a c t e r i z e d .

our

The contamina-

130 Neuronal

I--I

i

Glial

< Z

Endothelial II

i

2OO

[] [] []

E

GAP 43

.E

GFAP

neurons glial celbs endoth,cells

~ 100

total APP

E (3_ <

13-actin

0

Total APP Fig. 1. Autoradiograms of Northern blot analysis of R N A extracted from neuronal, glial and endothelial cells hybridized with four different probes recognizing G A P 43, GFAP, /3 actin and total APP m R N A . /3-Actin is used as a quantitative marker of m R N A . High levels of GAP-43 m R N A are evident in the neuronal RNA. In the glial cells this signal is very low compared to/3-actin and it is lacking in endothelial cells. The G F A P m R N A signal, on the other hand, was present in the glial preparation, but absent in the endothelial and neuronal cells. A P P m R N A was found in all three cell preparations.

tion of neurons in the gtial preparation and astrocytes in cultured neurons was investigated by immunocytochemistry and Northern blot analysis. GFAP antiserum immunocytochemistry and enolase-neuron specific monoclonal antibody testing indicated less than 5% of astrocytes in the neuronal preparation, and virtually no neurons in the glial cells (data not shown). Northern blot analyses were done with two cDNA probes recognizing the GAP (growth-associated protein) 43 mRNA, a marker of neuronal cells, and GFAP mRNA, a marker of astroglial cells. Fig 1 illustrates the autoradiograms from the same blot, with RNA extracted from glial, neuronal and endothelial cells, hybridized with four different probes: /3-actin, GAP-43, GFAP, and total APP. In the neuronal preparation the amount of GFAP mRNA normalized on the /3-actin mRNA signal was 2-3% of the GFAP measured in astrocytes, while GAP-43 mRNA in the glial preparation reached 2-5% of the signal found in neuronal cells. These data indicated an acceptable grade of purity of our culture. A P P mRNA expression The expression of total APP mRNA, normalized on /3-actin mRNA, appeared abundant in cortical neurons and glial cells, while in the endothelial cells the amount of APP transcripts was smaller as illustrated in Fig, 2, the expression of APP mRNA in glial cells was very similar to the expression of neuronal APP mRNA (94%). The expression of APP mRNA in human endothelial cells was significantly lower (50%) and results were similar with the brain-derived murine endothelial cell line (data not shown). APP-KPI mRNA was found in all three cell types. The different probes used for the Northern blot analysis made it impossible to establish

APP-KPI

Fig. 2. Total A P P and APP-KPI m R N A expressed in neuronal, glial and endothelial cells. The data are the means_+S.E.M, of 5 - ! 2 determinations. * P < 0.01 vs. respective neuron group, Student's t-test.

the absolute proportions of APP-KPI mRNA and total APP mRNA, but the ratio of APP.KPI m R N A to total APP mRNA was higher in endothelial (1,94) and glial cells (1.54) than in the neuronal preparation. IL-1 effects on APP mRNA in endothelial cells Exposure of human endothelial cells to IL-1 (human recombinant IL-1/3, 100 ng/ml, 6 h) induced about a 50% increase in APP mRNA expression (Fig. 3). The same dose of IL-I in murine endothelial cells had a very similar effect on APP mRNA expression (% control: 100 + 15 (control) vs. 151 + 11, P < 0.0t, Student's t-test). Northern blot analysis with the otigonucleotide probe indicated significant enhancement o f endothelial APP-KPI mRNA expression induced by IL-1 (about 35%, Fig. 3) IL-1 effects on APP rnRNA in neuronal and glial cells Exposure of cortical neuronal cells to IL-1, at the optimal dosage of 200 ng/ml, increased total APP mRNA and APP-KPI mRNA. The time-course of this rise is illustrated in Fig. 4. The increase of total APP mRNA was significant after 6 h, but the maximal effect

200

[] []

Z

Control IL-1,100 ng/ml

.c_

0

o

100

E

0

0 Total APP

APP-KPI

Fig. 3. Effect of h u m a n recombinant IL-lfl on APP-KPI m R N A expression in h u m a n endothelial are the m e a n s + S.E.M. of 5 - 7 determinations. ** 0.05 vs. respective control group, Student's

total APP and cells. The data P < 0:01, * P < t-test.

131

A

IL-1 200 ng/ml control

6h

I

12h

I

24h

~-actin I

I

I

APP

B <~

-h-

[ ] Control

1

BI . . . .

APP-KPI mRNA. In brain tissue the APP without the Kunitz domain was 15-20 times greater than APPKPI 3°. We could not assess the exact proportion between total APP m R N A and APP-KPI because of the different probes employed. However, in cultured neurons, the absolute amount of APP-KPI was detected by Northern blot analysis, which indicated a substantial presence, whereas that in brain homogenate tissue this was detectable only after signal amplifica{ion with the PCR technique 3°. As suggested by LeBlanc et al.36, an

E c-

A

O "

IL-1 I

E 13_ Q. < E3 O

I

I

APP-KPI

Total A P P

APP KPI

Fig. 4. Time-course of the effect of human recombinant IL-1/~ on total APP and APP-KPI mRNA expression in neuronal cells from fetal rat cortex. A: an example of two autoradiograms from Northern blot hybridized with //-actin and total APP-labeled probes. B: the quantification of results. The data are the means of 5 - 6 determinations + S.E.M. * * P < 0.01, * P < 0.05 vs. respective control group, Dunnett's test.

~-actin

B

[ ] Control , 50 ng/ml ,200 ng/ml ,400 ng/ml

Z

rr

was evident after 12 h of exposure; after 24 h the increase was still significant but appeared less dear. A similar time-course was followed by APP-KPI mRNA, although the increase did not reach significance after 6 h of IL-1 exposure (Fig. 4). The influence of IL-1 on APP expression was tested in glial cells. Two different dose-response curves of IL-1 at 6 or 12 h of exposure indicated that the presence of IL-1 did not influence APP expression (Fig. 5). As illustrated in the blot in Fig. 5A and quantified in Fig. 5B, total APP m R N A was unchanged after 6 h of exposure to IL-1 (50-400 ng/ml). The dose-response curve at 12 h showed similar results, although in this case a slight decrease in APP expression was observed at both dosages (Fig. 5C). In contrast with previous findings 7, the blot in Fig. 5A shows the presence of APP-KPI expression in glial cells and this transcript was not altered by IL-1 in the glial cells. DISCUSSION Since the cellular origin of /3-amyloid protein remains undair, we studied APP expression of three cell types potentially sources of fl-amyloid in senile plaque formation. A high level of APP m R N A was observed in rat cortical neurons, together with the expression of

E e-

n~ E 0_ (~. a 0

C ., Z

Total A P P

140

]

n-

120.

"=

100.

E

a~ Oo

[] I

APP-KPI

Control

IL-1 200ng/ml

80.

er

E o.. Q. <: GI

o

40. 20.

0

Total APP

APP-KPI

Fig. 5. Effect of human recombinant IL-1// on total APP and APP-KPI mRNA expression in glial cells. A: an example of a Northern blot with R N A extract from glial cells exposed for 12 h to IL-1, it was hybridized with/3-actin, total APP and APP-KPI probes. The dose-response data at 6 and 12 h of exposure with IL-1 are illustrated in B and C, respectively. The data are the means of 4 - 6 determinations.

132 alteration of APP m R N A may occur in neurons growing in vitro. Investigation of APP m R N A expression in glial cells revealed further differences between cells in culture and in vivo. The in situ hybridization technique showed 5, in agreement with other reports 3"37, the absence of APP m R N A expression in glial cells. We found instead that astrocytes, cultured for 3 weeks, expressed the same amount of APP transcripts as neurons. The APP m R N A in astrocytes was also observed by Berkenbosch et al. 7, although they excluded APPKP! expression in glial cells. These data indicate that in vitro proliferation of glial cells promotes the expression of APP mRNA. APP was observed in glial cells by Siman et al. 5° in the reactive astrocytosis following kainic acid microinjections in rat hippocampus. Deposition of/3-amyloid now appears to be due to a combination of APP overexpression and an aberrant processing of the protein 49. In AD both may occur in glial cells which in normal brain do not express APP. In human endothelial cells and in the brain-derived murine cell line the expression of APP m R N A was evident and the proportion of APP-KPI to total APP was higher than in neuronal and glial cells. This study found that APP m R N A was enhanced by IL-1 in primary neuronal cells. IL-1 receptors have been found in rat brain, localized on neurons 2'31'52. The substantial increase of neuronal APP expression induced by IL-1 suggests a new interaction between glial cells and neurons involved in /3-amyloid deposit and plaque formation 24. IL-1 is produced by astrocytes and microglia ~9 and induced astroglial proliferation after brain injury is. Gliosis provoked by an initial neurodegenerative process may activate a cyclic mechanism mediated by IL-1 that amplifies the consequence on APP expression. There is evidence to support this. Cortical deposition of/3-amyloid was observed in 40% of 15 subjects with a closed head injury, (mean age 52 years) 4~. Thus head injury may induce neuropathological changes like those of AD. Moreover head injury is the most consistently associated environmental factor in AD 41. On the other hand, a dramatic increase of IL-I immunoreactivity was observed in AD and DS brains. IL-1 was found in microglia and astrocytes and also within the senile plaques 23. Production of IL-1 by microglia was abnormal in the animal model of DS, the trisomic 16 mouse 12. Togheter with our results these findings suggest that the high levels of IL-1 in pathological conditions influence neuronal APP expression and promote /3-amyloid deposition. We investigated a wide range of doses and times, but we were unable to show any influence of IL-1 on the APP m R N A expression in glial cells. Exposure to

IL-1 did not modify either total APP mRNA or APPKPI mRNA. The lack of effect was not due to the absence of IL-1 receptors since astrocytes expressed IL-1 receptors and IL-1 activated NGF synthesis 1° in a rat glial preparation. Thus, although astrocytes have been implicated in plaque formation 24'6~ and IL-I was associated with glial proliferation and growth factor secretion by astrocytes ~'j71'~, the cytokinc does not directly enhance APP production in these cells. However, the high level of basal APP expression in glial culture may have prevented further induction of APP m R N A by IL-1. Measurement by in situ hybridization of glial APP in brain sections after an in vivo application of IL-1 would be useful to verify the sensitivity of these cells to the cytokine. According to previous results 22, IL-1 induced APP m R N A in human endothelial cells; we also found that APP expression in the brain-derived endothelial cell line was influenced by IL-1. The fl-amyloid deposition was associated with an increase in the APP751/APP695 ratio 2s'45. In neuronal and endothelial cultures, IL-1 induced a similar increase of total APP and APP-KPI mRNA, indicating that the enhancement of APP expression was not connected with a rise in the APP751/APP695 ratio. In contrast, APP splicing was altered in PC 12 and in neuroblastoma SH-SY5Y cells when APP m R N A was enhanced by a neuronal differentiating stimutus 33"51. Thus, the APP differential splicing appeared associated more with the neuronal differentiation than a consequence of a specific APP m R N A enhancer. The evidence obtained in this study indicates that the production of APP by glial cells is comparable to that in neurons. Stimulation of APP m R N A expression by IL-1 was evident in neuronal cells and in the brainderived endothelial cell line but not in cultured astrocytes. Thus, factors such as IL-1 which modulate the expression of APP appear important. Chronic exposure of the brain to IL-1 or other cytokines might lead to increased neuronal /3-amyloid deposition, but whether the cytokines are implicated in the pathogenesis of AD remains to be established. Acknowledgements. Grateful thanks are due to Mrs. Giovanna Bal-

coni for the precious advices in tissue culture technique, Dr. Maurizio D'incalci for the access to tissue culture facilities, Dr.Ines Martin Padura and Dr. Elisabetta Dejana for providing us with the endothelial cells. This work was partially supported by National Research Council, PsychopharmacologyProject. REFERENCES 1 Araujo, D.M. and Cotman, C., fl-Amyloidstimulates glial cells in vitro to produce growth factors that accumulate in senile plaques in Alzheimer's disease, Brain Res., 569 (1992) 141-145.

133 2 Ban, E., Milon, G., Prudhomme, N., Fillion, G. and Hauor, F., Receptors for interleukin-1 (a and fl) in mouse brain: mapping and neuronal localization in hippocampus, Neuroscience, 43 (1991) 21-30. 3 Bahmanyer, S., Higgins, G.A., Goldgaber, D., Lewis, D.A., Morrison, J.W., Wilson, M.C., Shaker, S.K. and Gajdusek, J.D.C., Localization of amyloid/3 protein messanger RNA in brains from patients with Alzheimer's disease, Science, 237 (1987) 77-80. 4 Barbieri, B., Balconi, G., Dejana, E. and Donati, M.B., Evidence that vascular endothelial cells can induce tha retraction of fibrin clots, Proc. Soc. Exp. Biol. Med., 168 (1981)204-207. 5 Bendotti, C., Forloni, G.L, Morgan, R., O'hara, B.F., OsterGranite, M.L, Reeves, R.H. Gearhart, J.D. and Coyle, J.T., Neuroanatomical localization and quantification of amyloid precursor protein mRNA by in situ hybridization in the brains of normal, aneuploid and lesioned mice, Proc. Nat. Acad. Sci. USA, 85 (1988) 3628-3632. 6 Bendotti,C., Servadio, A. and Samanin, R., Distribution of GAP43 mRNA in the brain stem of adult rats as evidenced by in situ hybridization: localization within monoaminergic neurons, J. Neurosci., 11 (1991) 600-607. 7 Berkenbosch, F., Refolo, L.M., Friedrich Jr., V.L., Casper, D., Blum, M. and Robakis, N.K., The Alzheimer's amyloid precursor protein is produced by type I astrocytes in primary cultures of rat neuroglia, J. Neurosci. Res., 25 (1990) 431-440. 8 Bussolino, F., De Rossi, M., Sica, A., Colotta, F., Wang, J.M., Bocchietto, E., Martin Padura,I., Bosia, A., Dejana, E. and Mantovani, A., Murine endothelioma cell lines transformed by polyoma middle T oncogene as target for and producers of cytokines, J. Immunol., 147 (1991) 2122-2129. 9 Card, J.P. Meade, R.P. and Davis, L.G., Immunocytochemical localization of the precursor protein for //-amyloid in the rat central nervous system, Neuron, 1 (1987) 835-846. 10 Carman-Krzan, M., Vig6, X. and Wise, B.C., Regulation by interleukin 1 of nerve growth factor secretion and nerve growth factor mRNA expression in rat primary astroglial cultures, J. Neurochem., 56 (1991) 536-543. 11 Chomczynsky, P. and Sacchi, W., Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction, Anal. Biochem., 162 (1987) 156-159. 12 Colton, C.A., Yao, J., Taffs, R.E., Keri, J.E. and Oster-Granite, M.L., Abnormal production of interleukin-1 by microglia from trisomy 16 mice, NeuroscL Lett., 132 (1991) 270-274. 13 Danielson, P.E., Forss-Petter, S., Brow, M.A., Calavetta, L., Douglass, J. Milner, R.J. and Sutcliffe, J.G., p1B15: cDNA clone of the rat mRNA encoding cyclophilin, DNA, 7 (1988) 261-267. 14 De Sauvage, F. and Octave, J.N., A novel mRNA of the A4 amyloid precursor gene coding for a possibly secreted protein, Science, 245 (1989) 651-653. 15 Donnelly, R.J., Friedhoff, A.J., Beer, B., Blume, A.J. and Vitek, P., Interleukin-1 stimulates the beta-amyloid precursor protein promoter, Cell. Mol. Neurobiol., 10 (1990) 485-491. 16 Frautschy, S.A., Baird, A. and Cole, G.M., Effects of injected Alzheimer ~-amyioid cores in rat brain, Proc. Natl. Acad. Sci. USA, 88 (1991) 8362-8366. 17 Gadient, R.A. Cron, K.C. and Otten, U., Interleukin-1 fl and tumor necrosis factor-a synergistically stimulate nerve growth factor (NGF) release from cultured rat astrocytes, Neurosci. lett., 117 (1990) 335-340. 18 Giulian, D. and Lachman, L.B., Interleukin-1 stimulation of astroglial proliferation after brain injury, Science, 228 (1985) 497-500. 19 Giulian, D., Baker, T.J., Shih, N. and Eachman, L.B., Interleukin-1 of the central nervous system is produced by ameboid microglia, J. Exp. Med., 164 (1986) 594-604. 20 Glenner, G.G. and Wong, C.W., Alzheimer's disease: initial report of the purification and charcterization of a novel cerebrovascular amyloid protein, Biochem. Biophys. Res. Commun., 120 (1984) 885-890. 21 Goate, A., Chartie-Harlin, M.C., Mullan, M. Brown, J., Crawford, F., Fidani, L., Giuffra, L., Haynes, A., Irving, N., James, L.,

Mant, R., Newton, P., Rooke, IL, Roques, P., Talbot, C., Pericak-Vance, M., Roses, A., WiUiamson, R., Rossor, M., Owen, M. and Hardy, J., Segregation of missense mutation in the amyloid precursor protein gene with familial Alzheimer's disease, Nature, 349 (1991) 704-706. 22 Goldgaber, D., Harris, H.W., Hla, T., Maciag, T., Donnelly, RJ., Jacobsen, J.S., Vitek, M.P. and Gajdusek, D.C., Interleukin-1 regulates synthesis of amyloid /3-protein precursor mRNA in human endothelial cells, Proc. Natl. Acad. Sci. USA, 86 (1989) 7606-761. 23 Griffin, W.S.T., Stanley, LC., Ling, C., White, L., MacLeod, V., Perrot, L.J., White Ill, C.L. and Araoz, C., Brain interleukin-1 and S-100 immunoreactivity are elavated in Down Syndrome and Alzheimer's disease, Proc. Natl. Acad. Sci. USA, 86 (1989) 76117615. 24 Haag, S., Akai, K. and Ishii, T., Demonstration of microglial cells in and around senile (neuritic) plaques in the Alzheimer brain, Acta Neuropathol., 77 (1989) 569-575. 25 Hanokoglu, I, Tanese, N. and Fuchs, E., Complementary DNA sequence of a human cytoplasmatic actin. Interspecies divergence of 3' non coding regions, J. Mol. Biol., 163 (1983) 673-678. 26 Ishiura, S., Proteolytic cleavage of the Alzheimer's disease amyioid A4 precursor protein, Z Neurochem., 56 (1991) 363-369. 27 Jacobsen, J.S., Blume, A.J. and Vitek, M.P., Quantitative measurement of alternatively spliced amyloid precursor protein mRNA expression in Alzheimer's disease and normal brain by S1 nuclease protection analysis, Neurobiol. Aging, 12 (1991) 585-592. 28 Johnson, S.A., McNeill, T., Cordeil, B. and Finch, C.B., Relation of neuronal APP 751/APP 695 and neurite plaque density in Alzheimer's disease, Science, 248 (1990) 854-857. 29 Kang, J., Lemaire, H.G., Unterbeck, A., Salbaum, J.M., Masters, C.L., Grzesehik, K.-H., Multhanp, G., Beyreuther, K. and MullerHill, B., The precursor of Alzheimer's disease amyloid A4 protein resembles a cell-surface receptor, Nature, 325 (1987)733-736. 30 Kang, J. and Muller-Hill, B., Differential splicing of Aizheimer's disease amyioid A4 precursor RNA in rat tissues: pre A4 695 mRNA is predominantly produced in rat and human brain, Biochem. Biophys. ICes. Commun. , 166 (1990) 1192-1200. 31 Katsuura, G., Gottschall, P.E. and Arimura, A., Identification of a high-affinity receptor for interleukin-1 beta in rat brain, Biochem. Biophysic. Res. Commun., 156 (1988) 61-67. 32 Kitaguchi, N., Takahasci, Y., Tokushima, Y., Shiojri, S. and Ito, H., Novel precursor of Alzheimer's disease amyloid protein shows protease inhibitory activity, Nature, 331 (1988) 350-352. 33 Konig, G., Masters, C.L. and Beyreuther, K. Retinoic acid induced differentiated neuroblastoma cells show increased expression of the /3A4 amyloid gene of Alzheimer's disease and an altered splicing pattern, FEBS lett. 269 (1990) 305-310. 34 Konig, G., Salbaum, J.M., Wietsler, O. Lang, W., Schimitt, H.P., Masters, C.L and Beyreuther, K. Alternative splicing of the flA4 amyloid gene of Alzheimer's disease in cortex of control and Alzheimer's diseases patients, Molec. Brain Res. 9 (1991) 259-262. 35 Kowall, N.W., Beal, M.F., Busciglio, L.J. et al (1991) An in vivo model for the neurodegenerative effects of fl-amyloid and protection by substance P, Proc. Nat. Acad. Sci. USA, 88 (1991) 7247-51. 36 Le Blanc, A.C., Chen, H.Y., Autilio-Gambetti, L. and Gambetti, P., APP gene expression in specific cell types of the rat CNS, Soci. Neurosci. Abstr., 21 (1991) 573.7 37 Lewis, D.A., Higgins, G.A., Young, W.G., Goldgaber, D., Gajdusek, D.C., Wilson, C. and Morrison, J.H., Distribution of precursor amyloid-fl-protein messenger RNA in human cerebral cortex: relationship to neurofibrillary tangles and neurite plaques, Proc. Natl. Acad. Sci. USA, 86 (1988) 1691-1695. 38 Lewis, S.A., Balcarek, J.M., Krek, V., Shelanski, M. and Cowan, N.J., Sequence of a cDNA clone encoding mouse gliai fibrillary acidic protein: structural conservation of intermediate filaments, Proc. Natl. Acad. Sci. USA, 81 (1984) 2743-2746. 39 Mandybur, T.I., Chuirazzi, B.A., Astrocytes and the plaques of Alzheimer's disease, Neurology, 40 (1990) 635-639. 40 Maniatis, T., Fritsch, E.F. and Sambrok, J., Molecular Cloning: ,4

134

41

42

43

44

45

46

47

48

49 50

51

52

Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1980. Mortimer, J.A., van Dujin, C.M. and Chandra, V., Head trauma as a risk factor for Alzheimer's disease: a collaborative re-analysis of case-control studies, Int. J. EpidernioL, 20 (1991) $28. Narute, S. Igarashi, S., Kobayashi, H., Inuzuka, T., Kaneko, K., Shmuzu, T., lihara, K., Kojima, T., Miyatake, T. and Tsuji, S., Mis-sense mutation Val-to-ile in exon 17 of amyloid precursor protein gene in Japanese familial Alzheimer's disease. Lancet, 337 (1991) 978-979. Neve, R.L., Perrone-Bizzozero, N.I., Finklestein, S., Zwiers, H. Bird, E. Kurnit, D.M. and Benowitz, L.I., The neuronal growth associated protein GAP-43 (B-50, F1): neuronal specificity, developmental regulation and regional distribution of the huma and rat mRNAs, Mol. Brain Res., 2 (1987)177-183. Neve, R.L., Finch, E. and Dawes, L., Expression of the Alzheimer's amyloid precursor gene transcripts in the human brain, Neuron, 1 (1988) 669-677. Neve, R.L., Rogers, J. and Higgins, G.A., The Alzheimer's amyloid precursor-related transcript lacking the ~ / A 4 sequence is specifically increased in Alzheimer's disease brain, Neuron, 5 (1990) 329-338. Ponte, P., Gonzales-DeWhitt, P., Schilling, J., Miller, J., Hsu, D., Grenberg,b., Davis, K., Wallace, W., Lieberburg, I., Fuller, F. and Cordell, B., A new A4 amyloid mRNA contains a domain homologous to serine protease inhibitors, Nature, 331 (1988) 1080-1084. Robakis, N.K., Ramakrishna, N., Wolfe, G. and Wisnieski, H.M., Molecular cloning ane charcaterization of a cDNA encoding the cerebrovascular and the neuritic plaque amyloid peptides. Proc. Natl. Acad. Sci. USA, 84 (1987) 4190-4194. Roberts, G.W., Gentleman, S.M., Lynch, A. and Graham, D.I., /3A4 amyloid protein deposition in brain after head trauma, Lancet, 338 (1991) 1422-1423. Selkoe, D.J., The molecular pathology of Alzheimer's disease, Neuron, 6 (1991) 487-498. Siman, R. Card, P.J., Nelson, R.B. and Davis, L.G., Expression of /3-amyloid precursor protein in reactive astrocytes following neuronal damage, Neuron, 3 (1989) 275-285. Smith, C.J., Wion, D. and Brachet, P., Nerve growth factor-induced neuronal differentiation is accompanied by differential splicing of /3-amyloid precursor mRNAs in the PC 12 cell line, Mol. Brain Res., 10 (1991) 351-354. Takao, T., Tracey, D.E., Mitchell, W.M. and De Souza, E.B., Interleukin-1 receptors in mouse brain: characterization and neuronal localization, Endocrinology, 127 (1990) 3070-3078.

53 Tanaka, S., Nakamura, S., Ueda, K., Kameyama, M., Shiojiri. S.. Takahashi. Y., Kitaguchi, N. and Ito. H.. Three types of amyloid protein precursor mRNA in human brain: their differential ex pression in Alzheimer's disease, Biochem. Biophys Res. ( 7ommun.. 157 (1988) 472-479. 54 Tanzi, R.E., Gusella, J.F., Watkins, P.C., Bruns, G.A.P., St George-Hyslop, P., Van Keuren, M.L., Patterson, D., Pagan. S., Kurnit, D.M. and Neve, R.L., Amyloid /3 protein gene: cDNA, mRNA distribution, and genetic linkage near the Alzheimer locus, Science, 237 (1987) 77-80. 55 Tanzi, R.E., McClatchey, A.I., Lamperti, E.D., Villa-Kamaroff. L., Gusella, J. and Neve, L.R., Protease inhibitor domain encoded by an amyloid protein precursor mRNA associated with Alzheimer's disease, Nature, 331 (1988) 528-3/1. 56 Van Broeckoven, C.L., Genthe, A.M., Vanderberghe, A., Horstehemeke, B., Backhovens, H., Raeymaekers, P., Van Hull; W., Wehenert, A., Gheuens, J., Cras. P., Bruyland, M., Martin, J.J., Salbaum, M., Multhamp, G. Masters, C.L. Beyreuther, K., Gurling, H.M.D., Mullan, M.J., Holland, A., Barton, A., Irving, N., Williamson, R. Richards, S.J. and Hardy, J.A., Failure of familial Alzheimer's disease to segregate with the A4-amyloid gene in several European families, Nature, 329 (1987) 353-355. 57 Vitek, M.P., Rasool, C., de Sauvage, F., Vitek, S., Bartus, R., Beer, B., Ashton, R., Macq, A., Maloteaux, J. Blume, A. and Octave, J.N., Absence of mutation in the /3-amyloid cDNAs cloned from the brains of three patients with sporadic Alzheimer's disease, Mol. Brain Res., 4 (1988) 121-131. 58 Williams, R.L. Courtneidge, S.A. and Wagner, E.F., Embryonic lethalithies and endothelial tumors in chimeric mice expressing polyoma virus middle T oncogene, Cell, 52 (1988) 121-31, 59 Williams, R.L., Risau, W., Zerwes, H.G., Drexier, H., Aguzzi, A. and Wagner, E.F., Endothelioma cells expressing the polyoma middle T oncogene induce hemangiomas by host cell recruitment, Cell, 57 (1989) 1053-63. 60 Wisniewski, H,M., Bancher, C., Barcinkowska, M., Wen, G.Y. and Currie, J., Spectrum of morphological appearance of amyloid deposits in Alzbeimer's, Acta Neuropathol., 78 (1989) 337-347. 61 Yamaguchi, H., Nakazato, Y., Yamazaki, Y., Dshoj, M., Kawarabayashi, T. and Hirai, S., Subpial /3/A4 amyloid deposition occurs between astroglial processes in Alzheimer-type dementia, Neurosci. Lett., 223 (1991) 217-120. 62)Yankner, B.A., Dully, L.K. and Kirschner, D.A., Neurotrophic neurotoxic effects of amyloid /3 protein: reversal by tachynin neuropeptides, Science, 250 (1990) 279-282.